View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9311-LTR4-TNT-insertion-17 (Length: 455)

Name: F9311-LTR4-TNT-insertion-17
Description: F9311-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9311-LTR4-TNT-insertion-17
F9311-LTR4-TNT-insertion-17
[»] chr2 (3 HSPs)
chr2 (8-445)||(4596916-4597353)
chr2 (251-312)||(4587590-4587651)
chr2 (245-325)||(4602126-4602206)


Alignment Details
Target: chr2 (Bit Score: 438; Significance: 0; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 438; E-Value: 0
Query Start/End: Original strand, 8 - 445
Target Start/End: Original strand, 4596916 - 4597353
Alignment:
8 cacggaatccagtttcaccacttataaactcaatgtcaacgtgagattcttaacaagacgagactaataaataaatcacattacaatttgggttgcacct 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4596916 cacggaatccagtttcaccacttataaactcaatgtcaacgtgagattcttaacaagacgagactaataaataaatcacattacaatttgggttgcacct 4597015  T
108 aattcaactcaaaaagtaagtaaatattgtccattatttataaacacaaacatataatgtggaatcttaacaagaacattaaacagaaatgaaaatatga 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4597016 aattcaactcaaaaagtaagtaaatattgtccattatttataaacacaaacatataatgtggaatcttaacaagaacattaaacagaaatgaaaatatga 4597115  T
208 gttgttaaagcaaaacaaagcaagaatggatgttactgtgcgtgagaaaaagttggaaagagaagcaccccatcctccaacatcaaaggattcctcagtg 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4597116 gttgttaaagcaaaacaaagcaagaatggatgttactgtgcgtgagaaaaagttggaaagagaagcaccccatcctccaacatcaaaggattcctcagtg 4597215  T
308 attgagtcaccaaaaagatatatttgtggcctcttagtcatgtttgatcatacaattgtatggttggacttggtgggttcagttcaggtgaaagaaatgg 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4597216 attgagtcaccaaaaagatatatttgtggcctcttagtcatgtttgatcatacaattgtatggttggacttggtgggttcagttcaggtgaaagaaatgg 4597315  T
408 aagagggtcttagatcatataactatgttgatgcatta 445  Q
    ||||||||||||||||||||||||||||||||||||||    
4597316 aagagggtcttagatcatataactatgttgatgcatta 4597353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 251 - 312
Target Start/End: Original strand, 4587590 - 4587651
Alignment:
251 gagaaaaagttggaaagagaagcaccccatcctccaacatcaaaggattcctcagtgattga 312  Q
    |||||| |||||| || |||||||||||||||||||||| |||||||||| |||||||||||    
4587590 gagaaatagttggcaaaagaagcaccccatcctccaacaccaaaggattcttcagtgattga 4587651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 245 - 325
Target Start/End: Original strand, 4602126 - 4602206
Alignment:
245 gtgcgtgagaaaaagttggaaagagaagcaccccatcctccaacatcaaaggattcctcagtgattgagtcaccaaaaaga 325  Q
    ||||| ||||||  ||||| |||||||||||||||||||||||||   || || || ||||||||||| ||||| ||||||    
4602126 gtgcgagagaaatggttggcaagagaagcaccccatcctccaacagagaatgaatcttcagtgattgaatcaccgaaaaga 4602206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC