View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9311-LTR4-TNT-insertion-5 (Length: 403)

Name: F9311-LTR4-TNT-insertion-5
Description: F9311-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9311-LTR4-TNT-insertion-5
F9311-LTR4-TNT-insertion-5
[»] chr1 (1 HSPs)
chr1 (10-393)||(14158236-14158619)


Alignment Details
Target: chr1 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 10 - 393
Target Start/End: Original strand, 14158236 - 14158619
Alignment:
10 gtctccttgccttgtaagtgaaccgaacttttaaacctaacagaagattttcaacttcttccttatgcttctcaaaatcatcttctactttgaaatcttt 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14158236 gtctccttgccttgtaagtgaaccgaacttttaaacctaacagaagattttcaacttcttccttatgcttctcaaaatcatcttctactttgaaatcttt 14158335  T
110 gattttattagagatgtaactcagtaatgtttggccatcttttcttctacgaactgctctttccatggtggtgatcaagacaagaaatggtggtggtgat 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14158336 gattttattagagatgtaactcagtaatgtttggccatcttttcttctacgaactgctctttccatggtggtgatcaagacaagaaatggtggtggtgat 14158435  T
210 gagtacagcagataatgaaaatggtgnnnnnnnnnnnnnnnnnnaaaacatggtttcaaaaaccttaaatatttgaaatgtgtatctgtccctagaaata 309  Q
    ||||||||||||||||||||||||||                  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14158436 gagtacagcagataatgaaaatggtgagaagagaagaagaagaaaaaacatggtttcaaaaaccttaaatatttgaaatgtgtatctgtccctagaaata 14158535  T
310 gaaactgcatgctttgcagcttccaaaggagacaaaacatgagaacggaaataaggtcaatttcagcttatgtaacccatatta 393  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14158536 gaaactgcatgctttgcagcttccaaaggagacaaaacatgagaacggaaataaggtcaatttcagcttatgtaacccatatta 14158619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC