View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9312-LTR4-TNT-insertion-1 (Length: 336)

Name: F9312-LTR4-TNT-insertion-1
Description: F9312-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9312-LTR4-TNT-insertion-1
[»] chr2 (2 HSPs)
chr2 (7-326)||(43284620-43284939)
chr2 (234-289)||(4140191-4140246)
[»] chr1 (1 HSPs)
chr1 (188-289)||(6345534-6345635)
[»] chr8 (1 HSPs)
chr8 (189-289)||(4970227-4970327)
[»] chr4 (1 HSPs)
chr4 (202-259)||(3232439-3232496)

Alignment Details
Target: chr2 (Bit Score: 320; Significance: 1e-180; HSPs: 2)
Name: chr2

Target: chr2; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 7 - 326
Target Start/End: Complemental strand, 43284939 - 43284620
7 aaaatgcgttgtaatttttgtctataaccagatccaaaataatgccattttcgctactaaagttgctgttcggactgagaaaagggaagaaagaagccaa 106  Q
43284939 aaaatgcgttgtaatttttgtctataaccagatccaaaataatgccattttcgctactaaagttgctgttcggactgagaaaagggaagaaagaagccaa 43284840  T
107 gggtaattgtcaggggtatttttagtattttctcacgtgtctggttttattaagggcaaaatggtcattttgggcataaacgctgagtcatcaaagtcct 206  Q
43284839 gggtaattgtcaggggtatttttagtattttctcacgtgtctggttttattaagggcaaaatggtcattttgggcataaacgctgagtcatcaaagtcct 43284740  T
207 tacccagtcagctaatgccatgtcattgccacgtaagtaatcacttgccacatgggcgttcagatgtaattaggaccaaatttgggaggattagtacctg 306  Q
43284739 tacccagtcagctaatgccatgtcattgccacgtaagtaatcacttgccacatgggcgttcagatgtaattaggaccaaatttgggaggattagtacctg 43284640  T
307 cagggtctaaaattcaattg 326  Q
43284639 cagggtctaaaattcaattg 43284620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 234 - 289
Target Start/End: Complemental strand, 4140246 - 4140191
234 gccacgtaagtaatcacttgccacatgggcgttcagatgtaattaggaccaaattt 289  Q
    ||||||||||||||||||||||||||| ||  || || ||||||| ||||||||||    
4140246 gccacgtaagtaatcacttgccacatgtgcaatctgaagtaattaagaccaaattt 4140191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 188 - 289
Target Start/End: Original strand, 6345534 - 6345635
188 gctgagtcatcaaagtccttacccagtcagctaatgccatgtcattgccacgtaagtaatcacttgccacatgggcgttcagatgtaattaggaccaaat 287  Q
    ||||||||| ||||||| | |||||||||| |  ||||| ||||||||||| | ||||||||| |||||||| |||  | ||| ||||||||||| ||||    
6345534 gctgagtcagcaaagtcttgacccagtcagatggtgccacgtcattgccacatcagtaatcacgtgccacataggcaataagaagtaattaggactaaat 6345633  T
288 tt 289  Q
6345634 tt 6345635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 189 - 289
Target Start/End: Complemental strand, 4970327 - 4970227
189 ctgagtcatcaaagtccttacccagtcagctaatgccatgtcattgccacgtaagtaatcacttgccacatgggcgttcagatgtaattaggaccaaatt 288  Q
    |||||||| ||||||| | |||||||||| |  ||||| ||||||||||| | ||||||||| |||||||| |||  | ||| ||||||||||| |||||    
4970327 ctgagtcagcaaagtcttgacccagtcagatggtgccacgtcattgccacatcagtaatcacgtgccacataggcaataagaagtaattaggactaaatt 4970228  T
289 t 289  Q
4970227 t 4970227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 3232439 - 3232496
202 gtccttacccagtcagctaatgccatgtcattgccacgtaagtaatcacttgccacat 259  Q
    |||||||||||||||||||  |||| |||| |||||  |||||||||||||| |||||    
3232439 gtccttacccagtcagctagagccacgtcagtgccatataagtaatcacttgacacat 3232496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 84212 times since January 2019
Visitors: 2323