View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9311-LTR4-TNT-insertion-5 (Length: 403)

Name: F9311-LTR4-TNT-insertion-5
Description: F9311-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9311-LTR4-TNT-insertion-5
[»] chr1 (1 HSPs)
chr1 (10-393)||(14158236-14158619)

Alignment Details
Target: chr1 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 10 - 393
Target Start/End: Original strand, 14158236 - 14158619
10 gtctccttgccttgtaagtgaaccgaacttttaaacctaacagaagattttcaacttcttccttatgcttctcaaaatcatcttctactttgaaatcttt 109  Q
14158236 gtctccttgccttgtaagtgaaccgaacttttaaacctaacagaagattttcaacttcttccttatgcttctcaaaatcatcttctactttgaaatcttt 14158335  T
110 gattttattagagatgtaactcagtaatgtttggccatcttttcttctacgaactgctctttccatggtggtgatcaagacaagaaatggtggtggtgat 209  Q
14158336 gattttattagagatgtaactcagtaatgtttggccatcttttcttctacgaactgctctttccatggtggtgatcaagacaagaaatggtggtggtgat 14158435  T
210 gagtacagcagataatgaaaatggtgnnnnnnnnnnnnnnnnnnaaaacatggtttcaaaaaccttaaatatttgaaatgtgtatctgtccctagaaata 309  Q
    ||||||||||||||||||||||||||                  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14158436 gagtacagcagataatgaaaatggtgagaagagaagaagaagaaaaaacatggtttcaaaaaccttaaatatttgaaatgtgtatctgtccctagaaata 14158535  T
310 gaaactgcatgctttgcagcttccaaaggagacaaaacatgagaacggaaataaggtcaatttcagcttatgtaacccatatta 393  Q
14158536 gaaactgcatgctttgcagcttccaaaggagacaaaacatgagaacggaaataaggtcaatttcagcttatgtaacccatatta 14158619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 84048 times since January 2019
Visitors: 2323