View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9311-LTR4-TNT-insertion-16 (Length: 464)

Name: F9311-LTR4-TNT-insertion-16
Description: F9311-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9311-LTR4-TNT-insertion-16
[»] chr2 (17 HSPs)
chr2 (8-456)||(24537343-24537791)
chr2 (321-440)||(25477631-25477750)
chr2 (321-456)||(30651553-30651688)
chr2 (360-456)||(17968284-17968380)
chr2 (321-456)||(9184739-9184873)
chr2 (330-456)||(9180048-9180173)
chr2 (321-456)||(1934313-1934449)
chr2 (362-457)||(18345091-18345186)
chr2 (321-456)||(12797566-12797699)
chr2 (360-455)||(19891802-19891897)
chr2 (359-454)||(19896690-19896785)
chr2 (345-441)||(34495433-34495531)
chr2 (330-456)||(40846911-40847037)
chr2 (360-456)||(12360926-12361022)
chr2 (391-440)||(25496726-25496775)
chr2 (372-427)||(29678448-29678503)
chr2 (333-441)||(15446640-15446749)
[»] chr4 (23 HSPs)
chr4 (321-456)||(16421681-16421816)
chr4 (321-456)||(31274153-31274288)
chr4 (330-456)||(37263885-37264011)
chr4 (360-456)||(8694391-8694487)
chr4 (321-440)||(32220904-32221023)
chr4 (321-456)||(37259185-37259320)
chr4 (363-456)||(31766553-31766646)
chr4 (360-456)||(5270745-5270841)
chr4 (321-456)||(51698561-51698696)
chr4 (321-426)||(19540530-19540635)
chr4 (360-456)||(13060140-13060236)
chr4 (360-440)||(31728703-31728783)
chr4 (373-456)||(12823209-12823292)
chr4 (333-440)||(55252317-55252424)
chr4 (321-456)||(13065125-13065261)
chr4 (360-456)||(19906919-19907015)
chr4 (321-435)||(6943418-6943533)
chr4 (368-456)||(32081490-32081578)
chr4 (345-434)||(33468345-33468434)
chr4 (360-456)||(5927539-5927635)
chr4 (330-441)||(23093753-23093864)
chr4 (391-434)||(33462701-33462744)
chr4 (387-438)||(39216443-39216494)
[»] chr1 (14 HSPs)
chr1 (321-456)||(38621347-38621482)
chr1 (321-456)||(19798321-19798456)
chr1 (330-456)||(33300564-33300690)
chr1 (321-456)||(20107989-20108125)
chr1 (321-456)||(47450545-47450680)
chr1 (360-456)||(10136003-10136099)
chr1 (360-456)||(26927042-26927138)
chr1 (345-456)||(10140756-10140867)
chr1 (360-456)||(25844434-25844530)
chr1 (321-456)||(16648956-16649091)
chr1 (321-440)||(16834114-16834233)
chr1 (360-456)||(51040843-51040939)
chr1 (339-456)||(8138275-8138392)
chr1 (360-456)||(39200083-39200179)
[»] chr3 (17 HSPs)
chr3 (321-456)||(12965209-12965343)
chr3 (321-440)||(55431868-55431987)
chr3 (321-456)||(20520596-20520731)
chr3 (359-456)||(12111929-12112026)
chr3 (321-456)||(23665443-23665579)
chr3 (361-456)||(14438021-14438116)
chr3 (321-456)||(46964651-46964786)
chr3 (330-456)||(3419637-3419763)
chr3 (363-456)||(18467893-18467986)
chr3 (360-456)||(32473345-32473441)
chr3 (360-456)||(55326455-55326551)
chr3 (321-440)||(757701-757820)
chr3 (321-456)||(7570536-7570672)
chr3 (372-456)||(27709621-27709705)
chr3 (382-456)||(12971136-12971210)
chr3 (386-456)||(18472710-18472780)
chr3 (321-416)||(23660824-23660920)
[»] chr7 (15 HSPs)
chr7 (321-456)||(3880603-3880738)
chr7 (321-456)||(21671832-21671968)
chr7 (321-440)||(4930861-4930980)
chr7 (321-440)||(10387694-10387814)
chr7 (321-456)||(8268935-8269070)
chr7 (321-456)||(42625909-42626044)
chr7 (321-456)||(3046208-3046342)
chr7 (321-456)||(12800026-12800160)
chr7 (376-456)||(3285189-3285269)
chr7 (361-440)||(26341886-26341965)
chr7 (321-456)||(27238790-27238925)
chr7 (363-454)||(44509720-44509811)
chr7 (321-440)||(10392433-10392552)
chr7 (321-456)||(2595464-2595597)
chr7 (321-441)||(16373031-16373150)
[»] chr8 (19 HSPs)
chr8 (330-456)||(17021000-17021126)
chr8 (330-456)||(17551437-17551563)
chr8 (321-456)||(1808086-1808221)
chr8 (321-456)||(40125216-40125351)
chr8 (321-456)||(17026558-17026693)
chr8 (321-456)||(17557050-17557185)
chr8 (372-456)||(1910274-1910358)
chr8 (321-456)||(23547937-23548073)
chr8 (321-432)||(19167287-19167398)
chr8 (360-456)||(15950874-15950970)
chr8 (360-456)||(33417208-33417304)
chr8 (321-418)||(38181601-38181698)
chr8 (372-456)||(17026831-17026915)
chr8 (372-456)||(17557323-17557407)
chr8 (372-456)||(44925236-44925320)
chr8 (382-439)||(33100092-33100149)
chr8 (321-432)||(18875734-18875844)
chr8 (345-439)||(26779787-26779883)
chr8 (372-409)||(2966318-2966355)
[»] scaffold0054 (1 HSPs)
scaffold0054 (321-456)||(29815-29949)
[»] chr6 (20 HSPs)
chr6 (321-456)||(6407182-6407317)
chr6 (321-456)||(11559537-11559672)
chr6 (321-456)||(25313774-25313909)
chr6 (321-456)||(26201268-26201403)
chr6 (330-456)||(19994718-19994844)
chr6 (330-454)||(22694688-22694812)
chr6 (321-456)||(20747623-20747758)
chr6 (321-456)||(11534027-11534162)
chr6 (321-456)||(33686969-33687103)
chr6 (330-456)||(2699414-2699540)
chr6 (360-456)||(8748438-8748534)
chr6 (372-456)||(17963880-17963964)
chr6 (345-456)||(5856644-5856755)
chr6 (345-456)||(11428624-11428735)
chr6 (321-456)||(14509612-14509747)
chr6 (321-456)||(4156672-4156807)
chr6 (321-456)||(16835485-16835614)
chr6 (321-456)||(17600006-17600146)
chr6 (360-440)||(17914264-17914344)
chr6 (411-456)||(11613230-11613275)
[»] chr5 (17 HSPs)
chr5 (321-456)||(39519034-39519169)
chr5 (360-456)||(12103704-12103800)
chr5 (360-456)||(26667956-26668052)
chr5 (360-456)||(26939553-26939649)
chr5 (321-440)||(37248139-37248256)
chr5 (333-456)||(39523685-39523808)
chr5 (321-441)||(16115569-16115689)
chr5 (360-456)||(36424316-36424412)
chr5 (321-456)||(20180476-20180611)
chr5 (372-455)||(29167296-29167379)
chr5 (360-440)||(6154771-6154851)
chr5 (360-456)||(7452431-7452527)
chr5 (360-440)||(37537276-37537356)
chr5 (360-440)||(37646395-37646475)
chr5 (321-456)||(6511958-6512093)
chr5 (372-456)||(40148586-40148670)
chr5 (321-434)||(35779931-35780043)
[»] scaffold0352 (1 HSPs)
scaffold0352 (360-456)||(7786-7882)
[»] scaffold0002 (2 HSPs)
scaffold0002 (321-456)||(4703-4838)
scaffold0002 (321-440)||(443280-443399)
[»] scaffold0057 (1 HSPs)
scaffold0057 (360-456)||(35802-35898)
[»] scaffold0690 (1 HSPs)
scaffold0690 (360-439)||(5907-5984)
[»] scaffold0240 (1 HSPs)
scaffold0240 (338-456)||(4628-4747)

Alignment Details
Target: chr2 (Bit Score: 404; Significance: 0; HSPs: 17)
Name: chr2

Target: chr2; HSP #1
Raw Score: 404; E-Value: 0
Query Start/End: Original strand, 8 - 456
Target Start/End: Complemental strand, 24537791 - 24537343
8 aaaggaaacaatacatttgacaagacccaaacatacaagagctacaaagataattttgaaagaaatnnnnnnnccacaaatctctctaaaatgcaaattg 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||    
24537791 aaaggaaacaatacatttgacaagacccaaacatacaagagctacaaagataattttgaaagaaataaaaaaaccacaaatctctctaaaatgcaaattg 24537692  T
108 cattccatcannnnnnnnattcttatatgactatttataagctaagtttgatagatagaaaaaactaatcaccacattttgtaagtgcctttccctagaa 207  Q
    ||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24537691 cattccatcattttttttattcttatatgactatttataagctaagtttgatagatagaaaaaactaatcaccacattttgtaagtgcctttccctagaa 24537592  T
208 aacaaacataaactaagaaataaattcctactaggcttacagaaacaaaagatagctacaaaatccagccttaaaataatacaaaagtccatcgagttgt 307  Q
24537591 aacaaacataaactaagaaataaattcctactaggcttacagaaacaaaagatagctacaaaatccagccttaaaataatacaaaagtccatcgagttgt 24537492  T
308 acaaaagatagctactcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattg 407  Q
24537491 acaaaagatagctactcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattg 24537392  T
408 cgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
24537391 cgccaacagttactctaatggataagatcaaaagagaatttatccatta 24537343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 321 - 440
Target Start/End: Complemental strand, 25477750 - 25477631
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||||||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| || |||||||    
25477750 actcaatgaaactctttggtgtgttttttgaattgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacagcagttac 25477651  T
421 tctaatggataagatcaaaa 440  Q
    ||||||||||||||| ||||    
25477650 tctaatggataagattaaaa 25477631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 30651553 - 30651688
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||| |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||| | ||||||||||    
30651553 actcaataaaactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgtgacaacagttac 30651652  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    |||| |||||||||| ||||   | |||||||||||    
30651653 tctagtggataagattaaaatgaagtttatccatta 30651688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 360 - 456
Target Start/End: Complemental strand, 17968380 - 17968284
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||| ||||||||||| ||||||||||||||||||||||||| |||| ||| |||||||||||    
17968380 gagtcctctatttatatagagattctgtaactgttttaccaaaaattgcgacaacagttactctaatggataagattaaaatagagtttatccatta 17968284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 9184873 - 9184739
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| | | | ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||| ||||    
9184873 actcaatgaaactctttggtgtg-tttttgaacttagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacaattac 9184775  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
9184774 tctaatggataagattaaaatggagtttatccatta 9184739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 330 - 456
Target Start/End: Complemental strand, 9180173 - 9180048
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    |||||||||||||  |||||||| | | | ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||| |||||||||||||    
9180173 aactctttggtgtg-tttttgaacttagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacaattactctaatgga 9180075  T
430 taagatcaaaagagaatttatccatta 456  Q
    |||||| ||||  || |||||||||||    
9180074 taagattaaaatggagtttatccatta 9180048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 1934449 - 1934313
321 actcaatagaactctttggtgtacttttt-gaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtta 419  Q
    |||||||  |||||||||||||  ||||| ||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| |||||||||    
1934449 actcaatgaaactctttggtgtgtttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagtta 1934350  T
420 ctctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||| |||||||||| ||||   | |||||||||||    
1934349 ctctagtggataagattaaaatgaagtttatccatta 1934313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 362 - 457
Target Start/End: Original strand, 18345091 - 18345186
362 gtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccattag 457  Q
    ||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||| ||||||||||||||||| ||||  || ||||||||||||    
18345091 gtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagtcactctaatggataagattaaaatggagtttatccattag 18345186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 12797566 - 12797699
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  ||||| |||||| |  |||||||| | |||||||||  ||||||||||||||||| ||||||||| |||||||  |    
12797566 actcaatgaaactctttggtgt--tttttaaattgagtgcagtcctctatttatatagagaatttgtaactgttttagcgaaaattgcgacaacagtcgc 12797663  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
12797664 tctaatggataagattaaaatggagtttatccatta 12797699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 360 - 455
Target Start/End: Complemental strand, 19891897 - 19891802
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatt 455  Q
    ||||||||| | ||||||||| || ||||||| ||||||||||||||||| ||| |||| |||||||||||||||| ||||  || ||||||||||    
19891897 gagtcctctatttatatagagattctgtaactattttagcaaaaattgcgacaatagtttctctaatggataagattaaaatggactttatccatt 19891802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 359 - 454
Target Start/End: Original strand, 19896690 - 19896785
359 agagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccat 454  Q
    |||||||||| | ||||||||| |||||||| ||||||| ||||||||||| ||  ||||| ||||| ||||||||||||||| ||| ||||||||    
19896690 agagtcctctatttatatagagattttgtaattgttttaacaaaaattgcggcaggagttagtctaacggataagatcaaaagggaacttatccat 19896785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 345 - 441
Target Start/End: Complemental strand, 34495531 - 34495433
345 tttttgaattgattagagtcctctctatatatagagct--tttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaag 441  Q
    ||||||||| || | ||||||||| | ||||||||| |  |||||||||||||||||  |||||||| ||||| |||||||||||||||||||||||||    
34495531 tttttgaatcgagtggagtcctctatttatatagagatattttgtaactgttttagctgaaattgcgacaacaattactctaatggataagatcaaaag 34495433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 330 - 456
Target Start/End: Complemental strand, 40847037 - 40846911
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    |||||||| ||||  ||||||||  || | ||||||||| | ||||||||  |||||||| | ||||||||||||||||| ||||||||| |||||||||    
40847037 aactcttttgtgtgatttttgaaccgagtggagtcctctgtttatatagaaattttgtaattattttagcaaaaattgcggcaacagttattctaatgga 40846938  T
430 taagatcaaaagagaatttatccatta 456  Q
    ||  ||||||||  ||||||| |||||    
40846937 tagtatcaaaaggaaatttattcatta 40846911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 12360926 - 12361022
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| |  ||||||||||||||||||| || ||||   | |||||||||||    
12360926 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacggcagttactctaatggataaaattaaaatgaagtttatccatta 12361022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 391 - 440
Target Start/End: Complemental strand, 25496775 - 25496726
391 tgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaa 440  Q
    |||||||||| |||||||| ||||||||||||||||||||||||| ||||    
25496775 tgttttagcacaaattgcgacaacagttactctaatggataagattaaaa 25496726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 372 - 427
Target Start/End: Original strand, 29678448 - 29678503
372 tatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatg 427  Q
    |||||||||  | ||||||||||||||||||||||||| ||||| |||||||||||    
29678448 tatatagagagtctgtaactgttttagcaaaaattgcgacaacaattactctaatg 29678503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 333 - 441
Target Start/End: Complemental strand, 15446749 - 15446640
333 tctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgt-tttagcaaaaattgcgccaacagttactctaatggata 431  Q
    ||||| ||||| ||| |||| ||| || | |||||| | |||||||||  ||| ||||||| |||||| |||| |||| ||||| |||||||  ||||||    
15446749 tctttagtgtaatttatgaactgagtaaaatcctctatttatatagagactttttaactgtatttagctaaaactgcgtcaacaattactcttgtggata 15446650  T
432 agatcaaaag 441  Q
15446649 agatcaaaag 15446640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 76; Significance: 6e-35; HSPs: 23)
Name: chr4

Target: chr4; HSP #1
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 16421681 - 16421816
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||||| ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||    
16421681 actcaatgaaactctttggtgtgttttttgaactgattggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttac 16421780  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
16421781 tctaatggataagattaaaatggagtttatccatta 16421816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 31274153 - 31274288
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||    
31274153 actcaatgaaactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttac 31274252  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    |||| |||||||||| ||||  || |||||||||||    
31274253 tctagtggataagattaaaatggagtttatccatta 31274288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 330 - 456
Target Start/End: Complemental strand, 37264011 - 37263885
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| |||||||||||||| ||||    
37264011 aactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctagtgga 37263912  T
430 taagatcaaaagagaatttatccatta 456  Q
    |||||| ||||  || |||||||||||    
37263911 taagattaaaatggagtttatccatta 37263885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 8694391 - 8694487
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
8694391 gagtcctctatttatatagagattttgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 8694487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 440
Target Start/End: Complemental strand, 32221023 - 32220904
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||| ||||||||| |||||||| ||| | ||||||||| | ||||||||| || |||||||||||||||| |||||||| ||||||||||    
32221023 actcaatgaaactttttggtgtattttttgaactgagtggagtcctctatttatatagagattatgtaactgttttagcataaattgcgacaacagttac 32220924  T
421 tctaatggataagatcaaaa 440  Q
    ||||||||||||||| ||||    
32220923 tctaatggataagattaaaa 32220904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 37259320 - 37259185
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||| ||||    
37259320 actcaatgaaactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattgtgtaactgttttagcaaaaattgcgacaacaattac 37259221  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    |||| |||||||||| ||||  || |||||||||||    
37259220 tctagtggataagattaaaatggagtttatccatta 37259185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 363 - 456
Target Start/End: Original strand, 31766553 - 31766646
363 tcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  ||||||||||||||    
31766553 tcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggaatttatccatta 31766646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 360 - 456
Target Start/End: Complemental strand, 5270841 - 5270745
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
5270841 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 5270745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 51698561 - 51698696
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  ||| |||| ||| | ||||| ||| | ||||||||| || ||||| ||||||||||||||||||| ||||||||||    
51698561 actcaatgaaactctttggtgtgttttatgaactgagtggagtcatctatttatatagagattctgtaattgttttagcaaaaattgcgacaacagttac 51698660  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
51698661 tctaatggataagattaaaatggagtttatccatta 51698696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 321 - 426
Target Start/End: Complemental strand, 19540635 - 19540530
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||| || || |||||||| ||| | ||||||||| | ||||||||| |||||||||||||||| ||||||||||| ||||||||||    
19540635 actcaatgaaactctttagtttattttttgaactgagtggagtcctctatttatatagagattttgtaactgttttatcaaaaattgcgacaacagttac 19540536  T
421 tctaat 426  Q
19540535 tctaat 19540530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 13060140 - 13060236
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| |||||||||||||||||||||||||||| ||| ||| ||||| || |||||||| |||| ||| |||||||||||    
13060140 gagtcctctatttatatagagattttgtaactgttttagcaaaaattgcgacaaaagtcactctgatagataagattaaaatagagtttatccatta 13060236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 31728783 - 31728703
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaa 440  Q
    ||||||||| | ||||||||| || |||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||    
31728783 gagtcctctatttatatagagattctgtaactgttttggcaaaaattgcgacaacagttactctaatggataagattaaaa 31728703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 373 - 456
Target Start/End: Complemental strand, 12823292 - 12823209
373 atatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||||| || || |||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
12823292 atatagagattctgcaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 12823209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 333 - 440
Target Start/End: Original strand, 55252317 - 55252424
333 tctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataa 432  Q
    ||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||  |||||||||||||||| |    
55252317 tctttggtgtgttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacagtagttactctaatggatga 55252416  T
433 gatcaaaa 440  Q
    ||| ||||    
55252417 gattaaaa 55252424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 13065261 - 13065125
321 actcaatagaa-ctctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaa-ttgcgccaacagtt 418  Q
    ||||||||||| |||||||||||  |||||||| | | | ||||||| | | ||||||||| |||||||||||| |||||||||| || ||| |  ||||    
13065261 actcaatagaaactctttggtgtgttttttgaactaagtggagtcctgtatttatatagagattttgtaactgtattagcaaaaaatttcgc-agtagtt 13065163  T
419 actctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||||||||||| ||| ||||||||||    
13065162 actctaatggataagatcaaaagggaacttatccatta 13065125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 19906919 - 19907015
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| |||||||| ||||||||||| ||||||| ||||||| ||||||||||||||||| |||   || |||||||||||    
19906919 gagtcctctatttatatagagattttgtaattgttttagcaacaattgcgacaacagtcactctaatggataagatgaaattggagtttatccatta 19907015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 321 - 435
Target Start/End: Original strand, 6943418 - 6943533
321 actcaatagaa-ctctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtta 419  Q
    ||||||||||| ||||||| |||  |||||||| ||| ||||||||| | | ||||| ||| ||||||| |||||||||| ||||||||| ||  |||||    
6943418 actcaatagaaactctttgatgtgatttttgaactgagtagagtcctatgtttatattgagattttgtagctgttttagcgaaaattgcgacagtagtta 6943517  T
420 ctctaatggataagat 435  Q
6943518 ctctaatggataagat 6943533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 368 - 456
Target Start/End: Complemental strand, 32081578 - 32081490
368 tctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||| ||||||| || |||||||||||||||| |||||||| |||||||||||||||| |||||||| ||||   | |||||||||||    
32081578 tctatttatagagattctgtaactgttttagcataaattgcgacaacagttactctaatcgataagattaaaatgaagtttatccatta 32081490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 345 - 434
Target Start/End: Complemental strand, 33468434 - 33468345
345 tttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataaga 434  Q
    |||||||| ||| | ||||||||| | |||||| || || |||||||||||||||||||||| || |  |||||||||||||||||||||    
33468434 tttttgaactgagtggagtcctctatttatataaagattctgtaactgttttagcaaaaattacgactgcagttactctaatggataaga 33468345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 360 - 456
Target Start/End: Complemental strand, 5927635 - 5927539
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||| ||| || ||||| |||||||||||| |||| | ||||||||||||||||||||||||| ||||   | |||||||||||    
5927635 gagtcctctatttatatggagattctgtaattgttttagcaaatattgtgacaacagttactctaatggataagattaaaatgaagtttatccatta 5927539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 330 - 441
Target Start/End: Original strand, 23093753 - 23093864
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    ||||||||| |||  |||||||| ||| | ||||||||| | ||| ||||| ||||||||| | ||||   ||||||||| ||||| |||| ||| ||||    
23093753 aactctttgatgtgttttttgaactgagtggagtcctctatttatttagaggttttgtaaccggtttaattaaaattgcggcaacaattacactagtgga 23093852  T
430 taagatcaaaag 441  Q
23093853 taagatcaaaag 23093864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 391 - 434
Target Start/End: Complemental strand, 33462744 - 33462701
391 tgttttagcaaaaattgcgccaacagttactctaatggataaga 434  Q
    ||||||||||||||||||| ||||| ||||||||||||||||||    
33462744 tgttttagcaaaaattgcgacaacaattactctaatggataaga 33462701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 387 - 438
Target Start/End: Complemental strand, 39216494 - 39216443
387 taactgttttagcaaaaattgcgccaacagttactctaatggataagatcaa 438  Q
    ||||||||||| | ||||||||| ||| ||||| ||||||||||||||||||    
39216494 taactgttttaactaaaattgcgacaatagttaatctaatggataagatcaa 39216443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 76; Significance: 6e-35; HSPs: 14)
Name: chr1

