View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9311-LTR4-TNT-insertion-17 (Length: 455)

Name: F9311-LTR4-TNT-insertion-17
Description: F9311-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9311-LTR4-TNT-insertion-17
[»] chr2 (3 HSPs)
chr2 (8-445)||(4596916-4597353)
chr2 (251-312)||(4587590-4587651)
chr2 (245-325)||(4602126-4602206)

Alignment Details
Target: chr2 (Bit Score: 438; Significance: 0; HSPs: 3)
Name: chr2

Target: chr2; HSP #1
Raw Score: 438; E-Value: 0
Query Start/End: Original strand, 8 - 445
Target Start/End: Original strand, 4596916 - 4597353
8 cacggaatccagtttcaccacttataaactcaatgtcaacgtgagattcttaacaagacgagactaataaataaatcacattacaatttgggttgcacct 107  Q
4596916 cacggaatccagtttcaccacttataaactcaatgtcaacgtgagattcttaacaagacgagactaataaataaatcacattacaatttgggttgcacct 4597015  T
108 aattcaactcaaaaagtaagtaaatattgtccattatttataaacacaaacatataatgtggaatcttaacaagaacattaaacagaaatgaaaatatga 207  Q
4597016 aattcaactcaaaaagtaagtaaatattgtccattatttataaacacaaacatataatgtggaatcttaacaagaacattaaacagaaatgaaaatatga 4597115  T
208 gttgttaaagcaaaacaaagcaagaatggatgttactgtgcgtgagaaaaagttggaaagagaagcaccccatcctccaacatcaaaggattcctcagtg 307  Q
4597116 gttgttaaagcaaaacaaagcaagaatggatgttactgtgcgtgagaaaaagttggaaagagaagcaccccatcctccaacatcaaaggattcctcagtg 4597215  T
308 attgagtcaccaaaaagatatatttgtggcctcttagtcatgtttgatcatacaattgtatggttggacttggtgggttcagttcaggtgaaagaaatgg 407  Q
4597216 attgagtcaccaaaaagatatatttgtggcctcttagtcatgtttgatcatacaattgtatggttggacttggtgggttcagttcaggtgaaagaaatgg 4597315  T
408 aagagggtcttagatcatataactatgttgatgcatta 445  Q
4597316 aagagggtcttagatcatataactatgttgatgcatta 4597353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 251 - 312
Target Start/End: Original strand, 4587590 - 4587651
251 gagaaaaagttggaaagagaagcaccccatcctccaacatcaaaggattcctcagtgattga 312  Q
    |||||| |||||| || |||||||||||||||||||||| |||||||||| |||||||||||    
4587590 gagaaatagttggcaaaagaagcaccccatcctccaacaccaaaggattcttcagtgattga 4587651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 245 - 325
Target Start/End: Original strand, 4602126 - 4602206
245 gtgcgtgagaaaaagttggaaagagaagcaccccatcctccaacatcaaaggattcctcagtgattgagtcaccaaaaaga 325  Q
    ||||| ||||||  ||||| |||||||||||||||||||||||||   || || || ||||||||||| ||||| ||||||    
4602126 gtgcgagagaaatggttggcaagagaagcaccccatcctccaacagagaatgaatcttcagtgattgaatcaccgaaaaga 4602206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 105683 times since January 2019
Visitors: 2328