View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9311-LTR4-TNT-insertion-16 (Length: 464)

Name: F9311-LTR4-TNT-insertion-16
Description: F9311-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9311-LTR4-TNT-insertion-16
F9311-LTR4-TNT-insertion-16
[»] chr2 (17 HSPs)
chr2 (8-456)||(24537343-24537791)
chr2 (321-440)||(25477631-25477750)
chr2 (321-456)||(30651553-30651688)
chr2 (360-456)||(17968284-17968380)
chr2 (321-456)||(9184739-9184873)
chr2 (330-456)||(9180048-9180173)
chr2 (321-456)||(1934313-1934449)
chr2 (362-457)||(18345091-18345186)
chr2 (321-456)||(12797566-12797699)
chr2 (360-455)||(19891802-19891897)
chr2 (359-454)||(19896690-19896785)
chr2 (345-441)||(34495433-34495531)
chr2 (330-456)||(40846911-40847037)
chr2 (360-456)||(12360926-12361022)
chr2 (391-440)||(25496726-25496775)
chr2 (372-427)||(29678448-29678503)
chr2 (333-441)||(15446640-15446749)
[»] chr4 (23 HSPs)
chr4 (321-456)||(16421681-16421816)
chr4 (321-456)||(31274153-31274288)
chr4 (330-456)||(37263885-37264011)
chr4 (360-456)||(8694391-8694487)
chr4 (321-440)||(32220904-32221023)
chr4 (321-456)||(37259185-37259320)
chr4 (363-456)||(31766553-31766646)
chr4 (360-456)||(5270745-5270841)
chr4 (321-456)||(51698561-51698696)
chr4 (321-426)||(19540530-19540635)
chr4 (360-456)||(13060140-13060236)
chr4 (360-440)||(31728703-31728783)
chr4 (373-456)||(12823209-12823292)
chr4 (333-440)||(55252317-55252424)
chr4 (321-456)||(13065125-13065261)
chr4 (360-456)||(19906919-19907015)
chr4 (321-435)||(6943418-6943533)
chr4 (368-456)||(32081490-32081578)
chr4 (345-434)||(33468345-33468434)
chr4 (360-456)||(5927539-5927635)
chr4 (330-441)||(23093753-23093864)
chr4 (391-434)||(33462701-33462744)
chr4 (387-438)||(39216443-39216494)
[»] chr1 (14 HSPs)
chr1 (321-456)||(38621347-38621482)
chr1 (321-456)||(19798321-19798456)
chr1 (330-456)||(33300564-33300690)
chr1 (321-456)||(20107989-20108125)
chr1 (321-456)||(47450545-47450680)
chr1 (360-456)||(10136003-10136099)
chr1 (360-456)||(26927042-26927138)
chr1 (345-456)||(10140756-10140867)
chr1 (360-456)||(25844434-25844530)
chr1 (321-456)||(16648956-16649091)
chr1 (321-440)||(16834114-16834233)
chr1 (360-456)||(51040843-51040939)
chr1 (339-456)||(8138275-8138392)
chr1 (360-456)||(39200083-39200179)
[»] chr3 (17 HSPs)
chr3 (321-456)||(12965209-12965343)
chr3 (321-440)||(55431868-55431987)
chr3 (321-456)||(20520596-20520731)
chr3 (359-456)||(12111929-12112026)
chr3 (321-456)||(23665443-23665579)
chr3 (361-456)||(14438021-14438116)
chr3 (321-456)||(46964651-46964786)
chr3 (330-456)||(3419637-3419763)
chr3 (363-456)||(18467893-18467986)
chr3 (360-456)||(32473345-32473441)
chr3 (360-456)||(55326455-55326551)
chr3 (321-440)||(757701-757820)
chr3 (321-456)||(7570536-7570672)
chr3 (372-456)||(27709621-27709705)
chr3 (382-456)||(12971136-12971210)
chr3 (386-456)||(18472710-18472780)
chr3 (321-416)||(23660824-23660920)
[»] chr7 (15 HSPs)
chr7 (321-456)||(3880603-3880738)
chr7 (321-456)||(21671832-21671968)
chr7 (321-440)||(4930861-4930980)
chr7 (321-440)||(10387694-10387814)
chr7 (321-456)||(8268935-8269070)
chr7 (321-456)||(42625909-42626044)
chr7 (321-456)||(3046208-3046342)
chr7 (321-456)||(12800026-12800160)
chr7 (376-456)||(3285189-3285269)
chr7 (361-440)||(26341886-26341965)
chr7 (321-456)||(27238790-27238925)
chr7 (363-454)||(44509720-44509811)
chr7 (321-440)||(10392433-10392552)
chr7 (321-456)||(2595464-2595597)
chr7 (321-441)||(16373031-16373150)
[»] chr8 (19 HSPs)
chr8 (330-456)||(17021000-17021126)
chr8 (330-456)||(17551437-17551563)
chr8 (321-456)||(1808086-1808221)
chr8 (321-456)||(40125216-40125351)
chr8 (321-456)||(17026558-17026693)
chr8 (321-456)||(17557050-17557185)
chr8 (372-456)||(1910274-1910358)
chr8 (321-456)||(23547937-23548073)
chr8 (321-432)||(19167287-19167398)
chr8 (360-456)||(15950874-15950970)
chr8 (360-456)||(33417208-33417304)
chr8 (321-418)||(38181601-38181698)
chr8 (372-456)||(17026831-17026915)
chr8 (372-456)||(17557323-17557407)
chr8 (372-456)||(44925236-44925320)
chr8 (382-439)||(33100092-33100149)
chr8 (321-432)||(18875734-18875844)
chr8 (345-439)||(26779787-26779883)
chr8 (372-409)||(2966318-2966355)
[»] scaffold0054 (1 HSPs)
scaffold0054 (321-456)||(29815-29949)
[»] chr6 (20 HSPs)
chr6 (321-456)||(6407182-6407317)
chr6 (321-456)||(11559537-11559672)
chr6 (321-456)||(25313774-25313909)
chr6 (321-456)||(26201268-26201403)
chr6 (330-456)||(19994718-19994844)
chr6 (330-454)||(22694688-22694812)
chr6 (321-456)||(20747623-20747758)
chr6 (321-456)||(11534027-11534162)
chr6 (321-456)||(33686969-33687103)
chr6 (330-456)||(2699414-2699540)
chr6 (360-456)||(8748438-8748534)
chr6 (372-456)||(17963880-17963964)
chr6 (345-456)||(5856644-5856755)
chr6 (345-456)||(11428624-11428735)
chr6 (321-456)||(14509612-14509747)
chr6 (321-456)||(4156672-4156807)
chr6 (321-456)||(16835485-16835614)
chr6 (321-456)||(17600006-17600146)
chr6 (360-440)||(17914264-17914344)
chr6 (411-456)||(11613230-11613275)
[»] chr5 (17 HSPs)
chr5 (321-456)||(39519034-39519169)
chr5 (360-456)||(12103704-12103800)
chr5 (360-456)||(26667956-26668052)
chr5 (360-456)||(26939553-26939649)
chr5 (321-440)||(37248139-37248256)
chr5 (333-456)||(39523685-39523808)
chr5 (321-441)||(16115569-16115689)
chr5 (360-456)||(36424316-36424412)
chr5 (321-456)||(20180476-20180611)
chr5 (372-455)||(29167296-29167379)
chr5 (360-440)||(6154771-6154851)
chr5 (360-456)||(7452431-7452527)
chr5 (360-440)||(37537276-37537356)
chr5 (360-440)||(37646395-37646475)
chr5 (321-456)||(6511958-6512093)
chr5 (372-456)||(40148586-40148670)
chr5 (321-434)||(35779931-35780043)
[»] scaffold0352 (1 HSPs)
scaffold0352 (360-456)||(7786-7882)
[»] scaffold0002 (2 HSPs)
scaffold0002 (321-456)||(4703-4838)
scaffold0002 (321-440)||(443280-443399)
[»] scaffold0057 (1 HSPs)
scaffold0057 (360-456)||(35802-35898)
[»] scaffold0690 (1 HSPs)
scaffold0690 (360-439)||(5907-5984)
[»] scaffold0240 (1 HSPs)
scaffold0240 (338-456)||(4628-4747)


Alignment Details
Target: chr2 (Bit Score: 404; Significance: 0; HSPs: 17)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 404; E-Value: 0
Query Start/End: Original strand, 8 - 456
Target Start/End: Complemental strand, 24537791 - 24537343
Alignment:
8 aaaggaaacaatacatttgacaagacccaaacatacaagagctacaaagataattttgaaagaaatnnnnnnnccacaaatctctctaaaatgcaaattg 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||    
24537791 aaaggaaacaatacatttgacaagacccaaacatacaagagctacaaagataattttgaaagaaataaaaaaaccacaaatctctctaaaatgcaaattg 24537692  T
108 cattccatcannnnnnnnattcttatatgactatttataagctaagtttgatagatagaaaaaactaatcaccacattttgtaagtgcctttccctagaa 207  Q
    ||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24537691 cattccatcattttttttattcttatatgactatttataagctaagtttgatagatagaaaaaactaatcaccacattttgtaagtgcctttccctagaa 24537592  T
208 aacaaacataaactaagaaataaattcctactaggcttacagaaacaaaagatagctacaaaatccagccttaaaataatacaaaagtccatcgagttgt 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24537591 aacaaacataaactaagaaataaattcctactaggcttacagaaacaaaagatagctacaaaatccagccttaaaataatacaaaagtccatcgagttgt 24537492  T
308 acaaaagatagctactcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattg 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24537491 acaaaagatagctactcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattg 24537392  T
408 cgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
24537391 cgccaacagttactctaatggataagatcaaaagagaatttatccatta 24537343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 321 - 440
Target Start/End: Complemental strand, 25477750 - 25477631
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||||||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| || |||||||    
25477750 actcaatgaaactctttggtgtgttttttgaattgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacagcagttac 25477651  T
421 tctaatggataagatcaaaa 440  Q
    ||||||||||||||| ||||    
25477650 tctaatggataagattaaaa 25477631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 30651553 - 30651688
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||| |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||| | ||||||||||    
30651553 actcaataaaactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgtgacaacagttac 30651652  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    |||| |||||||||| ||||   | |||||||||||    
30651653 tctagtggataagattaaaatgaagtttatccatta 30651688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 360 - 456
Target Start/End: Complemental strand, 17968380 - 17968284
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||| ||||||||||| ||||||||||||||||||||||||| |||| ||| |||||||||||    
17968380 gagtcctctatttatatagagattctgtaactgttttaccaaaaattgcgacaacagttactctaatggataagattaaaatagagtttatccatta 17968284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 9184873 - 9184739
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| | | | ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||| ||||    
9184873 actcaatgaaactctttggtgtg-tttttgaacttagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacaattac 9184775  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
9184774 tctaatggataagattaaaatggagtttatccatta 9184739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 330 - 456
Target Start/End: Complemental strand, 9180173 - 9180048
Alignment:
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    |||||||||||||  |||||||| | | | ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||| |||||||||||||    
9180173 aactctttggtgtg-tttttgaacttagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacaattactctaatgga 9180075  T
430 taagatcaaaagagaatttatccatta 456  Q
    |||||| ||||  || |||||||||||    
9180074 taagattaaaatggagtttatccatta 9180048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 1934449 - 1934313
Alignment:
321 actcaatagaactctttggtgtacttttt-gaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtta 419  Q
    |||||||  |||||||||||||  ||||| ||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| |||||||||    
1934449 actcaatgaaactctttggtgtgtttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagtta 1934350  T
420 ctctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||| |||||||||| ||||   | |||||||||||    
1934349 ctctagtggataagattaaaatgaagtttatccatta 1934313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 362 - 457
Target Start/End: Original strand, 18345091 - 18345186
Alignment:
362 gtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccattag 457  Q
    ||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||| ||||||||||||||||| ||||  || ||||||||||||    
18345091 gtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagtcactctaatggataagattaaaatggagtttatccattag 18345186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 12797566 - 12797699
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  ||||| |||||| |  |||||||| | |||||||||  ||||||||||||||||| ||||||||| |||||||  |    
12797566 actcaatgaaactctttggtgt--tttttaaattgagtgcagtcctctatttatatagagaatttgtaactgttttagcgaaaattgcgacaacagtcgc 12797663  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
12797664 tctaatggataagattaaaatggagtttatccatta 12797699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 360 - 455
Target Start/End: Complemental strand, 19891897 - 19891802
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatt 455  Q
    ||||||||| | ||||||||| || ||||||| ||||||||||||||||| ||| |||| |||||||||||||||| ||||  || ||||||||||    
19891897 gagtcctctatttatatagagattctgtaactattttagcaaaaattgcgacaatagtttctctaatggataagattaaaatggactttatccatt 19891802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 359 - 454
Target Start/End: Original strand, 19896690 - 19896785
Alignment:
359 agagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccat 454  Q
    |||||||||| | ||||||||| |||||||| ||||||| ||||||||||| ||  ||||| ||||| ||||||||||||||| ||| ||||||||    
19896690 agagtcctctatttatatagagattttgtaattgttttaacaaaaattgcggcaggagttagtctaacggataagatcaaaagggaacttatccat 19896785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 345 - 441
Target Start/End: Complemental strand, 34495531 - 34495433
Alignment:
345 tttttgaattgattagagtcctctctatatatagagct--tttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaag 441  Q
    ||||||||| || | ||||||||| | ||||||||| |  |||||||||||||||||  |||||||| ||||| |||||||||||||||||||||||||    
34495531 tttttgaatcgagtggagtcctctatttatatagagatattttgtaactgttttagctgaaattgcgacaacaattactctaatggataagatcaaaag 34495433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 330 - 456
Target Start/End: Complemental strand, 40847037 - 40846911
Alignment:
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    |||||||| ||||  ||||||||  || | ||||||||| | ||||||||  |||||||| | ||||||||||||||||| ||||||||| |||||||||    
40847037 aactcttttgtgtgatttttgaaccgagtggagtcctctgtttatatagaaattttgtaattattttagcaaaaattgcggcaacagttattctaatgga 40846938  T
430 taagatcaaaagagaatttatccatta 456  Q
    ||  ||||||||  ||||||| |||||    
40846937 tagtatcaaaaggaaatttattcatta 40846911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 12360926 - 12361022
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| |  ||||||||||||||||||| || ||||   | |||||||||||    
12360926 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacggcagttactctaatggataaaattaaaatgaagtttatccatta 12361022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 391 - 440
Target Start/End: Complemental strand, 25496775 - 25496726
Alignment:
391 tgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaa 440  Q
    |||||||||| |||||||| ||||||||||||||||||||||||| ||||    
25496775 tgttttagcacaaattgcgacaacagttactctaatggataagattaaaa 25496726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 372 - 427
Target Start/End: Original strand, 29678448 - 29678503
Alignment:
372 tatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatg 427  Q
    |||||||||  | ||||||||||||||||||||||||| ||||| |||||||||||    
29678448 tatatagagagtctgtaactgttttagcaaaaattgcgacaacaattactctaatg 29678503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 333 - 441
Target Start/End: Complemental strand, 15446749 - 15446640
Alignment:
333 tctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgt-tttagcaaaaattgcgccaacagttactctaatggata 431  Q
    ||||| ||||| ||| |||| ||| || | |||||| | |||||||||  ||| ||||||| |||||| |||| |||| ||||| |||||||  ||||||    
15446749 tctttagtgtaatttatgaactgagtaaaatcctctatttatatagagactttttaactgtatttagctaaaactgcgtcaacaattactcttgtggata 15446650  T
432 agatcaaaag 441  Q
    ||||||||||    
15446649 agatcaaaag 15446640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 76; Significance: 6e-35; HSPs: 23)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 16421681 - 16421816
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||||| ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||    
16421681 actcaatgaaactctttggtgtgttttttgaactgattggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttac 16421780  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
16421781 tctaatggataagattaaaatggagtttatccatta 16421816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 31274153 - 31274288
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||    
31274153 actcaatgaaactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttac 31274252  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    |||| |||||||||| ||||  || |||||||||||    
31274253 tctagtggataagattaaaatggagtttatccatta 31274288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 330 - 456
Target Start/End: Complemental strand, 37264011 - 37263885
Alignment:
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| |||||||||||||| ||||    
37264011 aactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctagtgga 37263912  T
430 taagatcaaaagagaatttatccatta 456  Q
    |||||| ||||  || |||||||||||    
37263911 taagattaaaatggagtttatccatta 37263885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 8694391 - 8694487
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
8694391 gagtcctctatttatatagagattttgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 8694487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 440
Target Start/End: Complemental strand, 32221023 - 32220904
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||| ||||||||| |||||||| ||| | ||||||||| | ||||||||| || |||||||||||||||| |||||||| ||||||||||    
32221023 actcaatgaaactttttggtgtattttttgaactgagtggagtcctctatttatatagagattatgtaactgttttagcataaattgcgacaacagttac 32220924  T
421 tctaatggataagatcaaaa 440  Q
    ||||||||||||||| ||||    
32220923 tctaatggataagattaaaa 32220904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 37259320 - 37259185
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||| ||||    
37259320 actcaatgaaactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattgtgtaactgttttagcaaaaattgcgacaacaattac 37259221  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    |||| |||||||||| ||||  || |||||||||||    
37259220 tctagtggataagattaaaatggagtttatccatta 37259185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 363 - 456
Target Start/End: Original strand, 31766553 - 31766646
Alignment:
363 tcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  ||||||||||||||    
31766553 tcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggaatttatccatta 31766646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 360 - 456
Target Start/End: Complemental strand, 5270841 - 5270745
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
5270841 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 5270745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 51698561 - 51698696
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  ||| |||| ||| | ||||| ||| | ||||||||| || ||||| ||||||||||||||||||| ||||||||||    
51698561 actcaatgaaactctttggtgtgttttatgaactgagtggagtcatctatttatatagagattctgtaattgttttagcaaaaattgcgacaacagttac 51698660  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
51698661 tctaatggataagattaaaatggagtttatccatta 51698696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 321 - 426
Target Start/End: Complemental strand, 19540635 - 19540530
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||| || || |||||||| ||| | ||||||||| | ||||||||| |||||||||||||||| ||||||||||| ||||||||||    
19540635 actcaatgaaactctttagtttattttttgaactgagtggagtcctctatttatatagagattttgtaactgttttatcaaaaattgcgacaacagttac 19540536  T
421 tctaat 426  Q
    ||||||    
19540535 tctaat 19540530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 13060140 - 13060236
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| |||||||||||||||||||||||||||| ||| ||| ||||| || |||||||| |||| ||| |||||||||||    
13060140 gagtcctctatttatatagagattttgtaactgttttagcaaaaattgcgacaaaagtcactctgatagataagattaaaatagagtttatccatta 13060236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 31728783 - 31728703
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaa 440  Q
    ||||||||| | ||||||||| || |||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||    
31728783 gagtcctctatttatatagagattctgtaactgttttggcaaaaattgcgacaacagttactctaatggataagattaaaa 31728703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 373 - 456
Target Start/End: Complemental strand, 12823292 - 12823209
Alignment:
373 atatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||||| || || |||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
12823292 atatagagattctgcaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 12823209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 333 - 440
Target Start/End: Original strand, 55252317 - 55252424
Alignment:
333 tctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataa 432  Q
    ||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||  |||||||||||||||| |    
55252317 tctttggtgtgttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacagtagttactctaatggatga 55252416  T
433 gatcaaaa 440  Q
    ||| ||||    
55252417 gattaaaa 55252424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 13065261 - 13065125
Alignment:
321 actcaatagaa-ctctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaa-ttgcgccaacagtt 418  Q
    ||||||||||| |||||||||||  |||||||| | | | ||||||| | | ||||||||| |||||||||||| |||||||||| || ||| |  ||||    
13065261 actcaatagaaactctttggtgtgttttttgaactaagtggagtcctgtatttatatagagattttgtaactgtattagcaaaaaatttcgc-agtagtt 13065163  T
419 actctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||||||||||| ||| ||||||||||    
13065162 actctaatggataagatcaaaagggaacttatccatta 13065125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 19906919 - 19907015
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| |||||||| ||||||||||| ||||||| ||||||| ||||||||||||||||| |||   || |||||||||||    
19906919 gagtcctctatttatatagagattttgtaattgttttagcaacaattgcgacaacagtcactctaatggataagatgaaattggagtttatccatta 19907015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 321 - 435
Target Start/End: Original strand, 6943418 - 6943533
Alignment:
321 actcaatagaa-ctctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtta 419  Q
    ||||||||||| ||||||| |||  |||||||| ||| ||||||||| | | ||||| ||| ||||||| |||||||||| ||||||||| ||  |||||    
6943418 actcaatagaaactctttgatgtgatttttgaactgagtagagtcctatgtttatattgagattttgtagctgttttagcgaaaattgcgacagtagtta 6943517  T
420 ctctaatggataagat 435  Q
    ||||||||||||||||    
6943518 ctctaatggataagat 6943533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 368 - 456
Target Start/End: Complemental strand, 32081578 - 32081490
Alignment:
368 tctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||| ||||||| || |||||||||||||||| |||||||| |||||||||||||||| |||||||| ||||   | |||||||||||    
32081578 tctatttatagagattctgtaactgttttagcataaattgcgacaacagttactctaatcgataagattaaaatgaagtttatccatta 32081490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 345 - 434
Target Start/End: Complemental strand, 33468434 - 33468345
Alignment:
345 tttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataaga 434  Q
    |||||||| ||| | ||||||||| | |||||| || || |||||||||||||||||||||| || |  |||||||||||||||||||||    
33468434 tttttgaactgagtggagtcctctatttatataaagattctgtaactgttttagcaaaaattacgactgcagttactctaatggataaga 33468345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 360 - 456
Target Start/End: Complemental strand, 5927635 - 5927539
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||| ||| || ||||| |||||||||||| |||| | ||||||||||||||||||||||||| ||||   | |||||||||||    
5927635 gagtcctctatttatatggagattctgtaattgttttagcaaatattgtgacaacagttactctaatggataagattaaaatgaagtttatccatta 5927539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 330 - 441
Target Start/End: Original strand, 23093753 - 23093864
Alignment:
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    ||||||||| |||  |||||||| ||| | ||||||||| | ||| ||||| ||||||||| | ||||   ||||||||| ||||| |||| ||| ||||    
23093753 aactctttgatgtgttttttgaactgagtggagtcctctatttatttagaggttttgtaaccggtttaattaaaattgcggcaacaattacactagtgga 23093852  T
430 taagatcaaaag 441  Q
    ||||||||||||    
23093853 taagatcaaaag 23093864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 391 - 434
Target Start/End: Complemental strand, 33462744 - 33462701
Alignment:
391 tgttttagcaaaaattgcgccaacagttactctaatggataaga 434  Q
    ||||||||||||||||||| ||||| ||||||||||||||||||    
33462744 tgttttagcaaaaattgcgacaacaattactctaatggataaga 33462701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 387 - 438
Target Start/End: Complemental strand, 39216494 - 39216443
Alignment:
387 taactgttttagcaaaaattgcgccaacagttactctaatggataagatcaa 438  Q
    ||||||||||| | ||||||||| ||| ||||| ||||||||||||||||||    
39216494 taactgttttaactaaaattgcgacaatagttaatctaatggataagatcaa 39216443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 76; Significance: 6e-35; HSPs: 14)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 38621347 - 38621482
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| |||||||||||||||||||||||||||| ||||||||||    
38621347 actcaatgaaactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattttgtaactgttttagcaaaaattgcgacaacagttac 38621446  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
38621447 tctaatggataagattaaaatggagtttatccatta 38621482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 19798456 - 19798321
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||| |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||  ||||||||||    
19798456 actcaatgaaactctttggtgtattttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcaacaacagttac 19798357  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
19798356 tctaatggataagattaaaatggagtttatccatta 19798321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 330 - 456
Target Start/End: Complemental strand, 33300690 - 33300564
Alignment:
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| |||||||||||||||||||||||||||  || ||||||||||||||||    
33300690 aactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattttgtaactgttttagcaaaaattgcaacagcagttactctaatgga 33300591  T
430 taagatcaaaagagaatttatccatta 456  Q
    |||||| ||||  || |||||||||||    
33300590 taagattaaaatggagtttatccatta 33300564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 20107989 - 20108125
Alignment:
321 actcaatagaa-ctctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtta 419  Q
    ||||||||||| |||||||||||| |||| ||| ||| ||||||||| | | ||||||||| |||| |||||||||||||||||||| |  |||||||||    
20107989 actcaatagaatctctttggtgtaattttagaactgagtagagtcctatatttatatagagattttttaactgttttagcaaaaattacaacaacagtta 20108088  T
420 ctctaatggataagatcaaaagagaatttatccatta 456  Q
    || ||||||||||||| |||| |||| ||||||||||    
20108089 ctttaatggataagattaaaaaagaacttatccatta 20108125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 47450680 - 47450545
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  ||||||||| |||  ||||| || ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||| | ||||||||||    
47450680 actcaatgaaactctttgatgtgttttttaaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgtgacaacagttac 47450581  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| |||| ||| |||||||||||    
47450580 tctaatggataagattaaaatagagtttatccatta 47450545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 10136003 - 10136099
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
10136003 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 10136099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 360 - 456
Target Start/End: Complemental strand, 26927138 - 26927042
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
26927138 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 26927042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 345 - 456
Target Start/End: Original strand, 10140756 - 10140867
Alignment:
345 tttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagaga 444  Q
    |||||||||| | | ||||||||| | |||| |||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  ||    
10140756 tttttgaattaagtggagtcctctatttatacagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatgga 10140855  T
445 atttatccatta 456  Q
     |||||||||||    
10140856 gtttatccatta 10140867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 25844434 - 25844530
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| |||||||||||||| |||||||||| ||||  || |||||||||||    
25844434 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctagtggataagattaaaatggagtttatccatta 25844530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 16649091 - 16648956
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||| ||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||| ||||| ||||||||||| ||||||||||    
16649091 actcaatgaaactttttggtgtgttttttgaactgagtggagtcctctatttatatagagattctgtaactattttaacaaaaattgcgacaacagttac 16648992  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||   | |||||||||||    
16648991 tctaatggataagattaaaatgaagtttatccatta 16648956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 321 - 440
Target Start/End: Original strand, 16834114 - 16834233
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||| | |||||| | | | ||||||||| | ||||||||| |||||||||||||||||| |||||||||  |||| ||||    
16834114 actcaatgaaactctttggtgtattgtttgaactaagtggagtcctctatttatatagagattttgtaactgttttagccaaaattgcgataacaattac 16834213  T
421 tctaatggataagatcaaaa 440  Q
    ||||||||||||||| ||||    
16834214 tctaatggataagattaaaa 16834233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 360 - 456
Target Start/End: Complemental strand, 51040939 - 51040843
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| |||||||||||||||||||||| || ||||   | |||||||||||    
51040939 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataaaattaaaatgaagtttatccatta 51040843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 339 - 456
Target Start/End: Original strand, 8138275 - 8138392
Alignment:
339 gtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaa 438  Q
    ||||| |||||||| ||| |  ||| |||| | ||||||||| |||||||||||||||||||||| ||||  ||  ||||||||||| ||||||||||||    
8138275 gtgtaatttttgaactgagtgaagttctctatttatatagagattttgtaactgttttagcaaaagttgcagcagtagttactctaacggataagatcaa 8138374  T
439 aagagaatttatccatta 456  Q
    ||| ||| ||||||||||    
8138375 aagggaacttatccatta 8138392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 360 - 456
Target Start/End: Complemental strand, 39200179 - 39200083
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || |||| |||||||||||||||||||| || |||||||||||| ||||||||| ||||  || |||||||||||    
39200179 gagtcctctatttatatagagattatgtagctgttttagcaaaaattgcgacagcagttactctaacggataagattaaaatggagtttatccatta 39200083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 72; Significance: 1e-32; HSPs: 17)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 12965343 - 12965209
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||| |||||||| ||||| |||||||| ||| | ||||| | | | ||||||||| |||||||||||||||| ||||||||||| | ||||||||    
12965343 actcaataaaactcttttgtgtaatttttgaactgagtggagtcttttatttatatagagattttgtaactgttttaacaaaaattgcggc-acagttac 12965245  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||||||||||||| ||||||||||    
12965244 tctaatggataagatcaaaagagaacttatccatta 12965209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 321 - 440
Target Start/End: Original strand, 55431868 - 55431987
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||| ||||| |||||| | ||||||||| | ||||||||| || ||||||||||||| ||||||||||| ||||||||||    
55431868 actcaatgaaactctttggtgtattttttaaattgagtggagtcctctatttatatagagattctgtaactgttttaacaaaaattgcgacaacagttac 55431967  T
421 tctaatggataagatcaaaa 440  Q
    ||||||||||||||| ||||    
55431968 tctaatggataagattaaaa 55431987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 20520596 - 20520731
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||| |||| ||| ||| | ||||||||| | ||||| ||| ||||||||| |||||||||||||||||| |||||| |||    
20520596 actcaatgaaactctttggtgtaattttggaactgagtggagtcctctatttatatcgagattttgtaaccgttttagcaaaaattgcgacaacagatac 20520695  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
20520696 tctaatggataagattaaaatggagtttatccatta 20520731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 359 - 456
Target Start/End: Complemental strand, 12112026 - 12111929
Alignment:
359 agagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||||||| | ||||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||| ||||  ||| ||||||||||    
12112026 agagtcctctatttatatagagattttgtaactgttttagcaaaaattgcggcaacaattactctaatggataagattaaaaaggaacttatccatta 12111929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 23665579 - 23665443
Alignment:
321 actcaatagaactctttggtgtacttttt-gaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtta 419  Q
    |||||||  |||||||||||||  ||||| ||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| |||||||||    
23665579 actcaatgaaactctttggtgtgtttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagtta 23665480  T
420 ctctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||| |||||||||| ||||  || |||||||||||    
23665479 ctctagtggataagattaaaatggagtttatccatta 23665443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 361 - 456
Target Start/End: Complemental strand, 14438116 - 14438021
Alignment:
361 agtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
14438116 agtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 14438021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 46964651 - 46964786
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| ||  |||||| |||||| |||||||||| ||||||||||    
46964651 actcaatgaaactctttggtgtgatttttgaactgagtggagtcctctatttatatagagattcagtaactattttagtaaaaattgcgacaacagttac 46964750  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
46964751 tctaatggataagattaaaatggagtttatccatta 46964786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 330 - 456
Target Start/End: Original strand, 3419637 - 3419763
Alignment:
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || | ||||| ||||||||||||||||| ||||||||||||||||| |    
3419637 aactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattctctaactattttagcaaaaattgcgacaacagttactctaatgaa 3419736  T
430 taagatcaaaagagaatttatccatta 456  Q
    |||||| ||||  || |||||||||||    
3419737 taagattaaaatggattttatccatta 3419763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 363 - 456
Target Start/End: Original strand, 18467893 - 18467986
Alignment:
363 tcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
18467893 tcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 18467986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 360 - 456
Target Start/End: Complemental strand, 32473441 - 32473345
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||| ||||||||||||||||||| ||||  || |||||||||||    
32473441 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacaattactctaatggataagattaaaatggagtttatccatta 32473345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 55326455 - 55326551
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||| ||||||||||||||||||| ||||  || |||||||||||    
55326455 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacaattactctaatggataagattaaaatggagtttatccatta 55326551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 321 - 440
Target Start/End: Complemental strand, 757820 - 757701
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||  ||| | |||| |||| | ||||||||| || ||||||||||||||||||||||||| ||||| ||||    
757820 actcaatgaaactctttggtgtgttttttgagctgagtggagttctctatttatatagagattatgtaactgttttagcaaaaattgcgacaacaattac 757721  T
421 tctaatggataagatcaaaa 440  Q
    ||||||||||||||| ||||    
757720 tctaatggataagattaaaa 757701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 7570672 - 7570536
Alignment:
321 actcaatagaactctttggtgtacttttt-gaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtta 419  Q
    |||||||  |||||||||||||  ||||| ||| ||| | ||||||||| | ||||||||| || |||||||||||||||||||| |||| ||||| |||    
7570672 actcaatgaaactctttggtgtgtttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaactgcgacaacaatta 7570573  T
420 ctctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||||||||||||| ||||   | |||||||||||    
7570572 ctctaatggataagattaaaatgaagtttatccatta 7570536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 372 - 456
Target Start/End: Original strand, 27709621 - 27709705
Alignment:
372 tatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| || ||||||||||||||||||||||||| ||||||| ||||||||||||||||| ||||  || |||||||||||    
27709621 tatatagagattctgtaactgttttagcaaaaattgcgacaacagtaactctaatggataagattaaaatggagtttatccatta 27709705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 382 - 456
Target Start/End: Complemental strand, 12971210 - 12971136
Alignment:
382 ttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    |||| ||||| ||||||||||||||||| |||||||||||||||| |||||||| ||||||||| ||||||||||    
12971210 ttttataactattttagcaaaaattgcggcaacagttactctaattgataagataaaaagagaacttatccatta 12971136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 386 - 456
Target Start/End: Original strand, 18472710 - 18472780
Alignment:
386 gtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
18472710 gtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 18472780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 321 - 416
Target Start/End: Complemental strand, 23660920 - 23660824
Alignment:
321 actcaatagaactctttggtgtacttttt-gaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacag 416  Q
    |||||||  |||||||||||||  ||||| ||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||    
23660920 actcaatgaaactctttggtgtgtttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacag 23660824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 68; Significance: 3e-30; HSPs: 15)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 3880603 - 3880738
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||| ||| ||| | ||||||||| | ||||||||| |||||||||| ||||||||||||||||| || |||||||    
3880603 actcaatgaaactctttggtgtgtttttagaactgagtggagtcctctatttatatagagattttgtaactattttagcaaaaattgcgacagcagttac 3880702  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||| ||||||||  ||||||||||||||    
3880703 tctaatggatacgatcaaaatggaatttatccatta 3880738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 21671832 - 21671968
Alignment:
321 actcaatagaa-ctctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtta 419  Q
    ||||||||||| ||||||||| |  |||||||| ||| | |||| |||| | ||||||||| |||||||||||||||||||||||||||| |||||||||    
21671832 actcaatagaaactctttggtatgatttttgaactgagtggagtactctatttatatagagattttgtaactgttttagcaaaaattgcggcaacagtta 21671931  T
420 ctctaatggataagatcaaaagagaatttatccatta 456  Q
     |||||| ||||| |||||||| ||| ||||||||||    
21671932 atctaatagataatatcaaaagggaacttatccatta 21671968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 440
Target Start/End: Original strand, 4930861 - 4930980
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||| ||||    
4930861 actcaatgaaactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacaattac 4930960  T
421 tctaatggataagatcaaaa 440  Q
    ||||||||||||||| ||||    
4930961 tctaatggataagattaaaa 4930980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 321 - 440
Target Start/End: Complemental strand, 10387814 - 10387694
Alignment:
321 actcaatagaa-ctctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtta 419  Q
    ||||||||||| ||||||| |||  |||||||| | | | ||||||||| | ||||||||| |||||||||| ||||||||||||||||| |||||||||    
10387814 actcaatagaaactctttgatgtgatttttgaactaagtggagtcctctatttatatagagattttgtaactattttagcaaaaattgcggcaacagtta 10387715  T
420 ctctaatggataagatcaaaa 440  Q
    |||| ||||||||||||||||    
10387714 ctctgatggataagatcaaaa 10387694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 8268935 - 8269070
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||| ||||||||  || ||||||||||| | ||| ||||| |||| ||||||||||||||||||||||| |   ||||||    
8268935 actcaatgaaactctttggtgtaatttttgaaccgagtagagtcctctatttatttagagattttataactgttttagcaaaaattgcgacggaagttac 8269034  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
8269035 tctaatggataagattaaaatggagtttatccatta 8269070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 42626044 - 42625909
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  ||||| |||||||| |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| |||| ||||     
42626044 actcaatgaaactcattggtgtaatttttgaactgagtggagtcctctatttatatagagattatgtaactgttttagcaaaaattgcgacaactgttat 42625945  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||| |||||||| ||||  || |||||||||||    
42625944 tctaatagataagattaaaattgagtttatccatta 42625909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 3046208 - 3046342
Alignment:
321 actcaatagaa-ctctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtta 419  Q
    ||||||||||| || ||||||||| |||||||| ||| |||| || ||| |  |||||||| ||| ||||||||||||||||||||||||  ||||||||    
3046208 actcaatagaaactttttggtgtaatttttgaactgagtagaatcatctattgatatagagattt-gtaactgttttagcaaaaattgcgg-aacagtta 3046305  T
420 ctctaatggataagatcaaaagagaatttatccatta 456  Q
    || ||||||||||||||||||| ||| ||||||||||    
3046306 ctttaatggataagatcaaaagggaacttatccatta 3046342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 12800026 - 12800160
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| | | |  |||||||| | ||||||| | || ||||||||||||||||||||||| | ||||||||||    
12800026 actcaatgaaactctttggtgtgttttttgaactaagtgaagtcctctatttatatagtgattctgtaactgttttagcaaaaattg-gacaacagttac 12800124  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||||||||  || |||||||||||    
12800125 tctaatggataagatcaaaatggagtttatccatta 12800160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 376 - 456
Target Start/End: Original strand, 3285189 - 3285269
Alignment:
376 tagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||| |||||||||| ||||||||||||| ||| |||||||||| |||||||||||||||||||| ||| ||||||||||    
3285189 tagagattttgtaactattttagcaaaaatcgcggcaacagttacactaatggataagatcaaaagggaacttatccatta 3285269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 361 - 440
Target Start/End: Original strand, 26341886 - 26341965
Alignment:
361 agtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaa 440  Q
    |||||||| | ||||||||| || |||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||    
26341886 agtcctctatttatatagagattctgtaactgttttcgcaaaaattgcgacaacagttactctaatggataagattaaaa 26341965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 27238790 - 27238925
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  || ||||| ||| | ||||||||| | ||||||||| |||||||||||||||||||||||||||   | ||||||     
27238790 actcaatgaaactctttggtgtgtttattgaactgagtggagtcctctatttatatagagattttgtaactgttttagcaaaaattgcaatagcagttag 27238889  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    | ||||||||||||| ||||  || |||||||||||    
27238890 tttaatggataagattaaaattgagtttatccatta 27238925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 363 - 454
Target Start/End: Complemental strand, 44509811 - 44509720
Alignment:
363 tcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccat 454  Q
    |||||| | ||||||||  |||| ||||||||||||||||||||||| || |||||||||||||||||||||| ||||  ||||||||||||    
44509811 tcctctatttatatagaaattttttaactgttttagcaaaaattgcgacagcagttactctaatggataagattaaaatggaatttatccat 44509720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 321 - 440
Target Start/End: Complemental strand, 10392552 - 10392433
Alignment:
321 actcaatagaa-ctctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtta 419  Q
    ||||||||||| ||||||| |||  |||||||| ||| | ||||||||| | ||||||||| ||||| ||||||||| |||||||||||| ||||| |||    
10392552 actcaatagaaactctttgatgtgatttttgaactgagtggagtcctctatttatatagagattttg-aactgttttggcaaaaattgcggcaacaatta 10392454  T
420 ctctaatggataagatcaaaa 440  Q
    || | ||||||||||||||||    
10392453 ctttgatggataagatcaaaa 10392433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 2595464 - 2595597
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||| ||||  |||||||| ||| | |||||||||  || ||||||| ||||| |||||||||||||||||||| | || |||||||    
2595464 actcaatgaaactctttcgtgtgttttttgaactgagtggagtcctct--atttatagagattttgcaactgttttagcaaaaattgtgacagcagttac 2595561  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    | ||||||||||||| ||||   | |||||||||||    
2595562 tttaatggataagattaaaatgcagtttatccatta 2595597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 321 - 441
Target Start/End: Original strand, 16373031 - 16373150
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    ||||||||||||||||||||||  |||||||||||| | ||||||| | | |||||||   |||||||||||||||| | ||| ||||  |||||  |||    
16373031 actcaatagaactctttggtgtgatttttgaattgagtggagtcctttatttatatagtaattttgtaactgttttaactaaatttgcaacaaca-atac 16373129  T
421 tctaatggataagatcaaaag 441  Q
    |||||||||||| ||||||||    
16373130 tctaatggataaaatcaaaag 16373150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 67; Significance: 1e-29; HSPs: 19)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 330 - 456
Target Start/End: Original strand, 17021000 - 17021126
Alignment:
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    |||||||||||||  || ||||| ||| | ||||||||| | |||| |||| |||||||||||||||||||||||||||| ||| |||||||||||||||    
17021000 aactctttggtgtgtttcttgaactgagtggagtcctctatttatacagagattttgtaactgttttagcaaaaattgcgacaatagttactctaatgga 17021099  T
430 taagatcaaaagagaatttatccatta 456  Q
    |||||| |||| ||| |||||||||||    
17021100 taagattaaaatagagtttatccatta 17021126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 330 - 456
Target Start/End: Original strand, 17551437 - 17551563
Alignment:
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    |||||||||||||  || ||||| ||| | ||||||||| | |||| |||| |||||||||||||||||||||||||||| ||| |||||||||||||||    
17551437 aactctttggtgtgtttcttgaactgagtggagtcctctatttatacagagattttgtaactgttttagcaaaaattgcgacaatagttactctaatgga 17551536  T
430 taagatcaaaagagaatttatccatta 456  Q
    |||||| |||| ||| |||||||||||    
17551537 taagattaaaatagagtttatccatta 17551563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 1808086 - 1808221
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||| ||||||||  |||||||| ||| |  |||| ||| | ||||||||| |||||||||||||||||||||||||||| || |||||||    
1808086 actcaatgaaactttttggtgtgttttttgaactgagtgtagtcttctatttatatagagattttgtaactgttttagcaaaaattgcgacagcagttac 1808185  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||||||||  || |||||||||||    
1808186 tctaatggataagatcaaaatggagtttatccatta 1808221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 40125351 - 40125216
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||| | ||||| ||||    
40125351 actcaatgaaactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgagacaacaattac 40125252  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
40125251 tctaatggataagattaaaatggagtttatccatta 40125216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 17026558 - 17026693
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||||||| | ||||||||| | ||||||||| || ||||| ||||||||||||||||||  || || ||||    
17026558 actcaatgaaactctttggtgtgttttttgaattgagtggagtcctctatttatatagagattctgtaattgttttagcaaaaattgcaacagcaattac 17026657  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
17026658 tctaatggataagattaaaattgagtttatccatta 17026693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 17557050 - 17557185
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||||||| | ||||||||| | ||||||||| || ||||| ||||||||||||||||||  || || ||||    
17557050 actcaatgaaactctttggtgtgttttttgaattgagtggagtcctctatttatatagagattctgtaattgttttagcaaaaattgcaacagcaattac 17557149  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
17557150 tctaatggataagattaaaattgagtttatccatta 17557185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 372 - 456
Target Start/End: Complemental strand, 1910358 - 1910274
Alignment:
372 tatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| || ||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||  || |||||||||||    
1910358 tatatagagattctgtaactgttttagcaaaaattgcgacaacagttactataatggataagattaaaatggagtttatccatta 1910274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 23548073 - 23547937
Alignment:
321 actcaatagaa-ctctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtta 419  Q
    ||||||||||| |||||||||||  |||||||| |   | ||||||||| | ||||||||| || |||||||||||||||||||||||   |||||||||    
23548073 actcaatagaaactctttggtgtgatttttgaactaggtggagtcctctatttatatagagattgtgtaactgttttagcaaaaattgaagcaacagtta 23547974  T
420 ctctaatggataagatcaaaagagaatttatccatta 456  Q
     | ||||| ||||||||||||||||| |||| |||||    
23547973 atttaatgaataagatcaaaagagaacttatacatta 23547937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 321 - 432
Target Start/End: Original strand, 19167287 - 19167398
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||| ||| | ||||||||| |||||||||||||| ||||||||||||| ||||| ||||    
19167287 actcaatgaaactctttggtgtgttttttgaactgagtggagtcttctatttatatagagattttgtaactgtttcagcaaaaattgcgacaacaattac 19167386  T
421 tctaatggataa 432  Q
    | ||||||||||    
19167387 tgtaatggataa 19167398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 360 - 456
Target Start/End: Complemental strand, 15950970 - 15950874
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| || || ||||||||||| ||||||| ||||  || |||||||||||    
15950970 gagtcctctttttatatagagattctgtaactgttttagcaaaaattgcgacagcaattactctaatgaataagattaaaatggagtttatccatta 15950874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 33417208 - 33417304
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| |||||||||||||||||||||||||||  ||||||||||||| ||| ||||||| ||||   | |||||||||||    
33417208 gagtcctctatttatatagagattttgtaactgttttagcaaaaattgcaacaacagttactctcatgaataagattaaaatgaagtttatccatta 33417304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 321 - 418
Target Start/End: Complemental strand, 38181698 - 38181601
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtt 418  Q
    |||||||  |||||||||||||  ||||| || ||| | ||||||||| | ||||||||| ||||||||| |||||||||||||||||| ||||||||    
38181698 actcaatgaaactctttggtgtgttttttaaactgagtggagtcctctatttatatagagattttgtaaccgttttagcaaaaattgcgacaacagtt 38181601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 372 - 456
Target Start/End: Original strand, 17026831 - 17026915
Alignment:
372 tatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| || ||||||||||||||||||||||||  || || ||||||||||||||||||| ||||  || |||||||||||    
17026831 tatatagagattctgtaactgttttagcaaaaattgcaacagcaattactctaatggataagattaaaattgagtttatccatta 17026915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 372 - 456
Target Start/End: Original strand, 17557323 - 17557407
Alignment:
372 tatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| || ||||||||||||||||||||||||  || || ||||||||||||||||||| ||||  || |||||||||||    
17557323 tatatagagattctgtaactgttttagcaaaaattgcaacagcaattactctaatggataagattaaaattgagtttatccatta 17557407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 372 - 456
Target Start/End: Complemental strand, 44925320 - 44925236
Alignment:
372 tatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| || ||||||||||||||||||||||||  || |||||||||||||||||||||| ||||   | |||||||||||    
44925320 tatatagagattctgtaactgttttagcaaaaattgcaacagcagttactctaatggataagattaaaatgaagtttatccatta 44925236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 382 - 439
Target Start/End: Original strand, 33100092 - 33100149
Alignment:
382 ttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaa 439  Q
    |||||||| || |||||| ||||||||| ||||| |||||||||||||||||||||||    
33100092 ttttgtaattggtttagctaaaattgcgacaacaattactctaatggataagatcaaa 33100149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 321 - 432
Target Start/End: Complemental strand, 18875844 - 18875734
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||| ||||||  || ||||| ||| | ||||||||| | ||||||||| || ||||||||||||| ||||||||||| ||  ||||||    
18875844 actcaatgaaactctatggtgtgtttattgaactgagtggagtcctctatttatatagagattctgtaactgtttta-caaaaattgcgacattagttac 18875746  T
421 tctaatggataa 432  Q
    ||||||| ||||    
18875745 tctaatgaataa 18875734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 345 - 439
Target Start/End: Original strand, 26779787 - 26779883
Alignment:
345 tttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagc---aaaaattgcgccaacagttactctaatggataagatcaaa 439  Q
    |||||||||||| | |||||| || | ||||||||| |||||||||| |||||||   |||||||||| ||||| |||||||||  ||||||||||||    
26779787 tttttgaattgagtggagtcc-ctgtttatatagagattttgtaactattttagcaaaaaaaattgcggcaacaattactctaacagataagatcaaa 26779883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 372 - 409
Target Start/End: Original strand, 2966318 - 2966355
Alignment:
372 tatatagagcttttgtaactgttttagcaaaaattgcg 409  Q
    ||||||||| ||||||||||| ||||||||||||||||    
2966318 tatatagagattttgtaactgctttagcaaaaattgcg 2966355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0054 (Bit Score: 64; Significance: 8e-28; HSPs: 1)
Name: scaffold0054
Description:

Target: scaffold0054; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 29815 - 29949
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||||| ||||||||| | ||||||||| || | |||||||||||| |||||||||| ||||||||||    
29815 actcaatgaaactctttggtgtg-tttttgaactgattggagtcctctatttatatagagattctataactgttttagaaaaaattgcgacaacagttac 29913  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
29914 tctaatggataagattaaaatggagtttatccatta 29949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 64; Significance: 8e-28; HSPs: 20)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 6407317 - 6407182
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  ||||||||| |||  |||||||||||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||| ||||    
6407317 actcaatgaaactctttgatgtgttttttgaattgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacaattac 6407218  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||   | |||||||||||    
6407217 tctaatggataagattaaaatgaagtttatccatta 6407182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 11559672 - 11559537
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | |||| |||| || |||||||||||||||||||||||||  |||||||||    
11559672 actcaatgaaactctttggtgtgttttttgaactgagtggagtcctctatttataaagagattctgtaactgttttagcaaaaattgcgataacagttac 11559573  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
11559572 tctaatggataagattaaaatggagtttatccatta 11559537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 25313909 - 25313774
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||| |||||||| | | | ||||| ||| | ||||||||| || ||||||||||||||||||||||| | ||||||||||    
25313909 actcaatgaaactctttggtgtattttttgaactaagttgagtcatctatttatatagagattctgtaactgttttagcaaaaattgtgacaacagttac 25313810  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
25313809 tctaatggataagattaaaaaggagtttatccatta 25313774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 26201403 - 26201268
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||| |||||||| | | | ||||| ||| | ||||||||| || ||||||||||||||||||||||| | ||||||||||    
26201403 actcaatgaaactctttggtgtattttttgaactaagttgagtcatctatttatatagagattctgtaactgttttagcaaaaattgtgacaacagttac 26201304  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
26201303 tctaatggataagattaaaaaggagtttatccatta 26201268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 330 - 456
Target Start/End: Complemental strand, 19994844 - 19994718
Alignment:
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    |||||||||||||| |||||||| ||| | ||||||||| | ||||||||| ||||||||||||||||||||||||| || || ||| ||||||||| ||    
19994844 aactctttggtgtaatttttgaactgagtggagtcctctatttatatagagattttgtaactgttttagcaaaaattacgacatcagatactctaattga 19994745  T
430 taagatcaaaagagaatttatccatta 456  Q
    |||||| |||||  || ||||||||||    
19994744 taagataaaaaggtaaattatccatta 19994718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 330 - 454
Target Start/End: Complemental strand, 22694812 - 22694688
Alignment:
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    |||||||||||||  |||||||| | | | || |||||| | ||||||||| |||||||||||||||||||||||||||| ||||| |||||||||| ||    
22694812 aactctttggtgtgatttttgaacttagtggaatcctctgtttatatagagattttgtaactgttttagcaaaaattgcggcaacaattactctaataga 22694713  T
430 taagatcaaaagagaatttatccat 454  Q
    |||||||||||  ||| ||||||||    
22694712 taagatcaaaatggaacttatccat 22694688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 20747758 - 20747623
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  ||||| || ||| | ||||||||| | ||||||||| ||| |||||||||||||||||||||| | || |||||||    
20747758 actcaatgaaactctttggtgtgattttttaactgagtggagtcctctatttatatagagatttggtaactgttttagcaaaaattgtgacagcagttac 20747659  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
20747658 tctaatggataagattaaaatggagtttatccatta 20747623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 11534162 - 11534027
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| |  |||||||| | |||| |||| || |||||||||||||||||||||||||  | |||||||    
11534162 actcaatgaaactctttggtgtgttttttgaactgagtgaagtcctctatttataaagagattctgtaactgttttagcaaaaattgcggtagcagttac 11534063  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
11534062 tctaatggataagattaaaatggagtttatccatta 11534027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 33687103 - 33686969
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||| ||||||| ||||||||||| || |||||||    
33687103 actcaatgaaactctttggtgtg-tttttgaactgagtggagtcctctatttatatagagattctgtaattgttttaacaaaaattgcgacagcagttac 33687005  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||||| |||||| ||||| || |||||||||||    
33687004 tctaatggttaagattaaaagggagtttatccatta 33686969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 330 - 456
Target Start/End: Complemental strand, 2699540 - 2699414
Alignment:
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    |||| ||||||||  |||||||| ||| |  | |||||| | ||||||||| ||||||||||||||||| |||||||||| || ||||||||||||||||    
2699540 aactatttggtgtgttttttgaactgagtgaattcctctatttatatagagattttgtaactgttttagtaaaaattgcgacagcagttactctaatgga 2699441  T
430 taagatcaaaagagaatttatccatta 456  Q
    |||||| ||||  || |||||||||||    
2699440 taagattaaaattgagtttatccatta 2699414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 8748438 - 8748534
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||| | ||||| ||||||||||||||||||| ||||  || |||||||||||    
8748438 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgagacaacaattactctaatggataagattaaaatggagtttatccatta 8748534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 372 - 456
Target Start/End: Complemental strand, 17963964 - 17963880
Alignment:
372 tatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| || ||||||||||||| ||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
17963964 tatatagagattctgtaactgttttaccaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 17963880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 345 - 456
Target Start/End: Original strand, 5856644 - 5856755
Alignment:
345 tttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagaga 444  Q
    ||||| || ||| ||||||||||| | ||||||||| |||||||||| ||||||||||||||||| ||  |||| |||||||||||||||| ||||  ||    
5856644 ttttttaactgagtagagtcctctatttatatagagattttgtaactattttagcaaaaattgcgacagtagtttctctaatggataagattaaaatgga 5856743  T
445 atttatccatta 456  Q
     |||||||||||    
5856744 gtttatccatta 5856755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 345 - 456
Target Start/End: Original strand, 11428624 - 11428735
Alignment:
345 tttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagaga 444  Q
    |||||||| ||| | ||||||||| | ||||||||| |||||||||| |||||||||||||| ||  | |||||||||||||||||||||| ||||  ||    
11428624 tttttgaactgagtggagtcctctatttatatagagattttgtaactcttttagcaaaaattacgatagcagttactctaatggataagattaaaatgga 11428723  T
445 atttatccatta 456  Q
     |||||||||||    
11428724 gtttatccatta 11428735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 14509612 - 14509747
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| | | | ||||||||| | |||| |||| |||||||| ||||||||||||||||||| ||||| ||||    
14509612 actcaatgaaactctttggtgtgttttttgaacttagtggagtcctctatttataaagagattttgtaaatgttttagcaaaaattgcgacaacaattac 14509711  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||| ||||||| ||||   | |||||||||||    
14509712 tctaatgtataagattaaaatgaagtttatccatta 14509747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 4156807 - 4156672
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||| ||||||||| |||||||| ||| | ||||||| | | |||||| || || ||||||||||||||||||||||||  ||| ||||||    
4156807 actcaatgaaactttttggtgtaatttttgaactgagtggagtcctttatttatatatagattctgtaactgttttagcaaaaattgcaacaagagttac 4156708  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||||| |||||| ||||   | |||||||||||    
4156707 tctaatgggtaagattaaaatgaagtttatccatta 4156672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 16835614 - 16835485
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||      ||||||||||| ||||||||||    
16835614 actcaatgaaactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattctgtaactg------caaaaattgcgacaacagttac 16835521  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    |||| |||||||||| ||||  || |||||||||||    
16835520 tctagtggataagattaaaatggagtttatccatta 16835485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 17600006 - 17600146
Alignment:
321 actcaatagaa-ctctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaatt----gcgccaaca 415  Q
    ||||||||||| |||||| ||||  |||||||| ||| |  |||||||| | ||| ||||| |||||||| | |||||| |||||||    ||| |||||    
17600006 actcaatagaaactctttagtgtgatttttgaactgagtgaagtcctctatttatttagagattttgtaatttttttagtaaaaattaattgcggcaaca 17600105  T
416 gttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||| ||||||||||||||||||| || |||| |||||    
17600106 gttactcaaatggataagatcaaaagaaaacttattcatta 17600146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 17914264 - 17914344
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaa 440  Q
    ||||||||| |  |||||||| |||||||||| |||||||||||||||||  |  ||||||||||| |||||| |||||||    
17914264 gagtcctctattaatatagagattttgtaacttttttagcaaaaattgcggtagaagttactctaacggataatatcaaaa 17914344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 411 - 456
Target Start/End: Complemental strand, 11613275 - 11613230
Alignment:
411 caacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||||||||||||||||||||||||||| |||  ||||||||||    
11613275 caacagttactctaatggataagatcaaaaaagatcttatccatta 11613230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 64; Significance: 8e-28; HSPs: 17)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 39519034 - 39519169
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||| |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||| | ||||||||||    
39519034 actcaataaaactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgtgacaacagttac 39519133  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    |||| |||||||||| ||||   | |||||||||||    
39519134 tctagtggataagattaaaatgaagtttatccatta 39519169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 12103704 - 12103800
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||||| ||||  || |||||||||||    
12103704 gagtcctctatttatatagagattttgtaactgttttagcaaaaattgcgacaacagttactctaaaggataagattaaaatggagtttatccatta 12103800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 26667956 - 26668052
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
26667956 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 26668052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 26939553 - 26939649
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
26939553 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 26939649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 321 - 440
Target Start/End: Complemental strand, 37248256 - 37248139
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||| ||||    
37248256 actcaatgaaactctttggtgt--tttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacaattac 37248159  T
421 tctaatggataagatcaaaa 440  Q
    ||||||||||||||| ||||    
37248158 tctaatggataagattaaaa 37248139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 333 - 456
Target Start/End: Original strand, 39523685 - 39523808
Alignment:
333 tctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataa 432  Q
    ||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| |||||||||||||| |||||||    
39523685 tctttggtgtgttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctagtggataa 39523784  T
433 gatcaaaagagaatttatccatta 456  Q
    ||| ||||   | |||||||||||    
39523785 gattaaaatgaagtttatccatta 39523808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 321 - 441
Target Start/End: Complemental strand, 16115689 - 16115569
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||| |||||||||||||  |||||||| ||| | || |||||| | ||||||||| |||||||| ||||||||| ||||||||| |||||  |||    
16115689 actcaatataactctttggtgtgatttttgaactgagtggaatcctctgtttatatagagattttgtaaatgttttagctaaaattgcggcaacatgtac 16115590  T
421 tctaatggataagatcaaaag 441  Q
    | |||||||||||||||||||    
16115589 tttaatggataagatcaaaag 16115569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 36424316 - 36424412
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||   | |||||||||||    
36424316 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatgaagtttatccatta 36424412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 20180611 - 20180476
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||| ||| | ||||||||||    
20180611 actcaatgaaactctttggtgtgatttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaagttgagacaacagttac 20180512  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||||||||| || ||||   | |||||||||||    
20180511 tctaatggataatattaaaatgaagtttatccatta 20180476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 372 - 455
Target Start/End: Complemental strand, 29167379 - 29167296
Alignment:
372 tatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatt 455  Q
    ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || ||||||||||    
29167379 tatatagagattctgtaactgttttagcaaaaattgcggcaacagttactctaatggataagattaaaatggagtttatccatt 29167296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 6154851 - 6154771
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaa 440  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| || |||||||||||||||||||||| ||||    
6154851 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacatcagttactctaatggataagattaaaa 6154771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 7452431 - 7452527
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || |||| |||||||||||||||||||| |||||||||||||||||||||| || ||||  || |||||||||||    
7452431 gagtcctctatttatatagagattctgtatctgttttagcaaaaattgcgacaacagttactctaatggataaaattaaaatggagtttatccatta 7452527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 37537356 - 37537276
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaa 440  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||| ||||||| ||||    
37537356 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatgaataagattaaaa 37537276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 37646475 - 37646395
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaa 440  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||| | ||||||||||||||||||||||||| ||||    
37646475 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgtgacaacagttactctaatggataagattaaaa 37646395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 6512093 - 6511958
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  ||||||||| |||  |||||||| ||| | ||||||||| | ||||||||| || || ||||||||||||||||| |||| |||||||||     
6512093 actcaatgaaactctttgatgtgttttttgaactgagtggagtcctctatttatatagagattctgcaactgttttagcaaaaaatgcgacaacagttaa 6511994  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||   | |||||||||||    
6511993 tctaatggataagattaaaatgaagtttatccatta 6511958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 372 - 456
Target Start/End: Original strand, 40148586 - 40148670
Alignment:
372 tatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| || | ||| ||||||||||||||||||| ||||||||||||||||||||| ||| ||||   | |||||||||||    
40148586 tatatagagattctataattgttttagcaaaaattgcgacaacagttactctaatggatatgattaaaatgaagtttatccatta 40148670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 321 - 434
Target Start/End: Complemental strand, 35780043 - 35779931
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    ||||||| |||||||||||| |  ||||||||  || | ||||||||| | ||||||||| |||||||||   |||||| ||||||||| || |  ||||    
35780043 actcaatggaactctttggtatgttttttgaaccgagtggagtcctctat-tatatagagattttgtaacgagtttagctaaaattgcggcatcgcttac 35779945  T
421 tctaatggataaga 434  Q
    |||| |||||||||    
35779944 tctagtggataaga 35779931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0352 (Bit Score: 61; Significance: 5e-26; HSPs: 1)
Name: scaffold0352
Description:

Target: scaffold0352; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 7786 - 7882
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
7786 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 7882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 60; Significance: 2e-25; HSPs: 2)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 4703 - 4838
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||| ||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||    
4703 actcaatgaaactctttggtgtgttttttgaactgagtggagtcatctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttac 4802  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    |||| |||||||||| ||||   | |||||||||||    
4803 tctagtggataagattaaaatgaagtttatccatta 4838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 321 - 440
Target Start/End: Complemental strand, 443399 - 443280
Alignment:
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | | ||||||| || ||||||||||||||||||||||| | ||  ||||||    
443399 actcaatgaaactctttggtgtgttttttgaactgagtggagtcctctatttgtatagagattctgtaactgttttagcaaaaattgtgacagtagttac 443300  T
421 tctaatggataagatcaaaa 440  Q
    ||||||||||||||| ||||    
443299 tctaatggataagataaaaa 443280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 49; Significance: 7e-19; HSPs: 1)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 35802 - 35898
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||  ||||||||||||||||||||| |||||| || |||||||||||||||||||||| ||||   | |||||||||||    
35802 gagtcctctgtttatatagaaattttgtaactgttttagcaaacattgcgacagcagttactctaatggataagattaaaatgaagtttatccatta 35898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0690 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0690
Description:

Target: scaffold0690; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 360 - 439
Target Start/End: Original strand, 5907 - 5984
Alignment:
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaa 439  Q
    ||||||||| | ||||||||| ||||||||||||||||||||||||||||||  ||  | ||||||||||||||||||||    
5907 gagtcctctatttatatagagattttgtaactgttttagcaaaaattgcgcc--caaatgctctaatggataagatcaaa 5984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0240 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: scaffold0240
Description:

Target: scaffold0240; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 338 - 456
Target Start/End: Original strand, 4628 - 4747
Alignment:
338 ggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggat-aagatc 436  Q
    |||||| |||||||| ||| | ||||||||| ||||||||||| |||||||| |||||||||||||||| |   |  |||||||||||||||| |||||     
4628 ggtgtaatttttgaactgagtggagtcctctgtatatatagagattttgtaattgttttagcaaaaattacagtagtagttactctaatggataaagatg 4727  T
437 aaaagagaatttatccatta 456  Q
    ||||  ||| ||||||||||    
4728 aaaatggaacttatccatta 4747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 95074 times since January 2019
Visitors: 2228