Target: chr1; HSP #1
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 38621347 - 38621482
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| |||||||||||||||||||||||||||| ||||||||||    
38621347 actcaatgaaactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattttgtaactgttttagcaaaaattgcgacaacagttac 38621446  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
38621447 tctaatggataagattaaaatggagtttatccatta 38621482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 19798456 - 19798321
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||| |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||  ||||||||||    
19798456 actcaatgaaactctttggtgtattttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcaacaacagttac 19798357  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
19798356 tctaatggataagattaaaatggagtttatccatta 19798321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 330 - 456
Target Start/End: Complemental strand, 33300690 - 33300564
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| |||||||||||||||||||||||||||  || ||||||||||||||||    
33300690 aactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattttgtaactgttttagcaaaaattgcaacagcagttactctaatgga 33300591  T
430 taagatcaaaagagaatttatccatta 456  Q
    |||||| ||||  || |||||||||||    
33300590 taagattaaaatggagtttatccatta 33300564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 20107989 - 20108125
321 actcaatagaa-ctctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtta 419  Q
    ||||||||||| |||||||||||| |||| ||| ||| ||||||||| | | ||||||||| |||| |||||||||||||||||||| |  |||||||||    
20107989 actcaatagaatctctttggtgtaattttagaactgagtagagtcctatatttatatagagattttttaactgttttagcaaaaattacaacaacagtta 20108088  T
420 ctctaatggataagatcaaaagagaatttatccatta 456  Q
    || ||||||||||||| |||| |||| ||||||||||    
20108089 ctttaatggataagattaaaaaagaacttatccatta 20108125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 47450680 - 47450545
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  ||||||||| |||  ||||| || ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||| | ||||||||||    
47450680 actcaatgaaactctttgatgtgttttttaaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgtgacaacagttac 47450581  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| |||| ||| |||||||||||    
47450580 tctaatggataagattaaaatagagtttatccatta 47450545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 10136003 - 10136099
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
10136003 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 10136099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 360 - 456
Target Start/End: Complemental strand, 26927138 - 26927042
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
26927138 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 26927042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 345 - 456
Target Start/End: Original strand, 10140756 - 10140867
345 tttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagaga 444  Q
    |||||||||| | | ||||||||| | |||| |||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  ||    
10140756 tttttgaattaagtggagtcctctatttatacagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatgga 10140855  T
445 atttatccatta 456  Q
10140856 gtttatccatta 10140867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 25844434 - 25844530
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| |||||||||||||| |||||||||| ||||  || |||||||||||    
25844434 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctagtggataagattaaaatggagtttatccatta 25844530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 16649091 - 16648956
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||| ||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||| ||||| ||||||||||| ||||||||||    
16649091 actcaatgaaactttttggtgtgttttttgaactgagtggagtcctctatttatatagagattctgtaactattttaacaaaaattgcgacaacagttac 16648992  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||   | |||||||||||    
16648991 tctaatggataagattaaaatgaagtttatccatta 16648956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 321 - 440
Target Start/End: Original strand, 16834114 - 16834233
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||| | |||||| | | | ||||||||| | ||||||||| |||||||||||||||||| |||||||||  |||| ||||    
16834114 actcaatgaaactctttggtgtattgtttgaactaagtggagtcctctatttatatagagattttgtaactgttttagccaaaattgcgataacaattac 16834213  T
421 tctaatggataagatcaaaa 440  Q
    ||||||||||||||| ||||    
16834214 tctaatggataagattaaaa 16834233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 360 - 456
Target Start/End: Complemental strand, 51040939 - 51040843
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| |||||||||||||||||||||| || ||||   | |||||||||||    
51040939 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataaaattaaaatgaagtttatccatta 51040843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 339 - 456
Target Start/End: Original strand, 8138275 - 8138392
339 gtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaa 438  Q
    ||||| |||||||| ||| |  ||| |||| | ||||||||| |||||||||||||||||||||| ||||  ||  ||||||||||| ||||||||||||    
8138275 gtgtaatttttgaactgagtgaagttctctatttatatagagattttgtaactgttttagcaaaagttgcagcagtagttactctaacggataagatcaa 8138374  T
439 aagagaatttatccatta 456  Q
    ||| ||| ||||||||||    
8138375 aagggaacttatccatta 8138392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 360 - 456
Target Start/End: Complemental strand, 39200179 - 39200083
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || |||| |||||||||||||||||||| || |||||||||||| ||||||||| ||||  || |||||||||||    
39200179 gagtcctctatttatatagagattatgtagctgttttagcaaaaattgcgacagcagttactctaacggataagattaaaatggagtttatccatta 39200083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 72; Significance: 1e-32; HSPs: 17)
Name: chr3

Target: chr3; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 12965343 - 12965209
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||| |||||||| ||||| |||||||| ||| | ||||| | | | ||||||||| |||||||||||||||| ||||||||||| | ||||||||    
12965343 actcaataaaactcttttgtgtaatttttgaactgagtggagtcttttatttatatagagattttgtaactgttttaacaaaaattgcggc-acagttac 12965245  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||||||||||||| ||||||||||    
12965244 tctaatggataagatcaaaagagaacttatccatta 12965209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 321 - 440
Target Start/End: Original strand, 55431868 - 55431987
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||| ||||| |||||| | ||||||||| | ||||||||| || ||||||||||||| ||||||||||| ||||||||||    
55431868 actcaatgaaactctttggtgtattttttaaattgagtggagtcctctatttatatagagattctgtaactgttttaacaaaaattgcgacaacagttac 55431967  T
421 tctaatggataagatcaaaa 440  Q
    ||||||||||||||| ||||    
55431968 tctaatggataagattaaaa 55431987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 20520596 - 20520731
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||| |||| ||| ||| | ||||||||| | ||||| ||| ||||||||| |||||||||||||||||| |||||| |||    
20520596 actcaatgaaactctttggtgtaattttggaactgagtggagtcctctatttatatcgagattttgtaaccgttttagcaaaaattgcgacaacagatac 20520695  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
20520696 tctaatggataagattaaaatggagtttatccatta 20520731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 359 - 456
Target Start/End: Complemental strand, 12112026 - 12111929
359 agagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||||||| | ||||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||| ||||  ||| ||||||||||    
12112026 agagtcctctatttatatagagattttgtaactgttttagcaaaaattgcggcaacaattactctaatggataagattaaaaaggaacttatccatta 12111929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 23665579 - 23665443
321 actcaatagaactctttggtgtacttttt-gaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtta 419  Q
    |||||||  |||||||||||||  ||||| ||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| |||||||||    
23665579 actcaatgaaactctttggtgtgtttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagtta 23665480  T
420 ctctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||| |||||||||| ||||  || |||||||||||    
23665479 ctctagtggataagattaaaatggagtttatccatta 23665443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 361 - 456
Target Start/End: Complemental strand, 14438116 - 14438021
361 agtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
14438116 agtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 14438021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 46964651 - 46964786
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| ||  |||||| |||||| |||||||||| ||||||||||    
46964651 actcaatgaaactctttggtgtgatttttgaactgagtggagtcctctatttatatagagattcagtaactattttagtaaaaattgcgacaacagttac 46964750  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
46964751 tctaatggataagattaaaatggagtttatccatta 46964786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 330 - 456
Target Start/End: Original strand, 3419637 - 3419763
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || | ||||| ||||||||||||||||| ||||||||||||||||| |    
3419637 aactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattctctaactattttagcaaaaattgcgacaacagttactctaatgaa 3419736  T
430 taagatcaaaagagaatttatccatta 456  Q
    |||||| ||||  || |||||||||||    
3419737 taagattaaaatggattttatccatta 3419763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 363 - 456
Target Start/End: Original strand, 18467893 - 18467986
363 tcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
18467893 tcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 18467986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 360 - 456
Target Start/End: Complemental strand, 32473441 - 32473345
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||| ||||||||||||||||||| ||||  || |||||||||||    
32473441 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacaattactctaatggataagattaaaatggagtttatccatta 32473345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 55326455 - 55326551
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||| ||||||||||||||||||| ||||  || |||||||||||    
55326455 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacaattactctaatggataagattaaaatggagtttatccatta 55326551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 321 - 440
Target Start/End: Complemental strand, 757820 - 757701
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||  ||| | |||| |||| | ||||||||| || ||||||||||||||||||||||||| ||||| ||||    
757820 actcaatgaaactctttggtgtgttttttgagctgagtggagttctctatttatatagagattatgtaactgttttagcaaaaattgcgacaacaattac 757721  T
421 tctaatggataagatcaaaa 440  Q
    ||||||||||||||| ||||    
757720 tctaatggataagattaaaa 757701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 7570672 - 7570536
321 actcaatagaactctttggtgtacttttt-gaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtta 419  Q
    |||||||  |||||||||||||  ||||| ||| ||| | ||||||||| | ||||||||| || |||||||||||||||||||| |||| ||||| |||    
7570672 actcaatgaaactctttggtgtgtttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaactgcgacaacaatta 7570573  T
420 ctctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||||||||||||| ||||   | |||||||||||    
7570572 ctctaatggataagattaaaatgaagtttatccatta 7570536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 372 - 456
Target Start/End: Original strand, 27709621 - 27709705
372 tatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| || ||||||||||||||||||||||||| ||||||| ||||||||||||||||| ||||  || |||||||||||    
27709621 tatatagagattctgtaactgttttagcaaaaattgcgacaacagtaactctaatggataagattaaaatggagtttatccatta 27709705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 382 - 456
Target Start/End: Complemental strand, 12971210 - 12971136
382 ttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    |||| ||||| ||||||||||||||||| |||||||||||||||| |||||||| ||||||||| ||||||||||    
12971210 ttttataactattttagcaaaaattgcggcaacagttactctaattgataagataaaaagagaacttatccatta 12971136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 386 - 456
Target Start/End: Original strand, 18472710 - 18472780
386 gtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
18472710 gtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 18472780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 321 - 416
Target Start/End: Complemental strand, 23660920 - 23660824
321 actcaatagaactctttggtgtacttttt-gaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacag 416  Q
    |||||||  |||||||||||||  ||||| ||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||    
23660920 actcaatgaaactctttggtgtgtttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacag 23660824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 68; Significance: 3e-30; HSPs: 15)
Name: chr7

