View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9312-LTR4-TNT-insertion-3 (Length: 193)

Name: F9312-LTR4-TNT-insertion-3
Description: F9312-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9312-LTR4-TNT-insertion-3
F9312-LTR4-TNT-insertion-3
[»] chr3 (18 HSPs)
chr3 (8-184)||(4305151-4305327)
chr3 (60-179)||(28874465-28874584)
chr3 (85-179)||(48811382-48811476)
chr3 (63-179)||(45529133-45529249)
chr3 (57-179)||(40425085-40425207)
chr3 (58-159)||(38723212-38723312)
chr3 (107-174)||(28281052-28281120)
chr3 (54-97)||(52308983-52309026)
chr3 (57-174)||(54290796-54290913)
chr3 (83-179)||(25753481-25753577)
chr3 (82-174)||(53040464-53040556)
chr3 (64-175)||(2831524-2831635)
chr3 (57-92)||(31625434-31625469)
chr3 (57-95)||(34758899-34758937)
chr3 (61-94)||(4305117-4305150)
chr3 (111-179)||(40546351-40546420)
chr3 (57-178)||(52638173-52638293)
chr3 (87-159)||(38156538-38156609)
[»] chr2 (26 HSPs)
chr2 (57-174)||(20128300-20128417)
chr2 (57-179)||(24762728-24762850)
chr2 (57-159)||(24765305-24765407)
chr2 (57-173)||(20064881-20064997)
chr2 (99-183)||(35022619-35022703)
chr2 (57-159)||(2825990-2826092)
chr2 (57-179)||(35443506-35443628)
chr2 (56-178)||(11944888-11945010)
chr2 (52-174)||(32859750-32859872)
chr2 (99-179)||(815008-815088)
chr2 (57-179)||(13538365-13538488)
chr2 (99-158)||(24792001-24792060)
chr2 (57-134)||(3882586-3882663)
chr2 (57-158)||(8773708-8773809)
chr2 (57-102)||(15816795-15816840)
chr2 (57-134)||(20683056-20683133)
chr2 (59-132)||(34546329-34546402)
chr2 (99-152)||(37978506-37978559)
chr2 (82-177)||(15690187-15690282)
chr2 (82-178)||(39445446-39445542)
chr2 (82-156)||(39309751-39309825)
chr2 (57-95)||(43745594-43745632)
chr2 (82-179)||(2713441-2713538)
chr2 (81-178)||(8964386-8964483)
chr2 (98-159)||(28453251-28453312)
chr2 (111-179)||(2047805-2047873)
[»] chr4 (28 HSPs)
chr4 (57-174)||(31072489-31072606)
chr4 (60-174)||(54552765-54552879)
chr4 (57-179)||(13800710-13800830)
chr4 (82-178)||(12618709-12618805)
chr4 (57-168)||(24981762-24981873)
chr4 (57-179)||(8297841-8297964)
chr4 (57-132)||(30978709-30978784)
chr4 (99-178)||(48315936-48316015)
chr4 (82-178)||(16555962-16556058)
chr4 (57-179)||(39195740-39195862)
chr4 (111-177)||(14949003-14949069)
chr4 (58-179)||(41462020-41462142)
chr4 (52-174)||(51834879-51835001)
chr4 (81-155)||(53391272-53391346)
chr4 (57-106)||(45900236-45900285)
chr4 (58-179)||(47461056-47461177)
chr4 (57-102)||(49795115-49795160)
chr4 (83-174)||(5799005-5799096)
chr4 (53-92)||(32323815-32323854)
chr4 (57-172)||(37138183-37138297)
chr4 (55-134)||(40480229-40480308)
chr4 (57-179)||(2063446-2063567)
chr4 (56-130)||(27346267-27346341)
chr4 (57-130)||(28695736-28695809)
chr4 (57-95)||(44646623-44646661)
chr4 (57-174)||(49400583-49400699)
chr4 (87-179)||(41415765-41415857)
chr4 (54-134)||(53737853-53737933)
[»] chr7 (25 HSPs)
chr7 (59-179)||(46726109-46726228)
chr7 (81-174)||(2959593-2959686)
chr7 (87-173)||(47639184-47639270)
chr7 (98-179)||(18219097-18219180)
chr7 (97-178)||(42258902-42258985)
chr7 (60-179)||(2347390-2347509)
chr7 (57-179)||(27123244-27123367)
chr7 (57-175)||(28663157-28663273)
chr7 (82-178)||(36189474-36189571)
chr7 (62-94)||(42911162-42911194)
chr7 (57-169)||(47507580-47507692)
chr7 (57-172)||(10031942-10032057)
chr7 (57-92)||(17157871-17157906)
chr7 (57-179)||(28770447-28770570)
chr7 (57-132)||(34681663-34681737)
chr7 (57-179)||(35496586-35496709)
chr7 (99-174)||(44543734-44543809)
chr7 (61-92)||(47754478-47754509)
chr7 (57-103)||(27766776-27766822)
chr7 (80-178)||(36939464-36939562)
chr7 (113-179)||(41431104-41431170)
chr7 (57-106)||(14651471-14651520)
chr7 (57-130)||(34299806-34299879)
chr7 (57-138)||(44537311-44537392)
chr7 (57-101)||(45375439-45375483)
[»] chr5 (23 HSPs)
chr5 (57-184)||(41583513-41583640)
chr5 (65-178)||(2827579-2827692)
chr5 (57-124)||(25437944-25438011)
chr5 (57-135)||(30501198-30501276)
chr5 (57-135)||(30541541-30541619)
chr5 (57-134)||(34032149-34032226)
chr5 (60-179)||(30104777-30104897)
chr5 (82-178)||(36160314-36160410)
chr5 (120-179)||(7581192-7581251)
chr5 (52-178)||(7719169-7719296)
chr5 (55-134)||(10051698-10051777)
chr5 (57-92)||(23023603-23023638)
chr5 (57-92)||(31672381-31672416)
chr5 (98-156)||(2689287-2689344)
chr5 (60-174)||(2918616-2918730)
chr5 (57-91)||(10410420-10410454)
chr5 (77-135)||(22871910-22871968)
chr5 (61-159)||(26663609-26663707)
chr5 (61-159)||(26935204-26935302)
chr5 (119-177)||(27536716-27536774)
chr5 (81-159)||(30370891-30370968)
chr5 (54-91)||(779053-779090)
chr5 (85-141)||(40458834-40458889)
[»] chr1 (25 HSPs)
chr1 (55-142)||(32572764-32572851)
chr1 (61-174)||(27542834-27542948)
chr1 (54-179)||(26756200-26756325)
chr1 (60-179)||(48947177-48947296)
chr1 (57-159)||(45584509-45584611)
chr1 (57-130)||(34861275-34861348)
chr1 (87-174)||(27004042-27004129)
chr1 (57-180)||(43024926-43025049)
chr1 (88-142)||(16790296-16790350)
chr1 (57-135)||(39150552-39150630)
chr1 (58-123)||(35259116-35259181)
chr1 (57-130)||(39912273-39912346)
chr1 (57-134)||(40377012-40377089)
chr1 (54-177)||(37705844-37705967)
chr1 (57-130)||(16113889-16113962)
chr1 (57-134)||(34445639-34445716)
chr1 (63-174)||(5250920-5251031)
chr1 (57-92)||(40570659-40570694)
chr1 (80-179)||(43397028-43397130)
chr1 (57-103)||(3047837-3047883)
chr1 (83-141)||(9534368-9534426)
chr1 (57-166)||(39156231-39156340)
chr1 (52-92)||(4851345-4851385)
chr1 (58-106)||(14746287-14746334)
chr1 (119-179)||(46533778-46533838)
[»] chr8 (25 HSPs)
chr8 (52-173)||(37564352-37564473)
chr8 (57-179)||(31264967-31265089)
chr8 (60-147)||(8674432-8674519)
chr8 (82-177)||(15353786-15353881)
chr8 (60-179)||(24733145-24733264)
chr8 (64-173)||(27734360-27734469)
chr8 (57-141)||(7574231-7574315)
chr8 (83-178)||(44253803-44253897)
chr8 (57-179)||(16459213-16459335)
chr8 (53-179)||(25279895-25280020)
chr8 (58-103)||(1876572-1876617)
chr8 (57-134)||(20279614-20279691)
chr8 (57-134)||(21066241-21066318)
chr8 (98-159)||(29217559-29217620)
chr8 (52-179)||(42636379-42636507)
chr8 (82-177)||(35209948-35210043)
chr8 (57-92)||(37426389-37426424)
chr8 (78-172)||(37813423-37813518)
chr8 (57-95)||(7262120-7262158)
chr8 (57-91)||(24869384-24869418)
chr8 (119-179)||(7931747-7931807)
chr8 (61-93)||(11995213-11995245)
chr8 (55-103)||(12002235-12002283)
chr8 (99-131)||(32959880-32959912)
chr8 (61-93)||(41385368-41385400)
[»] chr6 (5 HSPs)
chr6 (85-179)||(15588653-15588747)
chr6 (57-173)||(35229262-35229378)
chr6 (82-179)||(6555052-6555149)
chr6 (57-103)||(6586507-6586552)
chr6 (57-135)||(3766250-3766325)
[»] scaffold0003 (1 HSPs)
scaffold0003 (81-154)||(354014-354086)
[»] scaffold0246 (1 HSPs)
scaffold0246 (55-134)||(18168-18247)
[»] scaffold0182 (1 HSPs)
scaffold0182 (57-95)||(19660-19698)


Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 18)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 8 - 184
Target Start/End: Complemental strand, 4305327 - 4305151
Alignment:
8 attcatacaaatatgtctaattaaataatggcatactaatatacatagagtcttgttaacgagtgcccctggggcactctttaaggatactaaatttaga 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4305327 attcatacaaatatgtctaattaaataatggcatactaatatacatagagtcttgttaacgagtgcccctggggcactctttaaggatactaaatttaga 4305228  T
108 atatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaacttacaattg 184  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4305227 atatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaacttacaattg 4305151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 60 - 179
Target Start/End: Original strand, 28874465 - 28874584
Alignment:
60 ttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacac 159  Q
    |||||||||| | |||| |  |||||| ||||||||||||||||||||| | ||| ||||||||||| |||| ||| |||||| |||| |||||||||||    
28874465 ttgttaacgactacccccgaagcactcgttaaggatactaaatttagaaaacattctttaaaaaagtaaaatgttacaaattccaatgcattgattacac 28874564  T
160 gatttttcataaaaacttac 179  Q
      ||||||||||||| ||||    
28874565 agtttttcataaaaatttac 28874584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 85 - 179
Target Start/End: Complemental strand, 48811476 - 48811382
Alignment:
85 tctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaacttac 179  Q
    ||||||||||| |||||||||||| |||||  ||||||||||| ||| ||| |||||  |||| ||||||||||| |||||||||||||||||||    
48811476 tctttaaggatcctaaatttagaaaatattcattaaaaaagtctaatgttacaaatttcaatgcattgattacacaatttttcataaaaacttac 48811382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 63 - 179
Target Start/End: Complemental strand, 45529249 - 45529133
Alignment:
63 ttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgat 162  Q
    |||||||||||||  ||||||||||||||| || | |||||||||| ||||| || ||||||||||||  ||| || ||  | || ||||||||||  |     
45529249 ttaacgagtgccctcggggcactctttaagcatcccaaatttagaaaatattcttcaaaaaagtcaaacgttacaagtttcagtgcattgattacataaa 45529150  T
163 ttttcataaaaacttac 179  Q
    |||||||||||||||||    
45529149 ttttcataaaaacttac 45529133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 57 - 179
Target Start/End: Original strand, 40425085 - 40425207
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    ||||||||||| |||||    |||||||||||||| ||| | |||||||||| |||||| ||||||| || |||| ||| |||||| |||  ||||||||    
40425085 gtcttgttaacaagtgctttcggggcactctttaaagatcccaaatttagaaaatatttcttaaaaatgttaaatgttacaaattccaatacattgatta 40425184  T
157 cacgatttttcataaaaacttac 179  Q
    ||   ||||| ||||||||||||    
40425185 caaatttttttataaaaacttac 40425207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 58 - 159
Target Start/End: Original strand, 38723212 - 38723312
Alignment:
58 tcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattac 157  Q
    ||||||||||||||||||| | | |||||||||||||| | ||||||| || ||||| ||||||||| | |||| |||||||||| |||  | |||||||    
38723212 tcttgttaacgagtgccccagag-cactctttaaggatcccaaatttaaaaaatattctttaaaaaaattaaatgttataaattccaatacactgattac 38723310  T
158 ac 159  Q
    ||    
38723311 ac 38723312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 107 - 174
Target Start/End: Complemental strand, 28281120 - 28281052
Alignment:
107 aatatattttttaaaaaagtcaaatattataaattctaatgtattgattacac-gatttttcataaaaa 174  Q
    |||||||| ||||||||||||||||||| ||| || ||||||||| |||||||  ||||||||||||||    
28281120 aatatattatttaaaaaagtcaaatattttaatttttaatgtattaattacacatatttttcataaaaa 28281052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 54 - 97
Target Start/End: Original strand, 52308983 - 52309026
Alignment:
54 agagtcttgttaacgagtgcccctggggcactctttaaggatac 97  Q
    ||||||||||||||||||||||| ||||||||||||||| ||||    
52308983 agagtcttgttaacgagtgcccccggggcactctttaagcatac 52309026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 174
Target Start/End: Complemental strand, 54290913 - 54290796
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||||||||||||||  ||| ||||||||||||||| ||  ||||||  |||  |||| ||||||||||||||| | |  || ||| |||||||| | ||    
54290913 gtcttgttaacgagtatccccggggcactctttaagcatgataaattaggaagttattctttaaaaaagtcaaacagttcaatttccaatgtattaaata 54290814  T
157 cacgatttttcataaaaa 174  Q
    ||| | ||||||||||||    
54290813 cacaagttttcataaaaa 54290796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 83 - 179
Target Start/End: Original strand, 25753481 - 25753577
Alignment:
83 actctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaacttac 179  Q
    |||||||||| |||  |||||||||| ||||| || || |||||||||| |||||| ||  |||| ||| ||||||  | |||||||||||||||||    
25753481 actctttaagcatatcaaatttagaaaatattcttcaataaagtcaaatgttataagtttcaatgcattaattacataaattttcataaaaacttac 25753577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 82 - 174
Target Start/End: Original strand, 53040464 - 53040556
Alignment:
82 cactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaa 174  Q
    |||||||||||||| ||||||| ||||  |||| ||||||||| ||||||| |  || ||| |||||||||| ||||| |  |||||||||||    
53040464 cactctttaaggattctaaattaagaaattattatttaaaaaattcaaatacttcaatttccaatgtattgaatacacaaactttcataaaaa 53040556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 64 - 175
Target Start/End: Original strand, 2831524 - 2831635
Alignment:
64 taacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatt 163  Q
    |||||||||||| || | |||||||||||||| | ||||  ||||  |||||||||| |||||||||||||  || ||  |||| | |||||| || | |    
2831524 taacgagtgcccatgagacactctttaaggattccaaatcaagaaattattttttaataaagtcaaatatttcaattttaaatgcaatgattatacaagt 2831623  T
164 tttcataaaaac 175  Q
    ||||||||||||    
2831624 tttcataaaaac 2831635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 57 - 92
Target Start/End: Complemental strand, 31625469 - 31625434
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaag 92  Q
    |||||||||||||||||||||||| |||||||||||    
31625469 gtcttgttaacgagtgcccctgggacactctttaag 31625434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 95
Target Start/End: Original strand, 34758899 - 34758937
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggat 95  Q
    |||||||||||||||||| | ||||||||||||||||||    
34758899 gtcttgttaacgagtgcctccggggcactctttaaggat 34758937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 61 - 94
Target Start/End: Original strand, 4305117 - 4305150
Alignment:
61 tgttaacgagtgcccctggggcactctttaagga 94  Q
    |||||||||||||||| |||||||||||||||||    
4305117 tgttaacgagtgcccccggggcactctttaagga 4305150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 111 - 179
Target Start/End: Original strand, 40546351 - 40546420
Alignment:
111 tattttttaaaaaagtcaaatattataaattctaatgtattgattacacg-atttttcataaaaacttac 179  Q
    ||||||||||||||||||||||||   | ||| |||| |||||||||| | |||||||||||| ||||||    
40546351 tattttttaaaaaagtcaaatatttcgatttccaatgcattgattacatgcatttttcataaatacttac 40546420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 57 - 178
Target Start/End: Complemental strand, 52638293 - 52638173
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    ||||||||||| ||||| || ||| ||||||||||| || | |||||||| |  |||| ||| |||||| ||| ||||| || ||| |||| | ||| ||    
52638293 gtcttgttaacaagtgcacc-gggacactctttaagaatccaaaatttagtaattattattttaaaaagccaactattacaatttccaatgcagtgaata 52638195  T
157 cacgatttttcataaaaactta 178  Q
    ||| |||||| |||||||||||    
52638194 cacaattttttataaaaactta 52638173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 87 - 159
Target Start/End: Complemental strand, 38156609 - 38156538
Alignment:
87 tttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacac 159  Q
    |||||||||  |||||||||||  ||||||||||||| ||||||| ||| |||||  |||| |||||||||||    
38156609 tttaaggatcttaaatttagaaagtattttttaaaaa-gtcaaatgttacaaatttcaatgcattgattacac 38156538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 62; Significance: 5e-27; HSPs: 26)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 57 - 174
Target Start/End: Original strand, 20128300 - 20128417
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    ||||||| |||||||||||| ||| |||||||||||||| ||||||||| ||| |||| |||||||||||||||| ||| |||||| |||| ||||||||    
20128300 gtcttgtaaacgagtgcccccgggacactctttaaggatcctaaatttataatttattctttaaaaaagtcaaatgttacaaattccaatgcattgatta 20128399  T
157 cacgatttttcataaaaa 174  Q
    ||||  |||| |||||||    
20128400 cacgtatttttataaaaa 20128417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 57 - 179
Target Start/End: Complemental strand, 24762850 - 24762728
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    ||||||||||||||||||    || |||||||||||||| | |||||||||| |||||  ||||||||||||||||||| |||||| ||| |||||||||    
24762850 gtcttgttaacgagtgccttcaggtcactctttaaggatcccaaatttagaaaatattccttaaaaaagtcaaatattacaaattccaatatattgatta 24762751  T
157 cacgatttttcataaaaacttac 179  Q
     ||   |||| ||||||||||||    
24762750 tacatatttttataaaaacttac 24762728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 57 - 159
Target Start/End: Original strand, 24765305 - 24765407
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||||||||||||||||| ||   ||||||||||||||| | |||||||||| |||||  |||||||| |||||||||| |||||| |||| ||||||||    
24765305 gtcttgttaacgagtgcctctaaagcactctttaaggatcccaaatttagaaaatattccttaaaaaaatcaaatattacaaattccaatgcattgatta 24765404  T
157 cac 159  Q
    |||    
24765405 cac 24765407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 57 - 173
Target Start/End: Original strand, 20064881 - 20064997
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||||||||||||||||| || ||||||||||||||||| |||||| ||| |  |||| ||| |||||||||| ||||| || ||  |||||||| | ||    
20064881 gtcttgttaacgagtgcctctagggcactctttaaggatcctaaatatagtaattattcttttaaaaagtcaactattacaattttcaatgtattaaata 20064980  T
157 cacgatttttcataaaa 173  Q
    ||| |||||||||||||    
20064981 cacaatttttcataaaa 20064997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 99 - 183
Target Start/End: Original strand, 35022619 - 35022703
Alignment:
99 aaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaacttacaatt 183  Q
    ||||||| || |||||| ||||||||||||||||||||||||| ||||| |||||||||||   |||| ||||||||||||||||    
35022619 aaatttaaaaaatatttcttaaaaaagtcaaatattataaattttaatgcattgattacacatattttaataaaaacttacaatt 35022703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 57 - 159
Target Start/End: Complemental strand, 2826092 - 2825990
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||||||||||||||| ||||| || |||||||||| |||||||| | ||||  |||||||||||||||| |||||||   | ||| |||| ||||||||    
2826092 gtcttgttaacgagtgtccctgtggtactctttaagcatactaaaataagaaattattttttaaaaaagtaaaatatttcgatttccaatgcattgatta 2825993  T
157 cac 159  Q
    |||    
2825992 cac 2825990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 57 - 179
Target Start/End: Complemental strand, 35443628 - 35443506
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    ||||||||||| |||| |||||| | | |||||||||||   ||||||| || |||||| | ||||||||||||| ||||||||| ||||| | ||||||    
35443628 gtcttgttaacaagtgtccctggagtattctttaaggatttcaaatttaaaaaatatttctcaaaaaagtcaaatgttataaattttaatgcactgatta 35443529  T
157 cacgatttttcataaaaacttac 179  Q
    ||| | ||||  |||||||||||    
35443528 cacaaatttttgtaaaaacttac 35443506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 56 - 178
Target Start/End: Complemental strand, 11945010 - 11944888
Alignment:
56 agtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatt 155  Q
    |||||||||||||||||  || | | |||||||||||||| |||| ||||| |  ||||||| ||||| ||||| ||||| || ||  |||| ||||| |    
11945010 agtcttgttaacgagtgttccagagacactctttaaggatcctaattttagtaattatttttaaaaaatgtcaactattacaattttcaatgcattgaat 11944911  T
156 acacgatttttcataaaaactta 178  Q
    |||| | ||||||||||||||||    
11944910 acacaacttttcataaaaactta 11944888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 52 - 174
Target Start/End: Original strand, 32859750 - 32859872
Alignment:
52 atagagtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtatt 151  Q
    |||| ||||||||||||||||||||  |||||||||||||  || |||||||  |||  |||| ||||||||||||||| | |  || ||| ||||||||    
32859750 atagggtcttgttaacgagtgcccccagggcactctttaaacatgctaaattaggaagttattctttaaaaaagtcaaacagttcaatttccaatgtatt 32859849  T
152 gattacacgatttttcataaaaa 174  Q
     | ||||| | ||||||||||||    
32859850 aaatacacaagttttcataaaaa 32859872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 99 - 179
Target Start/End: Original strand, 815008 - 815088
Alignment:
99 aaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaacttac 179  Q
    ||||||||||  |||||||||||||| |||||| | | |||||| |||| |||||||||||   |||||||||||||||||    
815008 aaatttagaaattattttttaaaaaaatcaaatgtcacaaattccaatgcattgattacaccgattttcataaaaacttac 815088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 57 - 179
Target Start/End: Original strand, 13538365 - 13538488
Alignment:
57 gtcttgttaacgagtgcccctg-gggcactctttaaggatactaaatttagaata-tattttttaaaaaagtcaaatattataaattctaatgtattgat 154  Q
    |||||||||||||||||||| | |||||||||||||| |||||||| |||||| | |||| ||||||||| ||||||| |  || ||| |||| |||||     
13538365 gtcttgttaacgagtgcccccgagggcactctttaagcatactaaa-ttagaaaattattctttaaaaaattcaaataattcaatttccaatgcattgaa 13538463  T
155 tacacgatttttcataaaaacttac 179  Q
    ||||  | |||||||||||| ||||    
13538464 tacataacttttcataaaaagttac 13538488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 99 - 158
Target Start/End: Original strand, 24792001 - 24792060
Alignment:
99 aaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattaca 158  Q
    |||||||||| ||||| |||||||||||||||| ||| |||||| |||| ||||||||||    
24792001 aaatttagaaaatattctttaaaaaagtcaaatgttacaaattccaatgcattgattaca 24792060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 134
Target Start/End: Original strand, 3882586 - 3882663
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatatt 134  Q
    |||||||||||||||||||  ||||||||||||||| || ||||| | || |  |||| |||||||| ||||||||||    
3882586 gtcttgttaacgagtgccctcggggcactctttaagcattctaaaataagcaattattctttaaaaaggtcaaatatt 3882663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 158
Target Start/End: Complemental strand, 8773809 - 8773708
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    ||||||||||||||| | |  |||||||||||||| ||| |||||   ||||  |||||| ||||||||||||||||| | | |||| ||| ||||||||    
8773809 gtcttgttaacgagtactctcggggcactctttaaagattctaaaagaagaaattattttataaaaaagtcaaatattttgatttctgatgcattgatta 8773710  T
157 ca 158  Q
    ||    
8773709 ca 8773708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 102
Target Start/End: Complemental strand, 15816840 - 15816795
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaat 102  Q
    ||||||||||||||||||||  |||||||||||||| |||||||||    
15816840 gtcttgttaacgagtgcccccagggcactctttaagcatactaaat 15816795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 134
Target Start/End: Complemental strand, 20683133 - 20683056
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatatt 134  Q
    |||||||||||||||||||| ||| |||||||||||||| | |||   |||| | ||||| ||||||| |||||||||    
20683133 gtcttgttaacgagtgcccccgggacactctttaaggattccaaaagaagaaaagattttataaaaaaatcaaatatt 20683056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 59 - 132
Target Start/End: Complemental strand, 34546402 - 34546329
Alignment:
59 cttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaata 132  Q
    ||||||||||||||||||||| ||||||||| ||||| | ||||  ||||  || ||| |||||||||||||||    
34546402 cttgttaacgagtgcccctggagcactctttgaggattccaaatgaagaaattaatttataaaaaagtcaaata 34546329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 99 - 152
Target Start/End: Original strand, 37978506 - 37978559
Alignment:
99 aaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattg 152  Q
    |||||||||| ||||| |||||||||||||||||||| ||||| ||||| ||||    
37978506 aaatttagaaaatattctttaaaaaagtcaaatattacaaattttaatgcattg 37978559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 82 - 177
Target Start/End: Complemental strand, 15690282 - 15690187
Alignment:
82 cactctttaaggatact-aaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaactt 177  Q
    ||||||||||||| ||| ||||| |||| |||||| | |||||| |||||||||| ||||| ||||| |||||||||||   |||| ||||||||||    
15690282 cactctttaagga-actcaaattaagaaaatatttctcaaaaaaatcaaatattacaaattttaatgcattgattacacatatttttataaaaactt 15690187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 82 - 178
Target Start/End: Complemental strand, 39445542 - 39445446
Alignment:
82 cactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaactta 178  Q
    |||||||||| |||  |||||||| || ||||||||||||||||| |||| ||| |||||  |||| | |||||||||  |||||| || |||||||    
39445542 cactctttaaagattttaaatttaaaaaatattttttaaaaaagttaaatgttagaaatttcaatgcactgattacacagtttttcttacaaactta 39445446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 82 - 156
Target Start/End: Original strand, 39309751 - 39309825
Alignment:
82 cactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||| ||||||||| |||| ||||||| ||||| |||||| ||||||||||||  |||||  |||| ||||||||    
39309751 cactttttaaggattctaagtttagaaaatattctttaaataagtcaaatatttcaaatttcaatgaattgatta 39309825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 95
Target Start/End: Original strand, 43745594 - 43745632
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggat 95  Q
    ||||||||||||||||||| | |||||||||||||||||    
43745594 gtcttgttaacgagtgcccttagggcactctttaaggat 43745632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 82 - 179
Target Start/End: Complemental strand, 2713538 - 2713441
Alignment:
82 cactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaacttac 179  Q
    |||||||||| |||  ||||||| ||| ||||| || ||||||||||||| ||| |||||| |||| | |||||| ||   ||||||| |||||||||    
2713538 cactctttaaagatcataaatttggaaaatattcttcaaaaaagtcaaatgttacaaattccaatgcaatgattatacagattttcatcaaaacttac 2713441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 81 - 178
Target Start/End: Original strand, 8964386 - 8964483
Alignment:
81 gcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaactta 178  Q
    ||||| |||||| || ||||||| || |  |||| ||||||||||| |||||||  || ||| |||| ||||||||||| | |||||||||| |||||    
8964386 gcactgtttaagcattctaaattaagtaattattctttaaaaaagtaaaatatttcaatttccaatgcattgattacacaaattttcataaatactta 8964483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 98 - 159
Target Start/End: Original strand, 28453251 - 28453312
Alignment:
98 taaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacac 159  Q
    |||||||| || ||||||||||||||| |||||||||| |||||| ||   |||||||||||    
28453251 taaatttataaaatattttttaaaaaattcaaatattacaaattccaacacattgattacac 28453312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 111 - 179
Target Start/End: Original strand, 2047805 - 2047873
Alignment:
111 tattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaacttac 179  Q
    |||||||| ||||| | ||||||| ||| || ||||||||||||| ||| | || ||||||||||||||    
2047805 tattttttgaaaaaattaaatattttaatttttaatgtattgattgcacaaattatcataaaaacttac 2047873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 58; Significance: 1e-24; HSPs: 28)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 57 - 174
Target Start/End: Complemental strand, 31072606 - 31072489
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||||||||||||||||||| ||| ||||||||||||||  ||||||||||| ||||| ||| |||||||||||| ||| ||||||  ||| ||||||||    
31072606 gtcttgttaacgagtgcccccgggccactctttaaggatcataaatttagaaaatattctttgaaaaagtcaaatgttacaaattcctatgcattgatta 31072507  T
157 cacgatttttcataaaaa 174  Q
    |||  ||||| |||||||    
31072506 cacagttttttataaaaa 31072489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 60 - 174
Target Start/End: Complemental strand, 54552879 - 54552765
Alignment:
60 ttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacac 159  Q
    ||||||||||||||| | ||||||||||||||| || |||||||||||| ||||| |||||||| ||||||| ||| ||||||| ||  |||||||||||    
54552879 ttgttaacgagtgcctccggggcactctttaagaatcctaaatttagaaaatattctttaaaaaggtcaaatgttacaaattcttatacattgattacac 54552780  T
160 gatttttcataaaaa 174  Q
      |||||| ||||||    
54552779 agtttttcgtaaaaa 54552765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 57 - 179
Target Start/End: Complemental strand, 13800830 - 13800710
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    ||||||||||||||||||||     |||||||||||||| |||||||||||| ||||| |||||||||||||||||||| ||||||  ||  ||||||||    
13800830 gtcttgttaacgagtgcccccaa--cactctttaaggatcctaaatttagaaaatattctttaaaaaagtcaaatattacaaattcctatacattgatta 13800733  T
157 cacgatttttcataaaaacttac 179  Q
    |||  ||||||||| ||| ||||    
13800732 cacagtttttcatagaaagttac 13800710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 45; E-Value: 7e-17
Query Start/End: Original strand, 82 - 178
Target Start/End: Complemental strand, 12618805 - 12618709
Alignment:
82 cactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaactta 178  Q
    ||||||||||| || | ||||||||||  |||||||| |||||||||||| |||||||||  |||| |||||||| || | ||||||||||||||||    
12618805 cactctttaagcattccaaatttagaaattatttttttaaaaagtcaaatgttataaatttcaatgcattgattatacaaattttcataaaaactta 12618709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 57 - 168
Target Start/End: Original strand, 24981762 - 24981873
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||||||||||||||| ||||| | |||| ||||| |||   |||||||||| ||||| ||||||||||| |||  ||| |||||| |||| ||||||||    
24981762 gtcttgttaacgagtgtccctgagacactttttaaagatttcaaatttagaaaatattctttaaaaaagttaaacgttacaaattcaaatgcattgatta 24981861  T
157 cacgatttttca 168  Q
    ||| ||||||||    
24981862 cacaatttttca 24981873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 57 - 179
Target Start/End: Original strand, 8297841 - 8297964
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||||||||||||||||||| ||||||||||||||| || | |||||||| |  |||| ||| |||| ||||| | ||| || ||| |||| ||| | ||    
8297841 gtcttgttaacgagtgcccccggggcactctttaagcatcccaaatttagtaattattcttttaaaatgtcaactgttacaatttccaatgcattcaata 8297940  T
157 cacgatttttca-taaaaacttac 179  Q
    ||| |||||||| |||||||||||    
8297941 cacaatttttcattaaaaacttac 8297964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 57 - 132
Target Start/End: Complemental strand, 30978784 - 30978709
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaata 132  Q
    |||||||||| ||||||||||||||||||||||||| || | ||||| ||||   |||| ||||||||||||||||    
30978784 gtcttgttaaggagtgcccctggggcactctttaagcattccaaattaagaaatgatttattaaaaaagtcaaata 30978709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 48315936 - 48316015
Alignment:
99 aaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaactta 178  Q
    |||||| ||| ||||| |||||||||||||||| ||| |||||  |||| ||||||||||| | ||||||||||||||||    
48315936 aaattttgaaaatattctttaaaaaagtcaaatgttacaaatttcaatgcattgattacacaacttttcataaaaactta 48316015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 82 - 178
Target Start/End: Original strand, 16555962 - 16556058
Alignment:
82 cactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaactta 178  Q
    ||||||||||  || |||||||||||| |||||| ||| || | |||||||||| |||||  |||| ||||||||||| | |||| |||||||||||    
16555962 cactctttaaaaattctaaatttagaaaatatttcttacaacattcaaatattacaaatttcaatgcattgattacacaaatttttataaaaactta 16556058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 179
Target Start/End: Complemental strand, 39195862 - 39195740
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||||||||||||||||||    ||||||||||||||||  ||||||||| || | ||||||||||| ||||| ||||| || ||  |||| ||||| ||    
39195862 gtcttgttaacgagtgccctcaaggcactctttaaggatcttaaatttagtat-ttttttttaaaaaggtcaactattacaattttcaatgcattgaata 39195764  T
157 cacgatttttcata-aaaacttac 179  Q
    ||| | |||||||| |||||||||    
39195763 cacaacttttcatataaaacttac 39195740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 14949069 - 14949003
Alignment:
111 tattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaactt 177  Q
    |||| |||||||||||||||| ||| |||||  |||| ||||||||||| | |||||||||||||||    
14949069 tattctttaaaaaagtcaaatgttacaaatttcaatgcattgattacacaaattttcataaaaactt 14949003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 58 - 179
Target Start/End: Original strand, 41462020 - 41462142
Alignment:
58 tcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattac 157  Q
    ||||||||||||||| |||||| |||||||||||| ||  || |||||| |  |||| ||| |||||||||| ||||| || |||| ||| ||| | |||    
41462020 tcttgttaacgagtgtccctggagcactctttaagcattttatatttagtaattattcttttaaaaagtcaactattacaatttcttatgcatttaatac 41462119  T
158 acgatttttca-taaaaacttac 179  Q
    |  |||||||| |||||||||||    
41462120 ataatttttcattaaaaacttac 41462142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 52 - 174
Target Start/End: Original strand, 51834879 - 51835001
Alignment:
52 atagagtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtatt 151  Q
    |||| |||||||||| ||||  ||| ||| ||||||||||| || |||||||||| |  |||| ||| |||||||||| |||||||| ||| |||| |||    
51834879 atagggtcttgttaatgagtttccccgggacactctttaagcatcctaaatttagcaattattcttttaaaaagtcaactattataatttccaatgcatt 51834978  T
152 gattacacgatttttcataaaaa 174  Q
     | ||||| | ||||||| ||||    
51834979 aaatacacaacttttcattaaaa 51835001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 81 - 155
Target Start/End: Complemental strand, 53391346 - 53391272
Alignment:
81 gcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatt 155  Q
    |||||||||||| ||||||||||||||| ||||| || ||| ||||||||| ||| |||||  |||| |||||||    
53391346 gcactctttaagaatactaaatttagaaaatattcttaaaagaagtcaaatgttacaaatttcaatgcattgatt 53391272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 106
Target Start/End: Complemental strand, 45900285 - 45900236
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttag 106  Q
    |||||||||||||||||||| | ||||||||||||| || ||||||||||    
45900285 gtcttgttaacgagtgcccccgaggcactctttaagcatcctaaatttag 45900236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 58 - 179
Target Start/End: Complemental strand, 47461177 - 47461056
Alignment:
58 tcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattac 157  Q
    ||||||||||||||| |  |||  |||| |||||||||   ||||||| || ||||| || |||||| | ||||||||||||||  |||||||||||||     
47461177 tcttgttaacgagtgtcattggaacactttttaaggatctcaaatttaaaaaatattattaaaaaaaattaaatattataaatttcaatgtattgattat 47461078  T
158 acgatttttcataaaaacttac 179  Q
    |    |||||||||||||||||    
47461077 atatattttcataaaaacttac 47461056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 102
Target Start/End: Original strand, 49795115 - 49795160
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaat 102  Q
    |||||||||||||||||||  ||||||||||||||| |||||||||    
49795115 gtcttgttaacgagtgccctgggggcactctttaagcatactaaat 49795160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 83 - 174
Target Start/End: Complemental strand, 5799096 - 5799005
Alignment:
83 actctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaa 174  Q
    |||| ||||||||  ||||||||||| ||||| ||| |||||||||||||||| |||||  ||||  ||||||| || | |||| |||||||    
5799096 actccttaaggatcttaaatttagaaaatattcttttaaaaagtcaaatattacaaatttaaatgcgttgattatacaaatttttataaaaa 5799005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 53 - 92
Target Start/End: Complemental strand, 32323854 - 32323815
Alignment:
53 tagagtcttgttaacgagtgcccctggggcactctttaag 92  Q
    ||||||||||||||||| | ||||||||||||||||||||    
32323854 tagagtcttgttaacgaattcccctggggcactctttaag 32323815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 57 - 172
Target Start/End: Complemental strand, 37138297 - 37138183
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    ||||||||||||||||  | |||||||||||||||||| |  |||||||| |  |||| ||| |||||||||| |||||||| ||| |||| | | | ||    
37138297 gtcttgttaacgagtgttc-tggggcactctttaaggaaatcaaatttagcaactattcttttaaaaagtcaactattataatttccaatgcactcaata 37138199  T
157 cacgatttttcataaa 172  Q
    ||| | ||||||||||    
37138198 cacaacttttcataaa 37138183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 55 - 134
Target Start/End: Complemental strand, 40480308 - 40480229
Alignment:
55 gagtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatatt 134  Q
    ||||||||| |||||||||| ||||| |||||||||||||| |||||   ||||  ||| |  |||||||||||||||||    
40480308 gagtcttgtaaacgagtgcctctgggacactctttaaggatgctaaaagaagaaattatgtcataaaaaagtcaaatatt 40480229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 179
Target Start/End: Original strand, 2063446 - 2063567
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    ||||||||||||||||| || ||  ||||||||||| || |||||||  |||  |||| ||||||||||||||| | |  || ||| |||||||| | ||    
2063446 gtcttgttaacgagtgctcccgga-cactctttaagcatgctaaattaggaagttattctttaaaaaagtcaaacagttcaatttccaatgtattaaata 2063544  T
157 cacgatttttcataaaaacttac 179  Q
    ||| | |||||||||||| ||||    
2063545 cacaaattttcataaaaagttac 2063567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 130
Target Start/End: Original strand, 27346267 - 27346341
Alignment:
56 agtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaa 130  Q
    |||||| ||||||||||| |   ||||||||||||||||| |||||   ||||| |||||| |||||||||||||    
27346267 agtctttttaacgagtgctctgcgggcactctttaaggattctaaaaaaagaatttattttataaaaaagtcaaa 27346341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 130
Target Start/End: Original strand, 28695736 - 28695809
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggat-actaaatttagaatatattttttaaaaaagtcaaa 130  Q
    |||||||||||||||||||   ||||||||||||||||| ||||| |  ||||  ||||||||||||||||||||    
28695736 gtcttgttaacgagtgccctaagggcactctttaaggattactaa-taaagaaattattttttaaaaaagtcaaa 28695809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 95
Target Start/End: Complemental strand, 44646661 - 44646623
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggat 95  Q
    |||||||||||||||||||| |||||| |||||||||||    
44646661 gtcttgttaacgagtgcccccggggcattctttaaggat 44646623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 57 - 174
Target Start/End: Original strand, 49400583 - 49400699
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    ||||||||||||||||| ||  | ||||| |||||| || |||||||||| |  |||| ||| ||||| |||| ||||| || ||| |||||||| | ||    
49400583 gtcttgttaacgagtgctcc-agagcactatttaagcatcctaaatttagtaattattcttttaaaaaatcaactattacaatttccaatgtatttaata 49400681  T
157 cacgatttttcataaaaa 174  Q
    ||||| ||||||| ||||    
49400682 cacgacttttcattaaaa 49400699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 87 - 179
Target Start/End: Complemental strand, 41415857 - 41415765
Alignment:
87 tttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaacttac 179  Q
    ||||||||| | |||| ||||| ||||| ||||||||||||| |  ||| |||||  |||| |||||||| || |||||| ||||||| ||||    
41415857 tttaaggattccaaatatagaaaatattctttaaaaaagtcacaagttacaaattacaatgcattgattaaacaattttttataaaaatttac 41415765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 54 - 134
Target Start/End: Complemental strand, 53737933 - 53737853
Alignment:
54 agagtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatatt 134  Q
    ||||||||| |||||||||||||  ||||||||||||||  | | ||| | ||||  |||| ||||||||| |||||||||    
53737933 agagtcttgctaacgagtgcccccagggcactctttaagcgttccaaaataagaaattattctttaaaaaattcaaatatt 53737853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 57; Significance: 5e-24; HSPs: 25)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 59 - 179
Target Start/End: Original strand, 46726109 - 46726228
Alignment:
59 cttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattaca 158  Q
    |||||||||||||||||| ||| |||||||||||||||| ||||||| || ||||| |||||||||||||||| ||| |||||  |||| ||||||||||    
46726109 cttgttaacgagtgcccccggg-cactctttaaggataccaaatttaaaaaatattctttaaaaaagtcaaatgttacaaatttcaatgcattgattaca 46726207  T
159 cgatttttcataaaaacttac 179  Q
       ||||||||||||| ||||    
46726208 tagtttttcataaaaatttac 46726228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 81 - 174
Target Start/End: Complemental strand, 2959686 - 2959593
Alignment:
81 gcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaa 174  Q
    |||||||||||||||  |||||| | || ||||||||| ||||||| |||| ||||||||| ||||| ||||||||||  ||||||||||||||    
2959686 gcactctttaaggatcataaattaaaaaaatattttttgaaaaagttaaatgttataaattttaatgcattgattacataatttttcataaaaa 2959593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 47639184 - 47639270
Alignment:
87 tttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaa 173  Q
    ||||||||| ||||||||| || ||||| ||||||||| | |||| ||| ||||| ||||||||||||||||| |||||| ||||||    
47639184 tttaaggatcctaaatttaaaaaatattctttaaaaaaattaaatgttacaaattttaatgtattgattacacaattttttataaaa 47639270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 98 - 179
Target Start/End: Complemental strand, 18219180 - 18219097
Alignment:
98 taaatttagaatatattttttaaaaaagtcaaatattataaattc--taatgtattgattacacgatttttcataaaaacttac 179  Q
    |||||||||||  |||| ||||||||| |||||||||||||||||  ||||| ||||| ||||||| |||| ||||||||||||    
18219180 taaatttagaaattattctttaaaaaactcaaatattataaattctataatgcattgaatacacgagtttttataaaaacttac 18219097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 42258902 - 42258985
Alignment:
97 ctaaatttagaatatattttttaaaaaagtcaaatattataaat--tctaatgtattgattacacgatttttcataaaaactta 178  Q
    |||||||||||| ||||| ||| ||||||| |||| ||| |||   | ||||||||||||||||| ||||||||||||||||||    
42258902 ctaaatttagaaaatattcttttaaaaagttaaatgttacaaaaaatttaatgtattgattacacaatttttcataaaaactta 42258985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 60 - 179
Target Start/End: Original strand, 2347390 - 2347509
Alignment:
60 ttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacac 159  Q
    |||||||||||||||||| ||  |||||| |||||| | |||||||| | |||||  | |||||| |||||||||| |||||  |||| ||||||||||     
2347390 ttgttaacgagtgcccctaggatactcttaaaggattccaaatttagtaaatattcctcaaaaaaatcaaatattacaaatttcaatgcattgattacat 2347489  T
160 gatttttcataaaaacttac 179  Q
     | |||| ||||||| ||||    
2347490 aaattttaataaaaatttac 2347509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 179
Target Start/End: Original strand, 27123244 - 27123367
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||||||||||||||||||| ||||||||||||||| || | |||||||| |   ||| ||| |||||||||| ||||| || ||| |||| ||| | ||    
27123244 gtcttgttaacgagtgcccccggggcactctttaagcatcccaaatttagtaatcattcttttaaaaagtcaactattacaatttccaatgcattaagta 27123343  T
157 cacgatttttc-ataaaaacttac 179  Q
    ||| | |||||  |||||||||||    
27123344 cacaacttttcgttaaaaacttac 27123367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 57 - 175
Target Start/End: Complemental strand, 28663273 - 28663157
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||||||||||||||| ||||| ||||||||||||| ||  ||| |||||||| |||| ||| |||||||||| ||||| || ||  |||| ||| | ||    
28663273 gtcttgttaacgagtg-ccctgaggcactctttaagcatcataactttagaat-tattcttttaaaaagtcaactattacaattttcaatgcattcaata 28663176  T
157 cacgatttttcataaaaac 175  Q
    ||| ||||||||| |||||    
28663175 cacaatttttcattaaaac 28663157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 82 - 178
Target Start/End: Original strand, 36189474 - 36189571
Alignment:
82 cactctttaaggatactaaatttagaatatattttttaaaaaa-gtcaaatattataaattctaatgtattgattacacgatttttcataaaaactta 178  Q
    |||| ||||||||| | |||||||||| ||||| | ||||||| | ||||||||  |||||| ||| ||||||||||||   ||||||||||||||||    
36189474 cactttttaaggatcccaaatttagaaaatattctataaaaaaagccaaatattgcaaattccaatatattgattacacatattttcataaaaactta 36189571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 62 - 94
Target Start/End: Complemental strand, 42911194 - 42911162
Alignment:
62 gttaacgagtgcccctggggcactctttaagga 94  Q
    |||||||||||||||||||||||||||||||||    
42911194 gttaacgagtgcccctggggcactctttaagga 42911162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 169
Target Start/End: Original strand, 47507580 - 47507692
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||||||||||||||| | | |||||||||||||||||| |||||   ||||   ||||| ||||||| ||||| |||  || |||  ||||||||||||    
47507580 gtcttgttaacgagtgtctccggggcactctttaaggattctaaaagaagaaataattttataaaaaaatcaaagatttcaatttccgatgtattgatta 47507679  T
157 cacgatttttcat 169  Q
    |||  ||||||||    
47507680 cacattttttcat 47507692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 57 - 172
Target Start/End: Complemental strand, 10032057 - 10031942
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||| ||||||||||||||| ||| ||||||||||| || | ||| |||| |  |||||||| ||||||| |||| ||   | ||| |||| ||||||||    
10032057 gtctcgttaacgagtgcccccgggacactctttaagcattccaaaattagtaattatttttttaaaaagttaaatgtttcgatttccaatgcattgatta 10031958  T
157 cacgatttttcataaa 172  Q
    |||  |||||||||||    
10031957 cacactttttcataaa 10031942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 57 - 92
Target Start/End: Complemental strand, 17157906 - 17157871
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaag 92  Q
    ||||||||||||||||||| ||||||||||||||||    
17157906 gtcttgttaacgagtgcccttggggcactctttaag 17157871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 57 - 179
Target Start/End: Original strand, 28770447 - 28770570
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||||||||||||||||| | ||||||||||||||| || | ||| |||| |  |||| |||  ||||||||| ||||| || ||| |||| ||| | ||    
28770447 gtcttgttaacgagtgcctccggggcactctttaagcatcccaaaattagtaattattcttttgaaaagtcaactattacaatttccaatgcattcaata 28770546  T
157 cacgatttttca-taaaaacttac 179  Q
    ||| | |||||| |||||||||||    
28770547 cacaacttttcattaaaaacttac 28770570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 57 - 132
Target Start/End: Original strand, 34681663 - 34681737
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaata 132  Q
    ||||| |||||||||||||| |||||| |||||||| || |||||||  |||  ||||||||| ||||||||||||    
34681663 gtcttcttaacgagtgcccc-ggggcagtctttaagcattctaaattaggaaattattttttacaaaagtcaaata 34681737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 57 - 179
Target Start/End: Complemental strand, 35496709 - 35496586
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||||||| |||| || ||| || |||||||||||| || | |||||||| |  ||| |||| |||||||||| ||||| || ||  |||| ||| ||||    
35496709 gtcttgtttacgaatgtccccggagcactctttaagcatccaaaatttagtaactatatttttaaaaagtcaactattacaattttcaatgcattcatta 35496610  T
157 cacgatttttca-taaaaacttac 179  Q
    ||| |||||||| |||||||||||    
35496609 cacaatttttcattaaaaacttac 35496586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 44543734 - 44543809
Alignment:
99 aaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaa 174  Q
    ||||||| || ||||| | |||||| ||||||| |||||||||| |||| |||||||||||  ||||| |||||||    
44543734 aaatttaaaaaatattctataaaaatgtcaaatgttataaattcaaatgcattgattacacatttttttataaaaa 44543809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 61 - 92
Target Start/End: Original strand, 47754478 - 47754509
Alignment:
61 tgttaacgagtgcccctggggcactctttaag 92  Q
    ||||||||||||||||||||||||||||||||    
47754478 tgttaacgagtgcccctggggcactctttaag 47754509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 103
Target Start/End: Complemental strand, 27766822 - 27766776
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatt 103  Q
    ||||||||||||||||||||  |||||||||||||| || |||||||    
27766822 gtcttgttaacgagtgcccccagggcactctttaagcattctaaatt 27766776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 80 - 178
Target Start/End: Original strand, 36939464 - 36939562
Alignment:
80 ggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaactta 178  Q
    ||||||||||||||||  |||||||| || |||||  | ||||||||||||| ||| |||||  | || ||| ||||||| | ||| ||||||||||||    
36939464 ggcactctttaaggatcttaaatttaaaaaatattcctcaaaaaagtcaaatgttacaaatttcagtgcattaattacacaaatttacataaaaactta 36939562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 113 - 179
Target Start/End: Complemental strand, 41431170 - 41431104
Alignment:
113 ttttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaacttac 179  Q
    |||||||||||| | |||||||  || |||||||||||||||||| |   |||||||||||||||||    
41431170 ttttttaaaaaaattaaatatttcaatttctaatgtattgattactcatattttcataaaaacttac 41431104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 57 - 106
Target Start/End: Complemental strand, 14651520 - 14651471
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttag 106  Q
    |||||| ||||||||||||| |||||||| |||||| || ||||||||||    
14651520 gtcttgctaacgagtgcccccggggcactttttaagtatcctaaatttag 14651471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 57 - 130
Target Start/End: Complemental strand, 34299879 - 34299806
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaa 130  Q
    |||||||||||||||||||| |||||||| |||||| || ||| ||| || |  |||| |||||||| ||||||    
34299879 gtcttgttaacgagtgcccccggggcactttttaagcatgctagattaagcaattattctttaaaaatgtcaaa 34299806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 57 - 138
Target Start/End: Original strand, 44537311 - 44537392
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataa 138  Q
    |||| |||||||||||||||||  |||||||||||| || | | |||||| |  |||| ||| |||||||||| ||||||||    
44537311 gtctcgttaacgagtgcccctgatgcactctttaagcatcccatatttagtaattattcttttaaaaagtcaactattataa 44537392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 101
Target Start/End: Complemental strand, 45375483 - 45375439
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaa 101  Q
    ||||| |||||||||||| | |||||||||||||||||| |||||    
45375483 gtcttattaacgagtgcctccggggcactctttaaggattctaaa 45375439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 52; Significance: 5e-21; HSPs: 23)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 57 - 184
Target Start/End: Original strand, 41583513 - 41583640
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||||||||||||||||||| ||| |||||||||||||| | ||||||||||  ||||  || ||||||| |||||||| |||||| |||| ||||| ||    
41583513 gtcttgttaacgagtgcccccgggtcactctttaaggatcccaaatttagaaattattccttcaaaaagttaaatattacaaattccaatgcattgaata 41583612  T
157 cacgatttttcataaaaacttacaattg 184  Q
    |||   |||||||||||| |||| ||||    
41583613 cacagattttcataaaaatttactattg 41583640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000004
Query Start/End: Original strand, 65 - 178
Target Start/End: Complemental strand, 2827692 - 2827579
Alignment:
65 aacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgattt 164  Q
    |||||||| ||| |||||||||||||| ||| | |||||||||| ||||| ||||| |||||||||| ||| || ||  |||| ||||||| ||| | ||    
2827692 aacgagtgtccccggggcactctttaaagattccaaatttagaaaatattatttaagaaagtcaaatgttacaagtttcaatgcattgattgcacaaatt 2827593  T
165 ttcataaaaactta 178  Q
    || |||||||||||    
2827592 ttaataaaaactta 2827579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 124
Target Start/End: Complemental strand, 25438011 - 25437944
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaa 124  Q
    |||||||||||||||||||| ||| ||||||||||| || ||||||| ||||  |||| |||||||||    
25438011 gtcttgttaacgagtgcccccgggacactctttaagcatgctaaattaagaagttattctttaaaaaa 25437944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 57 - 135
Target Start/End: Complemental strand, 30501276 - 30501198
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatatta 135  Q
    ||||||||||||||||||||  |||||||||||||| || | |||||||| |  |||| ||| |||||||||| |||||    
30501276 gtcttgttaacgagtgcccccagggcactctttaagcatcccaaatttagtaattattcttttaaaaagtcaattatta 30501198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 57 - 135
Target Start/End: Complemental strand, 30541619 - 30541541
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatatta 135  Q
    ||||||||||||||||||||  |||||||||||||| || | |||||||| |  |||| ||| |||||||||| |||||    
30541619 gtcttgttaacgagtgcccccagggcactctttaagcatcccaaatttagtaattattcttttaaaaagtcaattatta 30541541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 134
Target Start/End: Complemental strand, 34032226 - 34032149
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatatt 134  Q
    |||||||||||||||| || |||||||||||||||| || ||||| | || |  |||| ||||||||||| |||||||    
34032226 gtcttgttaacgagtgtccttggggcactctttaagcattctaaaataagtaattattctttaaaaaagttaaatatt 34032149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 60 - 179
Target Start/End: Original strand, 30104777 - 30104897
Alignment:
60 ttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacac 159  Q
    |||||||| |||||||  ||||||||||||||| || | |||||||| |  |||||||| ||||||||||  |||| || ||| |||| ||| | |||||    
30104777 ttgttaacaagtgccctcggggcactctttaagcatcccaaatttagtaactatttttttaaaaagtcaacaattacaatttccaatgcattcaatacac 30104876  T
160 gatttttca-taaaaacttac 179  Q
     | |||||| |||||||||||    
30104877 aacttttcattaaaaacttac 30104897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 82 - 178
Target Start/End: Original strand, 36160314 - 36160410
Alignment:
82 cactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaactta 178  Q
    ||||||||||| || ||||| | || |  ||||||||||||||||||||| || | | ||  ||| |||| |||||||||||||||||||| |||||    
36160314 cactctttaagcattctaaaataagcaattattttttaaaaaagtcaaatgttttgattttcaatatattaattacacgatttttcataaatactta 36160410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 120 - 179
Target Start/End: Complemental strand, 7581251 - 7581192
Alignment:
120 aaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaacttac 179  Q
    ||||| |||||||||| ||||||||||||||| | ||||||| |||| || |||||||||    
7581251 aaaaaatcaaatattacaaattctaatgtattaaatacacgaatttttatgaaaacttac 7581192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 52 - 178
Target Start/End: Original strand, 7719169 - 7719296
Alignment:
52 atagagtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtatt 151  Q
    |||| ||||| |||||||||||||| ||| ||||||||||| |||| | ||||| ||  |||| ||| ||||| |||| ||||| || ||| ||| ||||    
7719169 atagggtctttttaacgagtgcccccgggacactctttaagcataccatatttaaaaattattcttttaaaaaatcaactattacaatttccaatatatt 7719268  T
152 gattacacgatttttca-taaaaactta 178  Q
     | ||||| | |||||| ||||||||||    
7719269 caatacacaacttttcattaaaaactta 7719296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 55 - 134
Target Start/End: Original strand, 10051698 - 10051777
Alignment:
55 gagtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatatt 134  Q
    |||||||||||||||||| ||||  ||||||||||||||||  ||||   ||||   ||||| |||||||||||||||||    
10051698 gagtcttgttaacgagtgtccctaaggcactctttaaggattttaaaagaagaaataattttataaaaaagtcaaatatt 10051777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 57 - 92
Target Start/End: Original strand, 23023603 - 23023638
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaag 92  Q
    |||||||||||||||||||| |||||||||||||||    
23023603 gtcttgttaacgagtgcccccggggcactctttaag 23023638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 57 - 92
Target Start/End: Original strand, 31672381 - 31672416
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaag 92  Q
    |||||||||||||||||||| |||||||||||||||    
31672381 gtcttgttaacgagtgcccccggggcactctttaag 31672416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 98 - 156
Target Start/End: Complemental strand, 2689344 - 2689287
Alignment:
98 taaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||||||| || ||||||||||||||| |||||| |||||||||| ||||| |||||||    
2689344 taaatttaaaaaatattttttaaaaaa-tcaaatgttataaattcaaatgttttgatta 2689287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 60 - 174
Target Start/End: Complemental strand, 2918730 - 2918616
Alignment:
60 ttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacac 159  Q
    |||||||||||||||  ||||| |||||||||| ||   |||||||  |  ||||||||||||| ||||| |||||||| ||| |||| ||| | |||||    
2918730 ttgttaacgagtgcctttggggtactctttaagcatttcaaatttaataattattttttaaaaatgtcaactattataatttccaatgcatttaatacac 2918631  T
160 gatttttcataaaaa 174  Q
     | ||||||| ||||    
2918630 aacttttcattaaaa 2918616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 91
Target Start/End: Original strand, 10410420 - 10410454
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaa 91  Q
    |||||||||||||||||||| ||||||||||||||    
10410420 gtcttgttaacgagtgcccccggggcactctttaa 10410454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 77 - 135
Target Start/End: Original strand, 22871910 - 22871968
Alignment:
77 tggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatatta 135  Q
    |||| |||||||||||||| |||||   |||| ||||||| ||||||||||||||||||    
22871910 tgggacactctttaaggattctaaaagaagaaaatattttataaaaaagtcaaatatta 22871968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 61 - 159
Target Start/End: Original strand, 26663609 - 26663707
Alignment:
61 tgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacac 159  Q
    ||||||| ||||| ||  |||| || |||||| || ||||| | ||||  ||||||||||||||||||||||||   | ||| ||||||||||||||||    
26663609 tgttaacaagtgctcccagggcgctttttaagcattctaaaataagaaattattttttaaaaaagtcaaatatttcgatttccaatgtattgattacac 26663707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 61 - 159
Target Start/End: Original strand, 26935204 - 26935302
Alignment:
61 tgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacac 159  Q
    ||||||| ||||| ||  |||| || |||||| || ||||| | ||||  ||||||||||||||||||||||||   | ||| ||||||||||||||||    
26935204 tgttaacaagtgctcccagggcgctttttaagcattctaaaataagaaattattttttaaaaaagtcaaatatttcgatttccaatgtattgattacac 26935302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 177
Target Start/End: Complemental strand, 27536774 - 27536716
Alignment:
119 aaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaactt 177  Q
    ||||||||||||||||| |||||  |||| |||||||||||  |||||| |||||||||    
27536774 aaaaaagtcaaatattacaaatttgaatgcattgattacactttttttcgtaaaaactt 27536716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 81 - 159
Target Start/End: Complemental strand, 30370968 - 30370891
Alignment:
81 gcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacac 159  Q
    |||||||||||||||  | |||||| ||  ||||||||| ||||||||||| |||||||||  ||||| ||||||||||    
30370968 gcactctttaaggatttttaatttaaaaagtattttttataaaagtcaaat-ttataaatttcaatgtcttgattacac 30370891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 54 - 91
Target Start/End: Original strand, 779053 - 779090
Alignment:
54 agagtcttgttaacgagtgcccctggggcactctttaa 91  Q
    |||||||||||||||||||||||  |||||||||||||    
779053 agagtcttgttaacgagtgccccctgggcactctttaa 779090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 141
Target Start/End: Complemental strand, 40458889 - 40458834
Alignment:
85 tctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaatt 141  Q
    ||||||| |||| ||||||||||| ||||| ||| ||||||| ||||||||||||||    
40458889 tctttaatgatattaaatttagaa-atattatttcaaaaagttaaatattataaatt 40458834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 52; Significance: 5e-21; HSPs: 25)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 55 - 142
Target Start/End: Original strand, 32572764 - 32572851
Alignment:
55 gagtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattc 142  Q
    ||||||| |||||||||| ||||| | ||||||||||| ||||||||||||||| || || |||||||||||||||| ||||||||||    
32572764 gagtcttattaacgagtgtccctgcgacactctttaagcatactaaatttagaaaatgttatttaaaaaagtcaaatgttataaattc 32572851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 61 - 174
Target Start/End: Original strand, 27542834 - 27542948
Alignment:
61 tgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacac- 159  Q
    ||||||||||| || | | || ||||||||||||||| ||||||| || ||||| |||||||||||||||||||| | |||| ||||||||||||| ||     
27542834 tgttaacgagtacctccgaggtactctttaaggataccaaatttaaaaaatattctttaaaaaagtcaaatattacatattccaatgtattgattataca 27542933  T
160 gatttttcataaaaa 174  Q
    | |||||||||||||    
27542934 gttttttcataaaaa 27542948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 50; E-Value: 7e-20
Query Start/End: Original strand, 54 - 179
Target Start/End: Complemental strand, 26756325 - 26756200
Alignment:
54 agagtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattga 153  Q
    ||||||||||||||||||| | ||||  || ||||||||||   |||||||| || ||||| |||||||||||||||||||| ||| ||||||| ||| |    
26756325 agagtcttgttaacgagtgtctctggaacattctttaaggaccataaatttaaaaaatattatttaaaaaagtcaaatattacaaactctaatgcattta 26756226  T
154 ttacacgatttttcataaaaacttac 179  Q
    |||| | | ||||| |||||||||||    
26756225 ttactcaaattttcgtaaaaacttac 26756200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 60 - 179
Target Start/End: Original strand, 48947177 - 48947296
Alignment:
60 ttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacac 159  Q
    |||||||||||||||||||||||| |||||||| |||||||||| || |  ||||||||||||| ||||||  ||  || ||| |||| | |||||||||    
48947177 ttgttaacgagtgcccctggggcattctttaagcatactaaattaagtaattattttttaaaaatgtcaaagttttcaatttccaatgcactgattacac 48947276  T
160 gatttttcataaaaacttac 179  Q
     | |||||||||||| ||||    
48947277 aaattttcataaaaagttac 48947296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 57 - 159
Target Start/End: Original strand, 45584509 - 45584611
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    ||||||||||||| |||||| |||||||||||||||||| | |||   ||||  |||||| ||||||||| ||||||| ||| |||| ||||||||||||    
45584509 gtcttgttaacgaatgcccccggggcactctttaaggattccaaaagaagaaattattttataaaaaagttaaatattttaatttctgatgtattgatta 45584608  T
157 cac 159  Q
    |||    
45584609 cac 45584611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 42; E-Value: 0.000000000000004
Query Start/End: Original strand, 57 - 130
Target Start/End: Complemental strand, 34861348 - 34861275
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaa 130  Q
    |||||||||||||||||||| ||||||||||||||| || ||||||| || |  ||||||||||||| ||||||    
34861348 gtcttgttaacgagtgccccgggggcactctttaagcattctaaattaagtaattattttttaaaaatgtcaaa 34861275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 87 - 174
Target Start/End: Complemental strand, 27004129 - 27004042
Alignment:
87 tttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaa 174  Q
    ||||| ||| ||||||||| || ||||||||||||||||| |||| |||| ||||  |||| ||||||||||| ||||||| ||||||    
27004129 tttaaagatcctaaatttaaaaaatattttttaaaaaagttaaatgttatcaatttcaatgcattgattacacaatttttcttaaaaa 27004042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 57 - 180
Target Start/End: Complemental strand, 43025049 - 43024926
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||||||||||||||| | |   | |||||||||||||| ||| ||||| || ||||| ||||||||| | |||||||| |||||  |||| | ||||||    
43025049 gtcttgttaacgagtgtctccatgacactctttaaggatcctatatttaaaaaatattatttaaaaaaattaaatattacaaatttcaatgcactgatta 43024950  T
157 cacgatttttcataaaaacttaca 180  Q
    ||||  |||||||||||| |||||    
43024949 cacgtattttcataaaaatttaca 43024926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 88 - 142
Target Start/End: Complemental strand, 16790350 - 16790296
Alignment:
88 ttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattc 142  Q
    |||||||| |||||||||||| || ||||||||||||||||||| ||||||||||    
16790350 ttaaggatcctaaatttagaaaatcttttttaaaaaagtcaaatgttataaattc 16790296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 57 - 135
Target Start/End: Original strand, 39150552 - 39150630
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatatta 135  Q
    |||||||||||||||||||| ||||||||||||||| || |||||||||| |  |||| ||  |||||||||| |||||    
39150552 gtcttgttaacgagtgcccccggggcactctttaagcatcctaaatttagtaattattcttgtaaaaagtcaactatta 39150630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 58 - 123
Target Start/End: Complemental strand, 35259181 - 35259116
Alignment:
58 tcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaa 123  Q
    ||||||||||||||||||  ||||||||||||||| || ||||||| ||||  |||||||||||||    
35259181 tcttgttaacgagtgccctcggggcactctttaagtatgctaaattaagaaattattttttaaaaa 35259116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 57 - 130
Target Start/End: Complemental strand, 39912346 - 39912273
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaa 130  Q
    |||||||||||||||||||| ||| ||||||||||| || |||||||  |||  |||| |||||||||||||||    
39912346 gtcttgttaacgagtgcccccgggacactctttaagcatgctaaattaggaagttattatttaaaaaagtcaaa 39912273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 57 - 134
Target Start/End: Original strand, 40377012 - 40377089
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatatt 134  Q
    ||||||||||||||||||||| ||||||||||||||||| | |||   ||||   ||||| |||||||||||||||||    
40377012 gtcttgttaacgagtgccccttgggcactctttaaggattccaaaagaagaaataattttataaaaaagtcaaatatt 40377089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 54 - 177
Target Start/End: Original strand, 37705844 - 37705967
Alignment:
54 agagtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattga 153  Q
    ||||||||||||||||||||||| || |||||||||||| || | ||| | || |  ||||||||| |||| |||||| || | | ||  |||| ||| |    
37705844 agagtcttgttaacgagtgcccccggagcactctttaagcattcgaaaatgagtaattattttttagaaaactcaaatgttttgattttcaatgcattaa 37705943  T
154 ttacacgatttttcataaaaactt 177  Q
    ||||||| ||||||||||| ||||    
37705944 ttacacgttttttcataaatactt 37705967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 130
Target Start/End: Original strand, 16113889 - 16113962
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaa 130  Q
    |||||||||||||||||| | ||||||||||||||| |||||| ||| || |  |||||||| |||| ||||||    
16113889 gtcttgttaacgagtgcctccggggcactctttaagcatactatattaagtaattattttttcaaaatgtcaaa 16113962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 134
Target Start/End: Original strand, 34445639 - 34445716
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatatt 134  Q
    |||||||||||||||||||| || ||||||||||||||| | |||   ||||  || ||| |||||||||||||||||    
34445639 gtcttgttaacgagtgcccccggagcactctttaaggattccaaaagaagaaattaatttataaaaaagtcaaatatt 34445716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 63 - 174
Target Start/End: Complemental strand, 5251031 - 5250920
Alignment:
63 ttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgat 162  Q
    |||||||||||| | || |||||||||||  ||||||||||  |||  |||| ||||||||||||||| | | ||| ||  |||||||| | ||||| |     
5251031 ttaacgagtgcctccggagcactctttaaacatactaaattaggaagttattctttaaaaaagtcaaacagtttaattttcaatgtattaaatacacaaa 5250932  T
163 ttttcataaaaa 174  Q
    ||||||||||||    
5250931 ttttcataaaaa 5250920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 57 - 92
Target Start/End: Original strand, 40570659 - 40570694
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaag 92  Q
    |||||||||||||||||||| |||||||||||||||    
40570659 gtcttgttaacgagtgcccccggggcactctttaag 40570694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 80 - 179
Target Start/End: Complemental strand, 43397130 - 43397028
Alignment:
80 ggcactctttaaggatactaaatttag--aatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttca-taaaaact 176  Q
    ||||||||||||| || ||||||||||  | ||||| |||| |||||||||| |||||||| ||| |||| ||| | ||||| | |||||| ||||||||    
43397130 ggcactctttaagcatcctaaatttagtaattatatatttttaaaaagtcaactattataatttccaatgcatttaatacacaacttttcattaaaaact 43397031  T
177 tac 179  Q
    |||    
43397030 tac 43397028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 103
Target Start/End: Original strand, 3047837 - 3047883
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatt 103  Q
    |||||||||| ||||||||| ||||||||||||||| || |||||||    
3047837 gtcttgttaaagagtgcccccggggcactctttaagcatgctaaatt 3047883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 83 - 141
Target Start/End: Original strand, 9534368 - 9534426
Alignment:
83 actctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaatt 141  Q
    ||||||||| ||| | ||||||| || || || ||||||||||||||||||||||||||    
9534368 actctttaatgatcccaaatttaaaaaatgttatttaaaaaagtcaaatattataaatt 9534426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 57 - 166
Target Start/End: Original strand, 39156231 - 39156340
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||||||||||||||||||||| | ||||||||||| ||   |||||||| |  |||| ||| |||||||||| || || || ||| |||| ||| | ||    
39156231 gtcttgttaacgagtgcccctgagacactctttaagcatcaaaaatttagtaattattcttttaaaaagtcaactactacaatttccaatgcattcaata 39156330  T
157 cacgattttt 166  Q
    ||| ||||||    
39156331 cacaattttt 39156340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 52 - 92
Target Start/End: Complemental strand, 4851385 - 4851345
Alignment:
52 atagagtcttgttaacgagtgcccctggggcactctttaag 92  Q
    ||||||||||||||||||||||| | ||| |||||||||||    
4851385 atagagtcttgttaacgagtgcctccgggacactctttaag 4851345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 106
Target Start/End: Complemental strand, 14746334 - 14746287
Alignment:
58 tcttgttaacgagtgcccctggggcactctttaaggatactaaatttag 106  Q
    |||||||||||||||||||| || ||||||||||| |||| ||||||||    
14746334 tcttgttaacgagtgcccct-ggacactctttaagtataccaaatttag 14746287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 179
Target Start/End: Complemental strand, 46533838 - 46533778
Alignment:
119 aaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaacttac 179  Q
    |||||||| ||||||| | | ||||||||||||||||||||  ||||| ||||||| ||||    
46533838 aaaaaagtaaaatattttgatttctaatgtattgattacacatttttttataaaaaattac 46533778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 50; Significance: 7e-20; HSPs: 25)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 50; E-Value: 7e-20
Query Start/End: Original strand, 52 - 173
Target Start/End: Complemental strand, 37564473 - 37564352
Alignment:
52 atagagtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtatt 151  Q
    ||||||||||||||||||||||| ||||| ||||||||||  || ||||||| ||||  |||| ||||||||||||||||| |  || ||| ||||||||    
37564473 atagagtcttgttaacgagtgcctctgggacactctttaaacatgctaaattaagaaattattctttaaaaaagtcaaatagttcaatttccaatgtatt 37564374  T
152 gattacacgatttttcataaaa 173  Q
     | ||||| | |||||||||||    
37564373 aaatacacaagttttcataaaa 37564352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 57 - 179
Target Start/End: Original strand, 31264967 - 31265089
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||||||||||||||||||||| ||||||||||||| || |||||||  |||  |||| ||||||||||||||| | |  || ||| |||||||| | ||    
31264967 gtcttgttaacgagtgcccctgtggcactctttaagcatgctaaattaggaagttattctttaaaaaagtcaaacaattcaatttccaatgtattaaata 31265066  T
157 cacgatttttcataaaaacttac 179  Q
    ||| | |||||||||||| ||||    
31265067 cacaagttttcataaaaagttac 31265089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 60 - 147
Target Start/End: Original strand, 8674432 - 8674519
Alignment:
60 ttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatg 147  Q
    |||||||||||||||||  | | ||||||||||||| | ||||||| || ||||||||||||||||| |||| ||| |||||||||||    
8674432 ttgttaacgagtgcccccagagtactctttaaggatcccaaatttaaaaaatattttttaaaaaagttaaatgttacaaattctaatg 8674519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 82 - 177
Target Start/End: Complemental strand, 15353881 - 15353786
Alignment:
82 cactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaactt 177  Q
    ||||||| |||||| ||||||||| || ||||||||||||||||| |||||||| |||||  ||  |||| |||| || |||||||||||||||||    
15353881 cactcttcaaggatcctaaatttataaaatattttttaaaaaagtgaaatattacaaatttcaaaatattaattatacaatttttcataaaaactt 15353786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 60 - 179
Target Start/End: Original strand, 24733145 - 24733264
Alignment:
60 ttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacac 159  Q
    ||||||||||||| ||| |||  ||||||||||||| | ||||||| || ||||| | |||||||||||||| ||| |||||  | || |||||||||||    
24733145 ttgttaacgagtgtccccgggatactctttaaggatcccaaatttaaaaaatattctctaaaaaagtcaaatgttacaaattacagtgcattgattacac 24733244  T
160 gatttttcataaaaacttac 179  Q
     | |||| ||||||||||||    
24733245 aaatttttataaaaacttac 24733264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 42; E-Value: 0.000000000000004
Query Start/End: Original strand, 64 - 173
Target Start/End: Complemental strand, 27734469 - 27734360
Alignment:
64 taacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatt 163  Q
    ||||||||||||| ||  |||||||||||||| | ||||||||||  ||||  || |||||||| ||||||| |||||| |||| ||||| ||||||  |    
27734469 taacgagtgcccccggatcactctttaaggatcccaaatttagaaattattccttcaaaaagtctaatattacaaattccaatgcattgaatacacggat 27734370  T
164 tttcataaaa 173  Q
    ||||||||||    
27734369 tttcataaaa 27734360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 57 - 141
Target Start/End: Complemental strand, 7574315 - 7574231
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaatt 141  Q
    ||||||||||||||||| || |||||||| ||||||||  | |||||||||| |||||| |||||||| |||||| ||| |||||    
7574315 gtcttgttaacgagtgctcccggggcactatttaaggaacccaaatttagaaaatatttcttaaaaaaatcaaatgttacaaatt 7574231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 83 - 178
Target Start/End: Original strand, 44253803 - 44253897
Alignment:
83 actctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaactta 178  Q
    ||||||||||||| | ||||||| || |||||||| ||||||||||||| ||||||||| |||   ||||||||||| | |||| |||||||||||    
44253803 actctttaaggattccaaatttaaaaaatatttttaaaaaaagtcaaatgttataaattttaaatcattgattacacaaatttt-ataaaaactta 44253897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 57 - 179
Target Start/End: Original strand, 16459213 - 16459335
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||||||||||||||| | |||||  ||| |||||| ||  |||||||| || ||||| || ||||||||||||| ||| |||||  |||| |    |||    
16459213 gtcttgttaacgagtgtctctgggatactttttaagtattttaaatttaaaaaatattcttaaaaaaagtcaaatgttacaaatttcaatgcacgagtta 16459312  T
157 cacgatttttcataaaaacttac 179  Q
    ||| |||||||||||||||||||    
16459313 cacaatttttcataaaaacttac 16459335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 53 - 179
Target Start/End: Original strand, 25279895 - 25280020
Alignment:
53 tagagtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattg 152  Q
    |||||||||||||||||||||||||  | ||||||||||| || |||||||  |||  |||| ||| ||||||||||||| |  || ||| ||||||||     
25279895 tagagtcttgttaacgagtgcccctacgacactctttaagcatgctaaattaggaagttattcttt-aaaaagtcaaataattcaatttccaatgtatta 25279993  T
153 attacacgatttttcataaaaacttac 179  Q
    | ||||  | |||||||||||| ||||    
25279994 aatacataagttttcataaaaatttac 25280020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 58 - 103
Target Start/End: Complemental strand, 1876617 - 1876572
Alignment:
58 tcttgttaacgagtgcccctggggcactctttaaggatactaaatt 103  Q
    ||||||||||||||||||| ||||||||||||||| || |||||||    
1876617 tcttgttaacgagtgcccccggggcactctttaagcatgctaaatt 1876572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 134
Target Start/End: Complemental strand, 20279691 - 20279614
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatatt 134  Q
    ||||||||||| |||||||| ||||||||||||||| || ||||| | || |  |||| ||| |||||||||||||||    
20279691 gtcttgttaacaagtgcccccggggcactctttaagcattctaaaataagcaattattctttcaaaaagtcaaatatt 20279614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 134
Target Start/End: Complemental strand, 21066318 - 21066241
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatatt 134  Q
    ||||||||||| |||||||| ||||||||||||||| || ||||| | || |  |||| ||| |||||||||||||||    
21066318 gtcttgttaacaagtgcccccggggcactctttaagcattctaaaataagcaattattctttcaaaaagtcaaatatt 21066241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 98 - 159
Target Start/End: Original strand, 29217559 - 29217620
Alignment:
98 taaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacac 159  Q
    ||||||||||| |||||| ||||||| ||||||||||| |||||| |||| | |||||||||    
29217559 taaatttagaaaatatttcttaaaaaggtcaaatattacaaattccaatgcagtgattacac 29217620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 52 - 179
Target Start/End: Complemental strand, 42636507 - 42636379
Alignment:
52 atagagtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtatt 151  Q
    |||| |||||||||| |||||| || ||||||||||||||| || | |||||||| |  |||| || ||||||||||| ||||| || ||  |||| |||    
42636507 atagggtcttgttaaggagtgctcccggggcactctttaagcatcccaaatttagtaattattattcaaaaaagtcaactattacaatttacaatgcatt 42636408  T
152 gattacacgatttttca-taaaaacttac 179  Q
     | ||||| | |||||| |||||||||||    
42636407 taatacacaacttttcattaaaaacttac 42636379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 82 - 177
Target Start/End: Complemental strand, 35210043 - 35209948
Alignment:
82 cactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaactt 177  Q
    ||||||||||||||   ||||||| || |||||  |||||||||| |||| ||| |||||| |||||||| || |||| | |||| ||||||||||    
35210043 cactctttaaggatctcaaatttaaaaaatattccttaaaaaagttaaatgttacaaattccaatgtattaatcacacaaattttaataaaaactt 35209948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 57 - 92
Target Start/End: Original strand, 37426389 - 37426424
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaag 92  Q
    |||||||||||||||||||||||| |||||||||||    
37426389 gtcttgttaacgagtgcccctgggacactctttaag 37426424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 78 - 172
Target Start/End: Complemental strand, 37813518 - 37813423
Alignment:
78 ggggcactctttaaggatactaaatttagaatatatt-ttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaa 172  Q
    |||||||||||||||||| | |||||||| |  |||| |||||||||||||||  |||| || ||| |||| ||||| ||||| | ||||||||||    
37813518 ggggcactctttaaggatcccaaatttagtaattattcttttaaaaaagtcaaccattacaatttccaatgcattgaatacacaacttttcataaa 37813423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 95
Target Start/End: Complemental strand, 7262158 - 7262120
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggat 95  Q
    ||||||||||||||||||||  |||||||||||||||||    
7262158 gtcttgttaacgagtgcccccagggcactctttaaggat 7262120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 91
Target Start/End: Original strand, 24869384 - 24869418
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaa 91  Q
    |||||||||||||||||||||| ||||||||||||    
24869384 gtcttgttaacgagtgcccctgtggcactctttaa 24869418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 179
Target Start/End: Original strand, 7931747 - 7931807
Alignment:
119 aaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaacttac 179  Q
    ||||| |||||||||||||| ||  |||||||||||||||| | |||||| ||||| ||||    
7931747 aaaaaggtcaaatattataattttcaatgtattgattacacaaattttcaaaaaaagttac 7931807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 61 - 93
Target Start/End: Complemental strand, 11995245 - 11995213
Alignment:
61 tgttaacgagtgcccctggggcactctttaagg 93  Q
    |||||||||||||||| ||||||||||||||||    
11995245 tgttaacgagtgcccccggggcactctttaagg 11995213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 103
Target Start/End: Original strand, 12002235 - 12002283
Alignment:
55 gagtcttgttaacgagtgcccctggggcactctttaaggatactaaatt 103  Q
    |||||||||||||||||  ||  ||||||||||||||| ||||||||||    
12002235 gagtcttgttaacgagtatcctcggggcactctttaagtatactaaatt 12002283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 131
Target Start/End: Complemental strand, 32959912 - 32959880
Alignment:
99 aaatttagaatatattttttaaaaaagtcaaat 131  Q
    ||||||| |||||||||||||||||||||||||    
32959912 aaatttaaaatatattttttaaaaaagtcaaat 32959880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 61 - 93
Target Start/End: Complemental strand, 41385400 - 41385368
Alignment:
61 tgttaacgagtgcccctggggcactctttaagg 93  Q
    |||||||||||||||| ||||||||||||||||    
41385400 tgttaacgagtgcccccggggcactctttaagg 41385368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 85 - 179
Target Start/End: Original strand, 15588653 - 15588747
Alignment:
85 tctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacacgatttttcataaaaacttac 179  Q
    ||||||||||||  ||||||| || ||||| ||||||||| | |||| ||| |||||  |||| ||||||||||  |||||||||||||||||||    
15588653 tctttaaggatatcaaatttataaaatattctttaaaaaaattaaatgttacaaatttcaatgcattgattacataatttttcataaaaacttac 15588747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 57 - 173
Target Start/End: Original strand, 35229262 - 35229378
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgatta 156  Q
    |||||||||||||||||||| ||| |||||||||||||  | ||||||||    |||| ||| ||||||||| |||||| |||||| |||  |||||  |    
35229262 gtcttgttaacgagtgcccccgggacactctttaaggaacccaaatttagcgattattctttcaaaaagtcacatattacaaattccaatacattgaaca 35229361  T
157 cacgatttttcataaaa 173  Q
    ||| | |||||||||||    
35229362 cacaacttttcataaaa 35229378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 82 - 179
Target Start/End: Complemental strand, 6555149 - 6555052
Alignment:
82 cactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgattacac-gatttttcataaaaacttac 179  Q
    ||||||||||  || ||||||||||||  ||||  ||||||||||||||| |||||||||  |||| ||| ||||||| ||||||| ||||||||||||    
6555149 cactctttaaatattctaaatttagaaagtattccttaaaaaagtcaaatgttataaatttcaatgcattaattacactgattttt-ataaaaacttac 6555052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 103
Target Start/End: Complemental strand, 6586552 - 6586507
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatt 103  Q
    ||||||||||||| ||||| |||||||||||||||| ||||||||||    
6586552 gtcttgttaacgattgccc-tggggcactctttaagcatactaaatt 6586507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 135
Target Start/End: Original strand, 3766250 - 3766325
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatatta 135  Q
    ||||||||||||||||||||   ||||||||||||| || | |||||| |||  |||| ||| |||||||||| |||||    
3766250 gtcttgttaacgagtgcccc---ggcactctttaagcatcccaaatttggaaattattcttttaaaaagtcaattatta 3766325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 81 - 154
Target Start/End: Complemental strand, 354086 - 354014
Alignment:
81 gcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatattataaattctaatgtattgat 154  Q
    ||||||||||||||| | ||||||||||| | ||||||| ||||||||||||||| |||||  |||||| ||||    
354086 gcactctttaaggatcccaaatttagaatttttttttta-aaaagtcaaatattacaaattgcaatgtagtgat 354014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0246 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: scaffold0246
Description:

Target: scaffold0246; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 55 - 134
Target Start/End: Complemental strand, 18247 - 18168
Alignment:
55 gagtcttgttaacgagtgcccctggggcactctttaaggatactaaatttagaatatattttttaaaaaagtcaaatatt 134  Q
    ||||||||| |||||||||| ||||| |||||||||||||| |||||   ||||  ||| |  |||||||||||||||||    
18247 gagtcttgtaaacgagtgcctctgggacactctttaaggatgctaaaagaagaaattatgtcataaaaaagtcaaatatt 18168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0182 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0182
Description:

Target: scaffold0182; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 95
Target Start/End: Original strand, 19660 - 19698
Alignment:
57 gtcttgttaacgagtgcccctggggcactctttaaggat 95  Q
    ||||||||||||||||||| | |||||||||||||||||    
19660 gtcttgttaacgagtgcccttagggcactctttaaggat 19698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC