View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9311-LTR4-TNT-insertion-4 (Length: 289)

Name: F9311-LTR4-TNT-insertion-4
Description: F9311-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9311-LTR4-TNT-insertion-4
[»] chr3 (1 HSPs)
chr3 (9-279)||(52379129-52379399)

Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 9 - 279
Target Start/End: Complemental strand, 52379399 - 52379129
9 ctacaacatatatgaatttagttcttcttttcttatcagttttattacattttaaattaaaccaagaaaatttaatattacttatcagataagaagatgg 108  Q
52379399 ctacaacatatatgaatttagttcttcttttcttatcagttttattacattttaaattaaaccaagaaaatttaatattacttatcagataagaagatgg 52379300  T
109 ttttcattgcaagtataaaggccccttataggtgctttcaaaagaataatagaataccttctatttttggagagtcgtgtacattgtcaagtttatcatg 208  Q
52379299 ttttcattgcaagtataaaggccccttataggtgctttcaaaagaataatagaataccttctatttttggagagtcgtgtacattgtcaagtttatcatg 52379200  T
209 ctactcttgacctttccatttctttcatccatttataagattttaactaaatgattgagttcaactgatta 279  Q
52379199 ctactcttgacctttccatttctttcatccatttataagattttaactaaatgattgagttcaactgatta 52379129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 105525 times since January 2019
Visitors: 2328