Target: chr7; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 3880603 - 3880738
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||| ||| ||| | ||||||||| | ||||||||| |||||||||| ||||||||||||||||| || |||||||    
3880603 actcaatgaaactctttggtgtgtttttagaactgagtggagtcctctatttatatagagattttgtaactattttagcaaaaattgcgacagcagttac 3880702  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||| ||||||||  ||||||||||||||    
3880703 tctaatggatacgatcaaaatggaatttatccatta 3880738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 21671832 - 21671968
321 actcaatagaa-ctctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtta 419  Q
    ||||||||||| ||||||||| |  |||||||| ||| | |||| |||| | ||||||||| |||||||||||||||||||||||||||| |||||||||    
21671832 actcaatagaaactctttggtatgatttttgaactgagtggagtactctatttatatagagattttgtaactgttttagcaaaaattgcggcaacagtta 21671931  T
420 ctctaatggataagatcaaaagagaatttatccatta 456  Q
     |||||| ||||| |||||||| ||| ||||||||||    
21671932 atctaatagataatatcaaaagggaacttatccatta 21671968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 440
Target Start/End: Original strand, 4930861 - 4930980
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||| ||||    
4930861 actcaatgaaactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacaattac 4930960  T
421 tctaatggataagatcaaaa 440  Q
    ||||||||||||||| ||||    
4930961 tctaatggataagattaaaa 4930980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 321 - 440
Target Start/End: Complemental strand, 10387814 - 10387694
321 actcaatagaa-ctctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtta 419  Q
    ||||||||||| ||||||| |||  |||||||| | | | ||||||||| | ||||||||| |||||||||| ||||||||||||||||| |||||||||    
10387814 actcaatagaaactctttgatgtgatttttgaactaagtggagtcctctatttatatagagattttgtaactattttagcaaaaattgcggcaacagtta 10387715  T
420 ctctaatggataagatcaaaa 440  Q
    |||| ||||||||||||||||    
10387714 ctctgatggataagatcaaaa 10387694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 8268935 - 8269070
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||| ||||||||  || ||||||||||| | ||| ||||| |||| ||||||||||||||||||||||| |   ||||||    
8268935 actcaatgaaactctttggtgtaatttttgaaccgagtagagtcctctatttatttagagattttataactgttttagcaaaaattgcgacggaagttac 8269034  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
8269035 tctaatggataagattaaaatggagtttatccatta 8269070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 42626044 - 42625909
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  ||||| |||||||| |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| |||| ||||     
42626044 actcaatgaaactcattggtgtaatttttgaactgagtggagtcctctatttatatagagattatgtaactgttttagcaaaaattgcgacaactgttat 42625945  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||| |||||||| ||||  || |||||||||||    
42625944 tctaatagataagattaaaattgagtttatccatta 42625909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 3046208 - 3046342
321 actcaatagaa-ctctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtta 419  Q
    ||||||||||| || ||||||||| |||||||| ||| |||| || ||| |  |||||||| ||| ||||||||||||||||||||||||  ||||||||    
3046208 actcaatagaaactttttggtgtaatttttgaactgagtagaatcatctattgatatagagattt-gtaactgttttagcaaaaattgcgg-aacagtta 3046305  T
420 ctctaatggataagatcaaaagagaatttatccatta 456  Q
    || ||||||||||||||||||| ||| ||||||||||    
3046306 ctttaatggataagatcaaaagggaacttatccatta 3046342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 12800026 - 12800160
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| | | |  |||||||| | ||||||| | || ||||||||||||||||||||||| | ||||||||||    
12800026 actcaatgaaactctttggtgtgttttttgaactaagtgaagtcctctatttatatagtgattctgtaactgttttagcaaaaattg-gacaacagttac 12800124  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||||||||  || |||||||||||    
12800125 tctaatggataagatcaaaatggagtttatccatta 12800160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 376 - 456
Target Start/End: Original strand, 3285189 - 3285269
376 tagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||| |||||||||| ||||||||||||| ||| |||||||||| |||||||||||||||||||| ||| ||||||||||    
3285189 tagagattttgtaactattttagcaaaaatcgcggcaacagttacactaatggataagatcaaaagggaacttatccatta 3285269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 361 - 440
Target Start/End: Original strand, 26341886 - 26341965
361 agtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaa 440  Q
    |||||||| | ||||||||| || |||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||    
26341886 agtcctctatttatatagagattctgtaactgttttcgcaaaaattgcgacaacagttactctaatggataagattaaaa 26341965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 27238790 - 27238925
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  || ||||| ||| | ||||||||| | ||||||||| |||||||||||||||||||||||||||   | ||||||     
27238790 actcaatgaaactctttggtgtgtttattgaactgagtggagtcctctatttatatagagattttgtaactgttttagcaaaaattgcaatagcagttag 27238889  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    | ||||||||||||| ||||  || |||||||||||    
27238890 tttaatggataagattaaaattgagtttatccatta 27238925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 363 - 454
Target Start/End: Complemental strand, 44509811 - 44509720
363 tcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccat 454  Q
    |||||| | ||||||||  |||| ||||||||||||||||||||||| || |||||||||||||||||||||| ||||  ||||||||||||    
44509811 tcctctatttatatagaaattttttaactgttttagcaaaaattgcgacagcagttactctaatggataagattaaaatggaatttatccat 44509720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 321 - 440
Target Start/End: Complemental strand, 10392552 - 10392433
321 actcaatagaa-ctctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtta 419  Q
    ||||||||||| ||||||| |||  |||||||| ||| | ||||||||| | ||||||||| ||||| ||||||||| |||||||||||| ||||| |||    
10392552 actcaatagaaactctttgatgtgatttttgaactgagtggagtcctctatttatatagagattttg-aactgttttggcaaaaattgcggcaacaatta 10392454  T
420 ctctaatggataagatcaaaa 440  Q
    || | ||||||||||||||||    
10392453 ctttgatggataagatcaaaa 10392433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 2595464 - 2595597
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||| ||||  |||||||| ||| | |||||||||  || ||||||| ||||| |||||||||||||||||||| | || |||||||    
2595464 actcaatgaaactctttcgtgtgttttttgaactgagtggagtcctct--atttatagagattttgcaactgttttagcaaaaattgtgacagcagttac 2595561  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    | ||||||||||||| ||||   | |||||||||||    
2595562 tttaatggataagattaaaatgcagtttatccatta 2595597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 321 - 441
Target Start/End: Original strand, 16373031 - 16373150
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    ||||||||||||||||||||||  |||||||||||| | ||||||| | | |||||||   |||||||||||||||| | ||| ||||  |||||  |||    
16373031 actcaatagaactctttggtgtgatttttgaattgagtggagtcctttatttatatagtaattttgtaactgttttaactaaatttgcaacaaca-atac 16373129  T
421 tctaatggataagatcaaaag 441  Q
    |||||||||||| ||||||||    
16373130 tctaatggataaaatcaaaag 16373150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 67; Significance: 1e-29; HSPs: 19)
Name: chr8

Target: chr8; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 330 - 456
Target Start/End: Original strand, 17021000 - 17021126
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    |||||||||||||  || ||||| ||| | ||||||||| | |||| |||| |||||||||||||||||||||||||||| ||| |||||||||||||||    
17021000 aactctttggtgtgtttcttgaactgagtggagtcctctatttatacagagattttgtaactgttttagcaaaaattgcgacaatagttactctaatgga 17021099  T
430 taagatcaaaagagaatttatccatta 456  Q
    |||||| |||| ||| |||||||||||    
17021100 taagattaaaatagagtttatccatta 17021126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 330 - 456
Target Start/End: Original strand, 17551437 - 17551563
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    |||||||||||||  || ||||| ||| | ||||||||| | |||| |||| |||||||||||||||||||||||||||| ||| |||||||||||||||    
17551437 aactctttggtgtgtttcttgaactgagtggagtcctctatttatacagagattttgtaactgttttagcaaaaattgcgacaatagttactctaatgga 17551536  T
430 taagatcaaaagagaatttatccatta 456  Q
    |||||| |||| ||| |||||||||||    
17551537 taagattaaaatagagtttatccatta 17551563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 1808086 - 1808221
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||| ||||||||  |||||||| ||| |  |||| ||| | ||||||||| |||||||||||||||||||||||||||| || |||||||    
1808086 actcaatgaaactttttggtgtgttttttgaactgagtgtagtcttctatttatatagagattttgtaactgttttagcaaaaattgcgacagcagttac 1808185  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||||||||  || |||||||||||    
1808186 tctaatggataagatcaaaatggagtttatccatta 1808221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 40125351 - 40125216
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||| | ||||| ||||    
40125351 actcaatgaaactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgagacaacaattac 40125252  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
40125251 tctaatggataagattaaaatggagtttatccatta 40125216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 17026558 - 17026693
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||||||| | ||||||||| | ||||||||| || ||||| ||||||||||||||||||  || || ||||    
17026558 actcaatgaaactctttggtgtgttttttgaattgagtggagtcctctatttatatagagattctgtaattgttttagcaaaaattgcaacagcaattac 17026657  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
17026658 tctaatggataagattaaaattgagtttatccatta 17026693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 17557050 - 17557185
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||||||| | ||||||||| | ||||||||| || ||||| ||||||||||||||||||  || || ||||    
17557050 actcaatgaaactctttggtgtgttttttgaattgagtggagtcctctatttatatagagattctgtaattgttttagcaaaaattgcaacagcaattac 17557149  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
17557150 tctaatggataagattaaaattgagtttatccatta 17557185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 372 - 456
Target Start/End: Complemental strand, 1910358 - 1910274
372 tatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| || ||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||  || |||||||||||    
1910358 tatatagagattctgtaactgttttagcaaaaattgcgacaacagttactataatggataagattaaaatggagtttatccatta 1910274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 23548073 - 23547937
321 actcaatagaa-ctctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtta 419  Q
    ||||||||||| |||||||||||  |||||||| |   | ||||||||| | ||||||||| || |||||||||||||||||||||||   |||||||||    
23548073 actcaatagaaactctttggtgtgatttttgaactaggtggagtcctctatttatatagagattgtgtaactgttttagcaaaaattgaagcaacagtta 23547974  T
420 ctctaatggataagatcaaaagagaatttatccatta 456  Q
     | ||||| ||||||||||||||||| |||| |||||    
23547973 atttaatgaataagatcaaaagagaacttatacatta 23547937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 321 - 432
Target Start/End: Original strand, 19167287 - 19167398
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||| ||| | ||||||||| |||||||||||||| ||||||||||||| ||||| ||||    
19167287 actcaatgaaactctttggtgtgttttttgaactgagtggagtcttctatttatatagagattttgtaactgtttcagcaaaaattgcgacaacaattac 19167386  T
421 tctaatggataa 432  Q
    | ||||||||||    
19167387 tgtaatggataa 19167398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 360 - 456
Target Start/End: Complemental strand, 15950970 - 15950874
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| || || ||||||||||| ||||||| ||||  || |||||||||||    
15950970 gagtcctctttttatatagagattctgtaactgttttagcaaaaattgcgacagcaattactctaatgaataagattaaaatggagtttatccatta 15950874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 33417208 - 33417304
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| |||||||||||||||||||||||||||  ||||||||||||| ||| ||||||| ||||   | |||||||||||    
33417208 gagtcctctatttatatagagattttgtaactgttttagcaaaaattgcaacaacagttactctcatgaataagattaaaatgaagtttatccatta 33417304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 321 - 418
Target Start/End: Complemental strand, 38181698 - 38181601
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagtt 418  Q
    |||||||  |||||||||||||  ||||| || ||| | ||||||||| | ||||||||| ||||||||| |||||||||||||||||| ||||||||    
38181698 actcaatgaaactctttggtgtgttttttaaactgagtggagtcctctatttatatagagattttgtaaccgttttagcaaaaattgcgacaacagtt 38181601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 372 - 456
Target Start/End: Original strand, 17026831 - 17026915
372 tatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| || ||||||||||||||||||||||||  || || ||||||||||||||||||| ||||  || |||||||||||    
17026831 tatatagagattctgtaactgttttagcaaaaattgcaacagcaattactctaatggataagattaaaattgagtttatccatta 17026915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 372 - 456
Target Start/End: Original strand, 17557323 - 17557407
372 tatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| || ||||||||||||||||||||||||  || || ||||||||||||||||||| ||||  || |||||||||||    
17557323 tatatagagattctgtaactgttttagcaaaaattgcaacagcaattactctaatggataagattaaaattgagtttatccatta 17557407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 372 - 456
Target Start/End: Complemental strand, 44925320 - 44925236
372 tatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| || ||||||||||||||||||||||||  || |||||||||||||||||||||| ||||   | |||||||||||    
44925320 tatatagagattctgtaactgttttagcaaaaattgcaacagcagttactctaatggataagattaaaatgaagtttatccatta 44925236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 382 - 439
Target Start/End: Original strand, 33100092 - 33100149
382 ttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaa 439  Q
    |||||||| || |||||| ||||||||| ||||| |||||||||||||||||||||||    
33100092 ttttgtaattggtttagctaaaattgcgacaacaattactctaatggataagatcaaa 33100149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 321 - 432
Target Start/End: Complemental strand, 18875844 - 18875734
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||| ||||||  || ||||| ||| | ||||||||| | ||||||||| || ||||||||||||| ||||||||||| ||  ||||||    
18875844 actcaatgaaactctatggtgtgtttattgaactgagtggagtcctctatttatatagagattctgtaactgtttta-caaaaattgcgacattagttac 18875746  T
421 tctaatggataa 432  Q
    ||||||| ||||    
18875745 tctaatgaataa 18875734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 345 - 439
Target Start/End: Original strand, 26779787 - 26779883
345 tttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagc---aaaaattgcgccaacagttactctaatggataagatcaaa 439  Q
    |||||||||||| | |||||| || | ||||||||| |||||||||| |||||||   |||||||||| ||||| |||||||||  ||||||||||||    
26779787 tttttgaattgagtggagtcc-ctgtttatatagagattttgtaactattttagcaaaaaaaattgcggcaacaattactctaacagataagatcaaa 26779883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 372 - 409
Target Start/End: Original strand, 2966318 - 2966355
372 tatatagagcttttgtaactgttttagcaaaaattgcg 409  Q
    ||||||||| ||||||||||| ||||||||||||||||    
2966318 tatatagagattttgtaactgctttagcaaaaattgcg 2966355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0054 (Bit Score: 64; Significance: 8e-28; HSPs: 1)
Name: scaffold0054

Target: scaffold0054; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 29815 - 29949
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||||| ||||||||| | ||||||||| || | |||||||||||| |||||||||| ||||||||||    
29815 actcaatgaaactctttggtgtg-tttttgaactgattggagtcctctatttatatagagattctataactgttttagaaaaaattgcgacaacagttac 29913  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
29914 tctaatggataagattaaaatggagtttatccatta 29949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 64; Significance: 8e-28; HSPs: 20)
Name: chr6

Target: chr6; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 6407317 - 6407182
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  ||||||||| |||  |||||||||||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||| ||||    
6407317 actcaatgaaactctttgatgtgttttttgaattgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacaattac 6407218  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||   | |||||||||||    
6407217 tctaatggataagattaaaatgaagtttatccatta 6407182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 11559672 - 11559537
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | |||| |||| || |||||||||||||||||||||||||  |||||||||    
11559672 actcaatgaaactctttggtgtgttttttgaactgagtggagtcctctatttataaagagattctgtaactgttttagcaaaaattgcgataacagttac 11559573  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
11559572 tctaatggataagattaaaatggagtttatccatta 11559537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 25313909 - 25313774
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||| |||||||| | | | ||||| ||| | ||||||||| || ||||||||||||||||||||||| | ||||||||||    
25313909 actcaatgaaactctttggtgtattttttgaactaagttgagtcatctatttatatagagattctgtaactgttttagcaaaaattgtgacaacagttac 25313810  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
25313809 tctaatggataagattaaaaaggagtttatccatta 25313774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 26201403 - 26201268
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||| |||||||| | | | ||||| ||| | ||||||||| || ||||||||||||||||||||||| | ||||||||||    
26201403 actcaatgaaactctttggtgtattttttgaactaagttgagtcatctatttatatagagattctgtaactgttttagcaaaaattgtgacaacagttac 26201304  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
26201303 tctaatggataagattaaaaaggagtttatccatta 26201268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 330 - 456
Target Start/End: Complemental strand, 19994844 - 19994718
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    |||||||||||||| |||||||| ||| | ||||||||| | ||||||||| ||||||||||||||||||||||||| || || ||| ||||||||| ||    
19994844 aactctttggtgtaatttttgaactgagtggagtcctctatttatatagagattttgtaactgttttagcaaaaattacgacatcagatactctaattga 19994745  T
430 taagatcaaaagagaatttatccatta 456  Q
    |||||| |||||  || ||||||||||    
19994744 taagataaaaaggtaaattatccatta 19994718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 330 - 454
Target Start/End: Complemental strand, 22694812 - 22694688
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    |||||||||||||  |||||||| | | | || |||||| | ||||||||| |||||||||||||||||||||||||||| ||||| |||||||||| ||    
22694812 aactctttggtgtgatttttgaacttagtggaatcctctgtttatatagagattttgtaactgttttagcaaaaattgcggcaacaattactctaataga 22694713  T
430 taagatcaaaagagaatttatccat 454  Q
    |||||||||||  ||| ||||||||    
22694712 taagatcaaaatggaacttatccat 22694688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 20747758 - 20747623
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  ||||| || ||| | ||||||||| | ||||||||| ||| |||||||||||||||||||||| | || |||||||    
20747758 actcaatgaaactctttggtgtgattttttaactgagtggagtcctctatttatatagagatttggtaactgttttagcaaaaattgtgacagcagttac 20747659  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
20747658 tctaatggataagattaaaatggagtttatccatta 20747623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 11534162 - 11534027
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| |  |||||||| | |||| |||| || |||||||||||||||||||||||||  | |||||||    
11534162 actcaatgaaactctttggtgtgttttttgaactgagtgaagtcctctatttataaagagattctgtaactgttttagcaaaaattgcggtagcagttac 11534063  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||  || |||||||||||    
11534062 tctaatggataagattaaaatggagtttatccatta 11534027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 33687103 - 33686969
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||| ||||||| ||||||||||| || |||||||    
33687103 actcaatgaaactctttggtgtg-tttttgaactgagtggagtcctctatttatatagagattctgtaattgttttaacaaaaattgcgacagcagttac 33687005  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||||| |||||| ||||| || |||||||||||    
33687004 tctaatggttaagattaaaagggagtttatccatta 33686969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 330 - 456
Target Start/End: Complemental strand, 2699540 - 2699414
330 aactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatgga 429  Q
    |||| ||||||||  |||||||| ||| |  | |||||| | ||||||||| ||||||||||||||||| |||||||||| || ||||||||||||||||    
2699540 aactatttggtgtgttttttgaactgagtgaattcctctatttatatagagattttgtaactgttttagtaaaaattgcgacagcagttactctaatgga 2699441  T
430 taagatcaaaagagaatttatccatta 456  Q
    |||||| ||||  || |||||||||||    
2699440 taagattaaaattgagtttatccatta 2699414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 8748438 - 8748534
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||| | ||||| ||||||||||||||||||| ||||  || |||||||||||    
8748438 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgagacaacaattactctaatggataagattaaaatggagtttatccatta 8748534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 372 - 456
Target Start/End: Complemental strand, 17963964 - 17963880
372 tatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| || ||||||||||||| ||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
17963964 tatatagagattctgtaactgttttaccaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 17963880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 345 - 456
Target Start/End: Original strand, 5856644 - 5856755
345 tttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagaga 444  Q
    ||||| || ||| ||||||||||| | ||||||||| |||||||||| ||||||||||||||||| ||  |||| |||||||||||||||| ||||  ||    
5856644 ttttttaactgagtagagtcctctatttatatagagattttgtaactattttagcaaaaattgcgacagtagtttctctaatggataagattaaaatgga 5856743  T
445 atttatccatta 456  Q
5856744 gtttatccatta 5856755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 345 - 456
Target Start/End: Original strand, 11428624 - 11428735
345 tttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagaga 444  Q
    |||||||| ||| | ||||||||| | ||||||||| |||||||||| |||||||||||||| ||  | |||||||||||||||||||||| ||||  ||    
11428624 tttttgaactgagtggagtcctctatttatatagagattttgtaactcttttagcaaaaattacgatagcagttactctaatggataagattaaaatgga 11428723  T
445 atttatccatta 456  Q
11428724 gtttatccatta 11428735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 14509612 - 14509747
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| | | | ||||||||| | |||| |||| |||||||| ||||||||||||||||||| ||||| ||||    
14509612 actcaatgaaactctttggtgtgttttttgaacttagtggagtcctctatttataaagagattttgtaaatgttttagcaaaaattgcgacaacaattac 14509711  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||| ||||||| ||||   | |||||||||||    
14509712 tctaatgtataagattaaaatgaagtttatccatta 14509747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 4156807 - 4156672
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||| ||||||||| |||||||| ||| | ||||||| | | |||||| || || ||||||||||||||||||||||||  ||| ||||||    
4156807 actcaatgaaactttttggtgtaatttttgaactgagtggagtcctttatttatatatagattctgtaactgttttagcaaaaattgcaacaagagttac 4156708  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||||| |||||| ||||   | |||||||||||    
4156707 tctaatgggtaagattaaaatgaagtttatccatta 4156672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 16835614 - 16835485
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||      ||||||||||| ||||||||||    
16835614 actcaatgaaactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattctgtaactg------caaaaattgcgacaacagttac 16835521  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    |||| |||||||||| ||||  || |||||||||||    
16835520 tctagtggataagattaaaatggagtttatccatta 16835485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 17600006 - 17600146
321 actcaatagaa-ctctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaatt----gcgccaaca 415  Q
    ||||||||||| |||||| ||||  |||||||| ||| |  |||||||| | ||| ||||| |||||||| | |||||| |||||||    ||| |||||    
17600006 actcaatagaaactctttagtgtgatttttgaactgagtgaagtcctctatttatttagagattttgtaatttttttagtaaaaattaattgcggcaaca 17600105  T
416 gttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||| ||||||||||||||||||| || |||| |||||    
17600106 gttactcaaatggataagatcaaaagaaaacttattcatta 17600146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 17914264 - 17914344
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaa 440  Q
    ||||||||| |  |||||||| |||||||||| |||||||||||||||||  |  ||||||||||| |||||| |||||||    
17914264 gagtcctctattaatatagagattttgtaacttttttagcaaaaattgcggtagaagttactctaacggataatatcaaaa 17914344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 411 - 456
Target Start/End: Complemental strand, 11613275 - 11613230
411 caacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||||||||||||||||||||||||||| |||  ||||||||||    
11613275 caacagttactctaatggataagatcaaaaaagatcttatccatta 11613230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 64; Significance: 8e-28; HSPs: 17)
Name: chr5

Target: chr5; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 39519034 - 39519169
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||| |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||| | ||||||||||    
39519034 actcaataaaactctttggtgtgttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgtgacaacagttac 39519133  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    |||| |||||||||| ||||   | |||||||||||    
39519134 tctagtggataagattaaaatgaagtttatccatta 39519169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 12103704 - 12103800
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||||| ||||  || |||||||||||    
12103704 gagtcctctatttatatagagattttgtaactgttttagcaaaaattgcgacaacagttactctaaaggataagattaaaatggagtttatccatta 12103800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 26667956 - 26668052
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
26667956 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 26668052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 26939553 - 26939649
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
26939553 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 26939649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 321 - 440
Target Start/End: Complemental strand, 37248256 - 37248139
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||| ||||    
37248256 actcaatgaaactctttggtgt--tttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacaattac 37248159  T
421 tctaatggataagatcaaaa 440  Q
    ||||||||||||||| ||||    
37248158 tctaatggataagattaaaa 37248139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 333 - 456
Target Start/End: Original strand, 39523685 - 39523808
333 tctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataa 432  Q
    ||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||||||||| |||||||||||||| |||||||    
39523685 tctttggtgtgttttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctagtggataa 39523784  T
433 gatcaaaagagaatttatccatta 456  Q
    ||| ||||   | |||||||||||    
39523785 gattaaaatgaagtttatccatta 39523808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 321 - 441
Target Start/End: Complemental strand, 16115689 - 16115569
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||| |||||||||||||  |||||||| ||| | || |||||| | ||||||||| |||||||| ||||||||| ||||||||| |||||  |||    
16115689 actcaatataactctttggtgtgatttttgaactgagtggaatcctctgtttatatagagattttgtaaatgttttagctaaaattgcggcaacatgtac 16115590  T
421 tctaatggataagatcaaaag 441  Q
    | |||||||||||||||||||    
16115589 tttaatggataagatcaaaag 16115569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 36424316 - 36424412
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||   | |||||||||||    
36424316 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatgaagtttatccatta 36424412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 20180611 - 20180476
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | ||||||||| || ||||||||||||||||||| ||| | ||||||||||    
20180611 actcaatgaaactctttggtgtgatttttgaactgagtggagtcctctatttatatagagattctgtaactgttttagcaaaagttgagacaacagttac 20180512  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    |||||||||||| || ||||   | |||||||||||    
20180511 tctaatggataatattaaaatgaagtttatccatta 20180476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 372 - 455
Target Start/End: Complemental strand, 29167379 - 29167296
372 tatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatt 455  Q
    ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || ||||||||||    
29167379 tatatagagattctgtaactgttttagcaaaaattgcggcaacagttactctaatggataagattaaaatggagtttatccatt 29167296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 6154851 - 6154771
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaa 440  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| || |||||||||||||||||||||| ||||    
6154851 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacatcagttactctaatggataagattaaaa 6154771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 7452431 - 7452527
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || |||| |||||||||||||||||||| |||||||||||||||||||||| || ||||  || |||||||||||    
7452431 gagtcctctatttatatagagattctgtatctgttttagcaaaaattgcgacaacagttactctaatggataaaattaaaatggagtttatccatta 7452527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 37537356 - 37537276
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaa 440  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||| ||||||| ||||    
37537356 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatgaataagattaaaa 37537276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 37646475 - 37646395
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaa 440  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||| | ||||||||||||||||||||||||| ||||    
37646475 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgtgacaacagttactctaatggataagattaaaa 37646395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 6512093 - 6511958
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  ||||||||| |||  |||||||| ||| | ||||||||| | ||||||||| || || ||||||||||||||||| |||| |||||||||     
6512093 actcaatgaaactctttgatgtgttttttgaactgagtggagtcctctatttatatagagattctgcaactgttttagcaaaaaatgcgacaacagttaa 6511994  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||||||||| ||||   | |||||||||||    
6511993 tctaatggataagattaaaatgaagtttatccatta 6511958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 372 - 456
Target Start/End: Original strand, 40148586 - 40148670
372 tatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| || | ||| ||||||||||||||||||| ||||||||||||||||||||| ||| ||||   | |||||||||||    
40148586 tatatagagattctataattgttttagcaaaaattgcgacaacagttactctaatggatatgattaaaatgaagtttatccatta 40148670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 321 - 434
Target Start/End: Complemental strand, 35780043 - 35779931
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    ||||||| |||||||||||| |  ||||||||  || | ||||||||| | ||||||||| |||||||||   |||||| ||||||||| || |  ||||    
35780043 actcaatggaactctttggtatgttttttgaaccgagtggagtcctctat-tatatagagattttgtaacgagtttagctaaaattgcggcatcgcttac 35779945  T
421 tctaatggataaga 434  Q
    |||| |||||||||    
35779944 tctagtggataaga 35779931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0352 (Bit Score: 61; Significance: 5e-26; HSPs: 1)
Name: scaffold0352

Target: scaffold0352; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 7786 - 7882
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||  || |||||||||||    
7786 gagtcctctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttactctaatggataagattaaaatggagtttatccatta 7882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 60; Significance: 2e-25; HSPs: 2)
Name: scaffold0002

Target: scaffold0002; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 321 - 456
Target Start/End: Original strand, 4703 - 4838
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||| ||| | ||||||||| || ||||||||||||||||||||||||| ||||||||||    
4703 actcaatgaaactctttggtgtgttttttgaactgagtggagtcatctatttatatagagattctgtaactgttttagcaaaaattgcgacaacagttac 4802  T
421 tctaatggataagatcaaaagagaatttatccatta 456  Q
    |||| |||||||||| ||||   | |||||||||||    
4803 tctagtggataagattaaaatgaagtttatccatta 4838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 321 - 440
Target Start/End: Complemental strand, 443399 - 443280
321 actcaatagaactctttggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttac 420  Q
    |||||||  |||||||||||||  |||||||| ||| | ||||||||| | | ||||||| || ||||||||||||||||||||||| | ||  ||||||    
443399 actcaatgaaactctttggtgtgttttttgaactgagtggagtcctctatttgtatagagattctgtaactgttttagcaaaaattgtgacagtagttac 443300  T
421 tctaatggataagatcaaaa 440  Q
    ||||||||||||||| ||||    
443299 tctaatggataagataaaaa 443280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 49; Significance: 7e-19; HSPs: 1)
Name: scaffold0057

Target: scaffold0057; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 360 - 456
Target Start/End: Original strand, 35802 - 35898
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaaagagaatttatccatta 456  Q
    ||||||||| | ||||||||  ||||||||||||||||||||| |||||| || |||||||||||||||||||||| ||||   | |||||||||||    
35802 gagtcctctgtttatatagaaattttgtaactgttttagcaaacattgcgacagcagttactctaatggataagattaaaatgaagtttatccatta 35898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0690 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0690

Target: scaffold0690; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 360 - 439
Target Start/End: Original strand, 5907 - 5984
360 gagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggataagatcaaa 439  Q
    ||||||||| | ||||||||| ||||||||||||||||||||||||||||||  ||  | ||||||||||||||||||||    
5907 gagtcctctatttatatagagattttgtaactgttttagcaaaaattgcgcc--caaatgctctaatggataagatcaaa 5984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0240 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: scaffold0240

Target: scaffold0240; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 338 - 456
Target Start/End: Original strand, 4628 - 4747
338 ggtgtactttttgaattgattagagtcctctctatatatagagcttttgtaactgttttagcaaaaattgcgccaacagttactctaatggat-aagatc 436  Q
    |||||| |||||||| ||| | ||||||||| ||||||||||| |||||||| |||||||||||||||| |   |  |||||||||||||||| |||||     
4628 ggtgtaatttttgaactgagtggagtcctctgtatatatagagattttgtaattgttttagcaaaaattacagtagtagttactctaatggataaagatg 4727  T
437 aaaagagaatttatccatta 456  Q
    ||||  ||| ||||||||||    
4728 aaaatggaacttatccatta 4747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC