View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9311-LTR4-TNT-insertion-4 (Length: 289)

Name: F9311-LTR4-TNT-insertion-4
Description: F9311-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9311-LTR4-TNT-insertion-4
F9311-LTR4-TNT-insertion-4
[»] chr3 (1 HSPs)
chr3 (9-279)||(52379129-52379399)


Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 9 - 279
Target Start/End: Complemental strand, 52379399 - 52379129
Alignment:
9 ctacaacatatatgaatttagttcttcttttcttatcagttttattacattttaaattaaaccaagaaaatttaatattacttatcagataagaagatgg 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52379399 ctacaacatatatgaatttagttcttcttttcttatcagttttattacattttaaattaaaccaagaaaatttaatattacttatcagataagaagatgg 52379300  T
109 ttttcattgcaagtataaaggccccttataggtgctttcaaaagaataatagaataccttctatttttggagagtcgtgtacattgtcaagtttatcatg 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52379299 ttttcattgcaagtataaaggccccttataggtgctttcaaaagaataatagaataccttctatttttggagagtcgtgtacattgtcaagtttatcatg 52379200  T
209 ctactcttgacctttccatttctttcatccatttataagattttaactaaatgattgagttcaactgatta 279  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52379199 ctactcttgacctttccatttctttcatccatttataagattttaactaaatgattgagttcaactgatta 52379129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC