View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9311-LTR4-TNT-insertion-8 (Length: 269)

Name: F9311-LTR4-TNT-insertion-8
Description: F9311-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9311-LTR4-TNT-insertion-8
F9311-LTR4-TNT-insertion-8
[»] chr4 (2 HSPs)
chr4 (11-259)||(1228829-1229077)
chr4 (170-255)||(54267042-54267127)
[»] chr2 (1 HSPs)
chr2 (185-250)||(25049790-25049855)


Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 11 - 259
Target Start/End: Original strand, 1228829 - 1229077
Alignment:
11 caaacgtaaacgtaaaagcattccaagaaactcacctccacaaagaagctcagtttataggggtgtcacaaggttaattaattaatcaaattttgatgtt 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1228829 caaacgtaaacgtaaaagcattccaagaaactcacctccacaaagaagctcagtttataggggtgtcacaaggttaattaattaatcaaattttgatgtt 1228928  T
111 tttcattttgatctttatgtttttgtgtcctctaaaattgataatattgttttagacatcgttggaccggtcgatatgaagctcatttgtgggataagaa 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1228929 tttcattttgatctttatgtttttgtgtcctctaaaattgataatattgttttagacatcgttggaccggtcgatatgaagctcatttgtgggataagaa 1229028  T
211 ttgctggaatgaatcacaaagcaagaaaggaagacaaggtgatttaatt 259  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
1229029 ttgctggaatgaatcacaaagcaagaaaggaagacaaggtgatttaatt 1229077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 170 - 255
Target Start/End: Original strand, 54267042 - 54267127
Alignment:
170 cgttggaccggtcgatatgaagctcatttgtgggataagaattgctggaatgaatcacaaagcaagaaaggaagacaaggtgattt 255  Q
    |||||||| || ||||||||||||||||||||||| |||||||| |||||||| || || | ||||||||| ||||||||| ||||    
54267042 cgttggacaggccgatatgaagctcatttgtgggacaagaattgttggaatgagtctcagaacaagaaagggagacaaggtaattt 54267127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 185 - 250
Target Start/End: Original strand, 25049790 - 25049855
Alignment:
185 tatgaagctcatttgtgggataagaattgctggaatgaatcacaaagcaagaaaggaagacaaggt 250  Q
    |||||||||||||||||||| |||||||| ||||||||||| |||| ||| |||||| ||||||||    
25049790 tatgaagctcatttgtgggacaagaattgttggaatgaatcgcaaaacaaaaaaggacgacaaggt 25049855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 77757 times since January 2019
Visitors: 2276