View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9311-LTR4-TNT-insertion-3 (Length: 511)

Name: F9311-LTR4-TNT-insertion-3
Description: F9311-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9311-LTR4-TNT-insertion-3
F9311-LTR4-TNT-insertion-3
[»] chr1 (3 HSPs)
chr1 (10-501)||(13878074-13878565)
chr1 (431-488)||(19071410-19071467)
chr1 (431-488)||(19119300-19119357)
[»] scaffold0068 (1 HSPs)
scaffold0068 (431-488)||(58953-59015)
[»] chr6 (2 HSPs)
chr6 (431-488)||(21802924-21802987)
chr6 (400-449)||(34169207-34169256)


Alignment Details
Target: chr1 (Bit Score: 492; Significance: 0; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 492; E-Value: 0
Query Start/End: Original strand, 10 - 501
Target Start/End: Original strand, 13878074 - 13878565
Alignment:
10 atataggaggctggatgtgggggtacaaaatggacctctctagtggtagggttccaaagaattaagcttagggtataatcataatcatattccaaacata 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13878074 atataggaggctggatgtgggggtacaaaatggacctctctagtggtagggttccaaagaattaagcttagggtataatcataatcatattccaaacata 13878173  T
110 aaataccattacaatgaccgtatattttgattattcgtatggggatgtttttcggaaagagggatttgatgaggttgggtgttggtgttgggtgttgagg 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13878174 aaataccattacaatgaccgtatattttgattattcgtatggggatgtttttcggaaagagggatttgatgaggttgggtgttggtgttgggtgttgagg 13878273  T
210 taaagagagaagcattaggtgggtttctaggcaagttgattcaatgggcttgtcaaagatcctgtcattgtggttatgggttttagggcatgtttctttt 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13878274 taaagagagaagcattaggtgggtttctaggcaagttgattcaatgggcttgtcaaagatcctgtcattgtggttatgggttttagggcatgtttctttt 13878373  T
310 gtatactgtttaatgataacgaaacgatggtggtcatcatcatcattagacatatggatatgcatgttcctaataacaaatttagggttcttgaaaagaa 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13878374 gtatactgtttaatgataacgaaacgatggtggtcatcatcatcattagacatatggatatgcatgttcctaataacaaatttagggttcttgaaaagaa 13878473  T
410 tgttccaagatctttgaacacatttaaaacgcataagtgactttgcaggcaatctaactaatatctctgcctccaaatctccccctagaatt 501  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13878474 tgttccaagatctttgaacacatttaaaacgcataagtgactttgcaggcaatctaactaatatctctgcctccaaatctccccctagaatt 13878565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 431 - 488
Target Start/End: Complemental strand, 19071467 - 19071410
Alignment:
431 atttaaaacgcataagtgactttgcaggcaatctaactaatatctctgcctccaaatc 488  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
19071467 atttaaaacgcataagtgactttgcaggaaatctaactaatatctctgcctccaaatc 19071410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 431 - 488
Target Start/End: Complemental strand, 19119357 - 19119300
Alignment:
431 atttaaaacgcataagtgactttgcaggcaatctaactaatatctctgcctccaaatc 488  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
19119357 atttaaaacgcataagtgactttgcaggaaatctaactaatatctctgcctccaaatc 19119300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0068 (Bit Score: 39; Significance: 0.0000000000008; HSPs: 1)
Name: scaffold0068
Description:

Target: scaffold0068; HSP #1
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 431 - 488
Target Start/End: Complemental strand, 59015 - 58953
Alignment:
431 atttaaaacgcataagtgacttt-----gcaggcaatctaactaatatctctgcctccaaatc 488  Q
    |||||||||||||||||||||||     |||||||||||||||||||||||| ||||||||||    
59015 atttaaaacgcataagtgactttcacttgcaggcaatctaactaatatctcttcctccaaatc 58953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 33; Significance: 0.000000003; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 431 - 488
Target Start/End: Original strand, 21802924 - 21802987
Alignment:
431 atttaaaacgcataagtgactttgc------aggcaatctaactaatatctctgcctccaaatc 488  Q
    |||||||||||||||||||||||||      |||||||| ||||||||||||| ||||||||||    
21802924 atttaaaacgcataagtgactttgcacttgcaggcaatccaactaatatctcttcctccaaatc 21802987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 400 - 449
Target Start/End: Complemental strand, 34169256 - 34169207
Alignment:
400 ttgaaaagaatgttccaagatctttgaacacatttaaaacgcataagtga 449  Q
    ||||| |||||||||||||||| |||||| ||||| |||||||| |||||    
34169256 ttgaatagaatgttccaagatcgttgaacgcatttgaaacgcattagtga 34169207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98517 times since January 2019
Visitors: 2275