View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9312-LTR4-TNT-insertion-1 (Length: 336)

Name: F9312-LTR4-TNT-insertion-1
Description: F9312-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9312-LTR4-TNT-insertion-1
F9312-LTR4-TNT-insertion-1
[»] chr2 (2 HSPs)
chr2 (7-326)||(43284620-43284939)
chr2 (234-289)||(4140191-4140246)
[»] chr1 (1 HSPs)
chr1 (188-289)||(6345534-6345635)
[»] chr8 (1 HSPs)
chr8 (189-289)||(4970227-4970327)
[»] chr4 (1 HSPs)
chr4 (202-259)||(3232439-3232496)


Alignment Details
Target: chr2 (Bit Score: 320; Significance: 1e-180; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 7 - 326
Target Start/End: Complemental strand, 43284939 - 43284620
Alignment:
7 aaaatgcgttgtaatttttgtctataaccagatccaaaataatgccattttcgctactaaagttgctgttcggactgagaaaagggaagaaagaagccaa 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43284939 aaaatgcgttgtaatttttgtctataaccagatccaaaataatgccattttcgctactaaagttgctgttcggactgagaaaagggaagaaagaagccaa 43284840  T
107 gggtaattgtcaggggtatttttagtattttctcacgtgtctggttttattaagggcaaaatggtcattttgggcataaacgctgagtcatcaaagtcct 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43284839 gggtaattgtcaggggtatttttagtattttctcacgtgtctggttttattaagggcaaaatggtcattttgggcataaacgctgagtcatcaaagtcct 43284740  T
207 tacccagtcagctaatgccatgtcattgccacgtaagtaatcacttgccacatgggcgttcagatgtaattaggaccaaatttgggaggattagtacctg 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43284739 tacccagtcagctaatgccatgtcattgccacgtaagtaatcacttgccacatgggcgttcagatgtaattaggaccaaatttgggaggattagtacctg 43284640  T
307 cagggtctaaaattcaattg 326  Q
    ||||||||||||||||||||    
43284639 cagggtctaaaattcaattg 43284620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 234 - 289
Target Start/End: Complemental strand, 4140246 - 4140191
Alignment:
234 gccacgtaagtaatcacttgccacatgggcgttcagatgtaattaggaccaaattt 289  Q
    ||||||||||||||||||||||||||| ||  || || ||||||| ||||||||||    
4140246 gccacgtaagtaatcacttgccacatgtgcaatctgaagtaattaagaccaaattt 4140191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 188 - 289
Target Start/End: Original strand, 6345534 - 6345635
Alignment:
188 gctgagtcatcaaagtccttacccagtcagctaatgccatgtcattgccacgtaagtaatcacttgccacatgggcgttcagatgtaattaggaccaaat 287  Q
    ||||||||| ||||||| | |||||||||| |  ||||| ||||||||||| | ||||||||| |||||||| |||  | ||| ||||||||||| ||||    
6345534 gctgagtcagcaaagtcttgacccagtcagatggtgccacgtcattgccacatcagtaatcacgtgccacataggcaataagaagtaattaggactaaat 6345633  T
288 tt 289  Q
    ||    
6345634 tt 6345635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 189 - 289
Target Start/End: Complemental strand, 4970327 - 4970227
Alignment:
189 ctgagtcatcaaagtccttacccagtcagctaatgccatgtcattgccacgtaagtaatcacttgccacatgggcgttcagatgtaattaggaccaaatt 288  Q
    |||||||| ||||||| | |||||||||| |  ||||| ||||||||||| | ||||||||| |||||||| |||  | ||| ||||||||||| |||||    
4970327 ctgagtcagcaaagtcttgacccagtcagatggtgccacgtcattgccacatcagtaatcacgtgccacataggcaataagaagtaattaggactaaatt 4970228  T
289 t 289  Q
    |    
4970227 t 4970227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 3232439 - 3232496
Alignment:
202 gtccttacccagtcagctaatgccatgtcattgccacgtaagtaatcacttgccacat 259  Q
    |||||||||||||||||||  |||| |||| |||||  |||||||||||||| |||||    
3232439 gtccttacccagtcagctagagccacgtcagtgccatataagtaatcacttgacacat 3232496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC