View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9311-LTR4-TNT-insertion-7 (Length: 588)

Name: F9311-LTR4-TNT-insertion-7
Description: F9311-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9311-LTR4-TNT-insertion-7
F9311-LTR4-TNT-insertion-7
[»] chr3 (3 HSPs)
chr3 (9-579)||(51575065-51575635)
chr3 (452-541)||(51574935-51575024)
chr3 (436-471)||(51574590-51574625)
[»] chr2 (29 HSPs)
chr2 (27-147)||(2362283-2362400)
chr2 (32-171)||(39603512-39603651)
chr2 (215-310)||(2361862-2361957)
chr2 (211-285)||(2362223-2362297)
chr2 (72-153)||(39098913-39098994)
chr2 (437-524)||(39192889-39192976)
chr2 (437-524)||(39198569-39198656)
chr2 (437-522)||(39390594-39390679)
chr2 (440-489)||(39390807-39390856)
chr2 (408-522)||(39152219-39152333)
chr2 (443-513)||(39415153-39415223)
chr2 (437-486)||(39415531-39415580)
chr2 (478-559)||(39451779-39451860)
chr2 (408-489)||(39467902-39467983)
chr2 (445-510)||(39468007-39468072)
chr2 (156-204)||(39098820-39098868)
chr2 (68-124)||(39152677-39152733)
chr2 (409-489)||(39398249-39398329)
chr2 (233-284)||(2361930-2361981)
chr2 (450-513)||(39398164-39398227)
chr2 (156-206)||(39105775-39105825)
chr2 (465-559)||(39221748-39221842)
chr2 (409-489)||(39487829-39487909)
chr2 (437-485)||(39193099-39193147)
chr2 (437-485)||(39198779-39198827)
chr2 (437-513)||(39221962-39222038)
chr2 (437-513)||(39222172-39222248)
chr2 (437-521)||(39222290-39222374)
chr2 (409-489)||(39222490-39222570)
[»] chr4 (1 HSPs)
chr4 (218-262)||(33151692-33151736)
[»] chr5 (1 HSPs)
chr5 (437-489)||(33560199-33560251)


Alignment Details
Target: chr3 (Bit Score: 571; Significance: 0; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 571; E-Value: 0
Query Start/End: Original strand, 9 - 579
Target Start/End: Complemental strand, 51575635 - 51575065
Alignment:
9 aacaaccaatatcattatatcaggttgaaatgaaattgtctcattaaactagatgagggaaaacatttacctgattcaatttcctcttcaaaagatttta 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51575635 aacaaccaatatcattatatcaggttgaaatgaaattgtctcattaaactagatgagggaaaacatttacctgattcaatttcctcttcaaaagatttta 51575536  T
109 taaatgtttcatattgattgtctcttaactcaagttccttcagttgcccttcaaattgattctcttttgatttcagctcctttagttgcagttcaaaacg 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51575535 taaatgtttcatattgattgtctcttaactcaagttccttcagttgcccttcaaattgattctcttttgatttcagctcctttagttgcagttcaaaacg 51575436  T
209 atttagttcaaattcctcttcttttgattcaaactcccttacgcggccttcaaagtccttctcttttgatttaaactctctcactttgcctttaaattcc 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51575435 atttagttcaaattcctcttcttttgattcaaactcccttacgcggccttcaaagtccttctcttttgatttaaactctctcactttgcctttaaattcc 51575336  T
309 tcctcttctgatcgaagctccttcactcgactttcgaaaaacttctgttttgtacctagctctttcactcggctttcaaaatcattcatttttgtaccga 408  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51575335 tcctcttctgatcgaagctccttcactcgactttcgaaaaacttctgttttgtacctagctctttcactcggctttcaaaatcattcatttttgtaccga 51575236  T
409 gctccttcacccggtcttcaaagttcacctcttttgattcaaactccttcactcgaccttcaagttgattctcttttgacttgagatccttcacttggct 508  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51575235 gctccttcacccggtcttcaaagttcacctcttttgattcaaactccttcactcgaccttcaagttgattctcttttgacttgagatccttcacttggct 51575136  T
509 ttcaagatgcttctttactaattcaagctccttcaatttgcctttaaattcgtgctctttcaattcaattg 579  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51575135 ttcaagatgcttctttactaattcaagctccttcaatttgcctttaaattcgtgctctttcaattcaattg 51575065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 452 - 541
Target Start/End: Complemental strand, 51575024 - 51574935
Alignment:
452 ctccttcactcgaccttcaagttgattctcttttgacttgagatccttcacttggctttcaagatgcttctttactaattcaagctcctt 541  Q
    ||||||||| || ||||||| ||| ||||||||||| ||||| ||||||||||||||||||| |||||||||| || |||||| ||||||    
51575024 ctccttcacccgtccttcaaattgtttctcttttgatttgagttccttcacttggctttcaaaatgcttcttttctgattcaacctcctt 51574935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 436 - 471
Target Start/End: Complemental strand, 51574625 - 51574590
Alignment:
436 cctcttttgattcaaactccttcactcgaccttcaa 471  Q
    ||||||||||||||||||||||||| ||||||||||    
51574625 cctcttttgattcaaactccttcacccgaccttcaa 51574590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 55; Significance: 3e-22; HSPs: 29)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 27 - 147
Target Start/End: Complemental strand, 2362400 - 2362283
Alignment:
27 atcaggttgaaatgaaattgtctcattaaactagatgagggaaaacatttacctgattcaatttcctcttcaaaagattttataaatgtttcatattgat 126  Q
    |||| |||||||| ||| |||||||||||||||||||| |   | | ||||||||||||||||||||||||||| |||||||| || ||||||||||||     
2362400 atcaagttgaaattaaaatgtctcattaaactagatgaag---agcttttacctgattcaatttcctcttcaaatgattttattaacgtttcatattgac 2362304  T
127 tgtctcttaactcaagttcct 147  Q
     ||||||||  ||||||||||    
2362303 cgtctcttagttcaagttcct 2362283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 32 - 171
Target Start/End: Complemental strand, 39603651 - 39603512
Alignment:
32 gttgaaatgaaattgtctcattaaactagatgagggaaaacatttacctgattcaatttcctcttcaaaagattttataaatgtttcatattgattgtct 131  Q
    ||||||||| |||||||| | ||||| |||||| | | | | ||||||||||| ||||||||| ||||| |||||||  |||| |||||||||||  |||    
39603651 gttgaaatggaattgtcttaataaaccagatgatgaagatcgtttacctgatttaatttcctcgtcaaatgattttagtaatgcttcatattgatcctct 39603552  T
132 cttaactcaagttccttcagttgcccttcaaattgattct 171  Q
    ||||||||||| | ||||||||  || ||||||| |||||    
39603551 cttaactcaagcttcttcagttctccatcaaattcattct 39603512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 215 - 310
Target Start/End: Complemental strand, 2361957 - 2361862
Alignment:
215 ttcaaattcctcttcttttgattcaaactcccttacgcggccttcaaagtccttctcttttgatttaaactctctcactttgcctttaaattcctc 310  Q
    |||||| ||||  ||||||||||||||| || |||| |||| ||||||||||||||||| |||||||||||||  ||||  ||||| |||||||||    
2361957 ttcaaagtccttctcttttgattcaaacccctttactcggctttcaaagtccttctcttgtgatttaaactcttccactcggccttcaaattcctc 2361862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 211 - 285
Target Start/End: Complemental strand, 2362297 - 2362223
Alignment:
211 ttagttcaaattcctcttcttttgattcaaactcccttacgcggccttcaaagtccttctcttttgatttaaact 285  Q
    ||||||||| ||||||||||||||||||||||| ||| || |||| ||||||||||||||||  ||||| |||||    
2362297 ttagttcaagttcctcttcttttgattcaaacttcctcactcggctttcaaagtccttctctactgattcaaact 2362223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 72 - 153
Target Start/End: Complemental strand, 39098994 - 39098913
Alignment:
72 catttacctgattcaatttcctcttcaaaagattttataaatgtttcatattgattgtctcttaactcaagttccttcagtt 153  Q
    ||||||||||| | ||||||||||||||| |||||||  |||| || ||||||||| |||||||||||||  ||||||||||    
39098994 catttacctgaattaatttcctcttcaaatgattttagtaatgctttatattgattctctcttaactcaatgtccttcagtt 39098913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 437 - 524
Target Start/End: Original strand, 39192889 - 39192976
Alignment:
437 ctcttttgattcaaactccttcactcgaccttcaagttgattctcttttgacttgagatccttcacttggctttcaagatgcttcttt 524  Q
    ||||||||||||||||| |||||| ||||||||| ||||  |||| |||||||  || ||||||| |||||||||||  |||||||||    
39192889 ctcttttgattcaaacttcttcacccgaccttcatgttgcatctcgtttgactcaagctccttcatttggctttcaatgtgcttcttt 39192976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 437 - 524
Target Start/End: Original strand, 39198569 - 39198656
Alignment:
437 ctcttttgattcaaactccttcactcgaccttcaagttgattctcttttgacttgagatccttcacttggctttcaagatgcttcttt 524  Q
    ||||||||||||||||| |||||| ||||||||| ||||  |||| |||||||  || ||||||| |||||||||||  |||||||||    
39198569 ctcttttgattcaaacttcttcacccgaccttcatgttgcatctcgtttgactcaagctccttcatttggctttcaatgtgcttcttt 39198656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 437 - 522
Target Start/End: Original strand, 39390594 - 39390679
Alignment:
437 ctcttttgattcaaactccttcactcgaccttcaagttgattctcttttgacttgagatccttcacttggctttcaagatgcttct 522  Q
    |||||||||||||  |||||||||||| | |||| |||| |||||||||||||  |  ||||||| ||||||||||| ||||||||    
39390594 ctcttttgattcatgctccttcactcggctttcatgttgcttctcttttgactcaaactccttcatttggctttcaaaatgcttct 39390679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 440 - 489
Target Start/End: Original strand, 39390807 - 39390856
Alignment:
440 ttttgattcaaactccttcactcgaccttcaagttgattctcttttgact 489  Q
    |||||||||||| ||||||||||| |||||||||||| ||||||||||||    
39390807 ttttgattcaaattccttcactcggccttcaagttgactctcttttgact 39390856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 408 - 522
Target Start/End: Complemental strand, 39152333 - 39152219
Alignment:
408 agctccttcacccggtcttcaaagttca-cctcttttgattcaaactccttcactcgaccttcaagttgattctcttttgacttgagatccttcacttgg 506  Q
    |||| ||||||| || ||||||| |||| ||||||||||||||||| |||||||||| || |||||||| |||||||| ||||  || ||||| |   ||    
39152333 agcttcttcacctggccttcaaa-ttcatcctcttttgattcaaaccccttcactcgtccatcaagttgtttctctttagactcaagttccttaatccgg 39152235  T
507 ctttcaagatgcttct 522  Q
    ||||||| ||||||||    
39152234 ctttcaaaatgcttct 39152219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 443 - 513
Target Start/End: Original strand, 39415153 - 39415223
Alignment:
443 tgattcaaactccttcactcgaccttcaagttgattctcttttgacttgagatccttcacttggctttcaa 513  Q
    |||||| | ||||||||||||||||||| |||| |||||||||||||  || ||||||| | |||||||||    
39415153 tgattccagctccttcactcgaccttcatgttgcttctcttttgactcaagctccttcattcggctttcaa 39415223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 437 - 486
Target Start/End: Original strand, 39415531 - 39415580
Alignment:
437 ctcttttgattcaaactccttcactcgaccttcaagttgattctcttttg 486  Q
    ||||||||||||| ||||||||||| |||||||| |||| ||||||||||    
39415531 ctcttttgattcacactccttcacttgaccttcatgttgcttctcttttg 39415580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 478 - 559
Target Start/End: Complemental strand, 39451860 - 39451779
Alignment:
478 tctcttttgacttgagatccttcacttggctttcaagatgcttctttactaattcaagctccttcaatttgcctttaaattc 559  Q
    |||||||||| ||||| |||| |||||||||||||| ||||||||||    |||| || ||||||| |||||||| ||||||    
39451860 tctcttttgatttgagctcctccacttggctttcaaaatgcttctttttagattccagatccttcactttgccttcaaattc 39451779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 408 - 489
Target Start/End: Complemental strand, 39467983 - 39467902
Alignment:
408 agctccttcacccggtcttcaaagttcacctcttttgattcaaactccttcactcgaccttcaagttgattctcttttgact 489  Q
    |||||||||| | || ||||||| ||| |||||||||||||||||||||||   || |||||||| ||  ||||||||||||    
39467983 agctccttcatctggccttcaaatttctcctcttttgattcaaactccttcttccggccttcaagctgcatctcttttgact 39467902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 445 - 510
Target Start/End: Complemental strand, 39468072 - 39468007
Alignment:
445 attcaaactccttcactcgaccttcaagttgattctcttttgacttgagatccttcacttggcttt 510  Q
    ||||||||||||||||||| ||| ||||||| |||||||||||||  |  ||||||| ||||||||    
39468072 attcaaactccttcactcgtcctgcaagttggttctcttttgactccaactccttcaattggcttt 39468007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 156 - 204
Target Start/End: Complemental strand, 39098868 - 39098820
Alignment:
156 ccttcaaattgattctcttttgatttcagctcctttagttgcagttcaa 204  Q
    |||||||| ||||||||||||||||| ||||||||| |||||| |||||    
39098868 ccttcaaactgattctcttttgattttagctccttttgttgcacttcaa 39098820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 68 - 124
Target Start/End: Complemental strand, 39152733 - 39152677
Alignment:
68 aaaacatttacctgattcaatttcctcttcaaaagattttataaatgtttcatattg 124  Q
    |||||||||||||||||| |||||||| |||||| ||||||| |||| | |||||||    
39152733 aaaacatttacctgattctatttcctcatcaaaatattttattaatggtccatattg 39152677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 409 - 489
Target Start/End: Original strand, 39398249 - 39398329
Alignment:
409 gctccttcacccggtcttcaaagttcacctcttttgattcaaactccttcactcgaccttcaagttgattctcttttgact 489  Q
    ||||||||| | || ||||||| ||| |||||||||| ||||||||||||   || |||||||||||  ||||||||||||    
39398249 gctccttcatctggccttcaaatttctcctcttttgactcaaactccttcttccggccttcaagttgcatctcttttgact 39398329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 233 - 284
Target Start/End: Complemental strand, 2361981 - 2361930
Alignment:
233 tgattcaaactcccttacgcggccttcaaagtccttctcttttgatttaaac 284  Q
    ||||||||||| ||| || |||| ||||||||||||||||||||||| ||||    
2361981 tgattcaaacttcctcactcggctttcaaagtccttctcttttgattcaaac 2361930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 450 - 513
Target Start/End: Original strand, 39398164 - 39398227
Alignment:
450 aactccttcactcgaccttcaagttgattctcttttgacttgagatccttcacttggctttcaa 513  Q
    |||||||||||||| ||| ||||||| |||||||||||||  |  ||||||| |||||||||||    
39398164 aactccttcactcgtcctacaagttggttctcttttgactctaactccttcaattggctttcaa 39398227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 156 - 206
Target Start/End: Complemental strand, 39105825 - 39105775
Alignment:
156 ccttcaaattgattctcttttgatttcagctcctttagttgcagttcaaaa 206  Q
    |||| ||| ||||||||||||||||| ||||||||| |||||| |||||||    
39105825 cctttaaactgattctcttttgattttagctccttttgttgcatttcaaaa 39105775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 465 - 559
Target Start/End: Complemental strand, 39221842 - 39221748
Alignment:
465 ccttcaagttgattctcttttgacttgagatccttcacttggctttcaagatgcttctttactaattcaagctccttcaatttgcctttaaattc 559  Q
    ||||||| |||  |||||||||||||||| || | |||||||||||||| ||||||| || || |||| |  ||||||| || ||||| ||||||    
39221842 ccttcaaattgcctctcttttgacttgagctcgtccacttggctttcaaaatgcttccttcctgattccaaatccttcatttggccttcaaattc 39221748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 409 - 489
Target Start/End: Original strand, 39487829 - 39487909
Alignment:
409 gctccttcacccggtcttcaaagttca-cctcttttgattcaaactccttcactcgaccttcaagttgattctcttttgact 489  Q
    |||||||||||||| ||||||| |||| |||||||| | |  |||||||||| ||| || |||||||| |||||||||||||    
39487829 gctccttcacccggccttcaaa-ttcatcctcttttaactttaactccttcattcggccatcaagttgcttctcttttgact 39487909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 437 - 485
Target Start/End: Original strand, 39193099 - 39193147
Alignment:
437 ctcttttgattcaaactccttcactcgaccttcaagttgattctctttt 485  Q
    ||||||||||||||||| |||||| ||||||||| ||||  ||||||||    
39193099 ctcttttgattcaaacttcttcacccgaccttcatgttgcatctctttt 39193147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 437 - 485
Target Start/End: Original strand, 39198779 - 39198827
Alignment:
437 ctcttttgattcaaactccttcactcgaccttcaagttgattctctttt 485  Q
    ||||||||||||||||| |||||| ||||||||| ||||  ||||||||    
39198779 ctcttttgattcaaacttcttcacccgaccttcatgttgcatctctttt 39198827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 437 - 513
Target Start/End: Complemental strand, 39222038 - 39221962
Alignment:
437 ctcttttgattcaaactccttcactcgaccttcaagttgattctcttttgacttgagatccttcacttggctttcaa 513  Q
    ||||||||||| ||||| | ||| | | ||| ||||||| || ||||||||||| |  |||||||||||||||||||    
39222038 ctcttttgatttaaacttcctcaattggcctacaagttggttatcttttgactttaactccttcacttggctttcaa 39221962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 437 - 513
Target Start/End: Complemental strand, 39222248 - 39222172
Alignment:
437 ctcttttgattcaaactccttcactcgaccttcaagttgattctcttttgacttgagatccttcacttggctttcaa 513  Q
    ||||||||||| ||||| | ||| | | ||| ||||||| || ||||||||||| |  |||||||||||||||||||    
39222248 ctcttttgatttaaacttcctcaattggcctacaagttggttatcttttgactttaactccttcacttggctttcaa 39222172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 437 - 521
Target Start/End: Complemental strand, 39222374 - 39222290
Alignment:
437 ctcttttgattcaaactccttcactcgaccttcaagttgattctcttttgacttgagatccttcacttggctttcaagatgcttc 521  Q
    ||||||||||| |  |||||||||| | ||||||||||| |||||||| ||||  |  ||||||| ||||||||| | |||||||    
39222374 ctcttttgatttatgctccttcacttggccttcaagttgcttctctttagactcaaactccttcatttggctttcgaaatgcttc 39222290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 409 - 489
Target Start/End: Complemental strand, 39222570 - 39222490
Alignment:
409 gctccttcacccggtcttcaaagttcacctcttttgattcaaactccttcactcgaccttcaagttgattctcttttgact 489  Q
    |||||||||  ||| |||||||||   ||||||| |||||||||||||||||||| || |||| ||  |||||||| ||||    
39222570 gctccttcattcggccttcaaagtcatcctctttagattcaaactccttcactcggccatcaaatttcttctctttagact 39222490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 218 - 262
Target Start/End: Complemental strand, 33151736 - 33151692
Alignment:
218 aaattcctcttcttttgattcaaactcccttacgcggccttcaaa 262  Q
    ||||||||||||||||||||||||||||| ||| |||||||||||    
33151736 aaattcctcttcttttgattcaaactcccgtactcggccttcaaa 33151692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 437 - 489
Target Start/End: Complemental strand, 33560251 - 33560199
Alignment:
437 ctcttttgattcaaactccttcactcgaccttcaagttgattctcttttgact 489  Q
    |||||||||||||||||||||||| || |||||| ||||  ||||||||||||    
33560251 ctcttttgattcaaactccttcacccggccttcatgttgcatctcttttgact 33560199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC