View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9311-LTR4-TNT-insertion-6 (Length: 315)

Name: F9311-LTR4-TNT-insertion-6
Description: F9311-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9311-LTR4-TNT-insertion-6
F9311-LTR4-TNT-insertion-6
[»] chr2 (1 HSPs)
chr2 (10-305)||(36568999-36569294)
[»] chr4 (1 HSPs)
chr4 (252-301)||(18770148-18770197)


Alignment Details
Target: chr2 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 10 - 305
Target Start/End: Complemental strand, 36569294 - 36568999
Alignment:
10 accgtgacgtcgcggtttggtcacctatactatacggcgcggctgttccggtttcgccttacttgtcggagattctaaggcaagatcaaacttcaggagg 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36569294 accgtgacgtcgcggtttggtcacctatactatacggcgcggctgttccggtttcgccttacttgtcggagattctaaggcaagatcaaacttcaggagg 36569195  T
110 agtgttggtcaacgttaaagtcaacggtagggttaagtggaaagtagggacttgggtttctggaaggtaccatattgatgtgaactgtccggcgtttata 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36569194 agtgttggtcaacgttaaagtcaacggtagggttaagtggaaagtagggacttgggtttctggaaggtaccatattgatgtgaactgtccggcgtttata 36569095  T
210 aaggtcgccggtgataagggtgatgatgggttcggagtttctgctccggcggtgaagtttcagtttttgcaaagttgtgttgttgatgtttaatta 305  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36569094 aaggtcgccggtgataagggtgatgatgggttcggagtttctgctccggcggtgaagtttcagtttttgcaaagttgtgttgttgatgtttaatta 36568999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 252 - 301
Target Start/End: Original strand, 18770148 - 18770197
Alignment:
252 gctccggcggtgaagtttcagtttttgcaaagttgtgttgttgatgttta 301  Q
    ||||||||||| ||||||||| ||||||||| ||||  ||||||||||||    
18770148 gctccggcggttaagtttcagcttttgcaaaattgtcatgttgatgttta 18770197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC