View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9311-LTR4-TNT-insertion-8 (Length: 269)

Name: F9311-LTR4-TNT-insertion-8
Description: F9311-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9311-LTR4-TNT-insertion-8
[»] chr4 (2 HSPs)
chr4 (11-259)||(1228829-1229077)
chr4 (170-255)||(54267042-54267127)
[»] chr2 (1 HSPs)
chr2 (185-250)||(25049790-25049855)

Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr4

Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 11 - 259
Target Start/End: Original strand, 1228829 - 1229077
11 caaacgtaaacgtaaaagcattccaagaaactcacctccacaaagaagctcagtttataggggtgtcacaaggttaattaattaatcaaattttgatgtt 110  Q
1228829 caaacgtaaacgtaaaagcattccaagaaactcacctccacaaagaagctcagtttataggggtgtcacaaggttaattaattaatcaaattttgatgtt 1228928  T
111 tttcattttgatctttatgtttttgtgtcctctaaaattgataatattgttttagacatcgttggaccggtcgatatgaagctcatttgtgggataagaa 210  Q
1228929 tttcattttgatctttatgtttttgtgtcctctaaaattgataatattgttttagacatcgttggaccggtcgatatgaagctcatttgtgggataagaa 1229028  T
211 ttgctggaatgaatcacaaagcaagaaaggaagacaaggtgatttaatt 259  Q
1229029 ttgctggaatgaatcacaaagcaagaaaggaagacaaggtgatttaatt 1229077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 170 - 255
Target Start/End: Original strand, 54267042 - 54267127
170 cgttggaccggtcgatatgaagctcatttgtgggataagaattgctggaatgaatcacaaagcaagaaaggaagacaaggtgattt 255  Q
    |||||||| || ||||||||||||||||||||||| |||||||| |||||||| || || | ||||||||| ||||||||| ||||    
54267042 cgttggacaggccgatatgaagctcatttgtgggacaagaattgttggaatgagtctcagaacaagaaagggagacaaggtaattt 54267127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 185 - 250
Target Start/End: Original strand, 25049790 - 25049855
185 tatgaagctcatttgtgggataagaattgctggaatgaatcacaaagcaagaaaggaagacaaggt 250  Q
    |||||||||||||||||||| |||||||| ||||||||||| |||| ||| |||||| ||||||||    
25049790 tatgaagctcatttgtgggacaagaattgttggaatgaatcgcaaaacaaaaaaggacgacaaggt 25049855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC