View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9312-LTR4-TNT-insertion-4 (Length: 367)

Name: F9312-LTR4-TNT-insertion-4
Description: F9312-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9312-LTR4-TNT-insertion-4
[»] chr5 (15 HSPs)
chr5 (7-358)||(18637246-18637597)
chr5 (213-322)||(38845441-38845552)
chr5 (239-322)||(9818732-9818818)
chr5 (239-322)||(18851084-18851169)
chr5 (163-325)||(34250281-34250441)
chr5 (263-346)||(39097220-39097303)
chr5 (188-322)||(6951257-6951392)
chr5 (239-322)||(11648080-11648163)
chr5 (239-325)||(42858103-42858191)
chr5 (165-224)||(34454045-34454104)
chr5 (137-194)||(9818861-9818918)
chr5 (137-234)||(36927588-36927685)
chr5 (211-322)||(13171735-13171848)
chr5 (302-346)||(25548474-25548518)
chr5 (302-346)||(39229146-39229190)
[»] chr6 (33 HSPs)
chr6 (178-324)||(765327-765475)
chr6 (157-295)||(34910972-34911106)
chr6 (211-322)||(4910906-4911018)
chr6 (240-324)||(30927039-30927120)
chr6 (166-294)||(34620912-34621041)
chr6 (166-294)||(34748349-34748478)
chr6 (163-293)||(1485073-1485204)
chr6 (211-325)||(3482041-3482156)
chr6 (261-357)||(957649-957745)
chr6 (239-295)||(17225877-17225935)
chr6 (161-294)||(434161-434296)
chr6 (178-295)||(46230-46350)
chr6 (239-324)||(26280601-26280688)
chr6 (180-294)||(25195876-25195989)
chr6 (239-293)||(947594-947648)
chr6 (261-322)||(5724656-5724717)
chr6 (269-346)||(6895984-6896061)
chr6 (314-346)||(18690628-18690660)
chr6 (161-204)||(6208060-6208103)
chr6 (315-346)||(7280446-7280477)
chr6 (166-229)||(28466914-28466977)
chr6 (166-229)||(34736756-34736819)
chr6 (264-322)||(2234513-2234571)
chr6 (249-324)||(6654102-6654179)
chr6 (239-322)||(16540105-16540190)
chr6 (165-234)||(882773-882842)
chr6 (163-204)||(19601379-19601420)
chr6 (264-293)||(34027446-34027475)
chr6 (211-291)||(6653843-6653926)
chr6 (156-204)||(10400661-10400709)
chr6 (265-293)||(10874521-10874549)
chr6 (211-323)||(25195341-25195452)
chr6 (168-204)||(34026417-34026453)
[»] chr2 (20 HSPs)
chr2 (211-357)||(43501088-43501233)
chr2 (264-322)||(42740975-42741033)
chr2 (189-291)||(33502266-33502366)
chr2 (167-322)||(30503207-30503361)
chr2 (169-295)||(4894090-4894217)
chr2 (190-324)||(16518775-16518909)
chr2 (163-229)||(7632521-7632587)
chr2 (211-293)||(22536025-22536108)
chr2 (211-325)||(33019131-33019246)
chr2 (209-325)||(12037056-12037172)
chr2 (315-346)||(7630372-7630403)
chr2 (261-320)||(42982544-42982603)
chr2 (261-319)||(2002721-2002779)
chr2 (287-357)||(7632640-7632710)
chr2 (239-285)||(15928460-15928506)
chr2 (194-324)||(44439249-44439381)
chr2 (140-185)||(11650661-11650706)
chr2 (162-234)||(3853940-3854012)
chr2 (137-185)||(11759746-11759794)
chr2 (137-185)||(37745785-37745833)
[»] chr7 (15 HSPs)
chr7 (162-336)||(45557349-45557524)
chr7 (160-357)||(17111820-17112006)
chr7 (168-346)||(38123598-38123777)
chr7 (178-324)||(40491574-40491721)
chr7 (240-324)||(41386818-41386904)
chr7 (165-234)||(40561687-40561756)
chr7 (264-322)||(30182325-30182383)
chr7 (137-234)||(29842173-29842268)
chr7 (163-234)||(29829296-29829367)
chr7 (163-234)||(33853411-33853482)
chr7 (164-205)||(36270832-36270873)
chr7 (239-324)||(597948-598034)
chr7 (165-229)||(15050385-15050449)
chr7 (139-187)||(40491726-40491774)
chr7 (305-357)||(48159006-48159058)
[»] chr8 (27 HSPs)
chr8 (245-358)||(15677823-15677939)
chr8 (178-320)||(32927892-32928035)
chr8 (239-322)||(38868496-38868581)
chr8 (261-344)||(32994268-32994351)
chr8 (191-355)||(38335816-38335981)
chr8 (239-322)||(13384656-13384741)
chr8 (178-325)||(26100088-26100236)
chr8 (178-320)||(35494990-35495133)
chr8 (246-323)||(4662912-4662991)
chr8 (269-325)||(7244635-7244691)
chr8 (246-346)||(18355859-18355959)
chr8 (160-311)||(32767396-32767548)
chr8 (178-283)||(18356031-18356135)
chr8 (178-343)||(30098887-30099051)
chr8 (168-224)||(7720282-7720338)
chr8 (211-324)||(37684401-37684515)
chr8 (177-295)||(16972005-16972124)
chr8 (161-229)||(3619066-3619133)
chr8 (315-346)||(7533753-7533784)
chr8 (246-322)||(44141059-44141137)
chr8 (239-322)||(6027051-6027136)
chr8 (255-324)||(36200154-36200221)
chr8 (267-307)||(75533-75573)
chr8 (161-205)||(8130101-8130145)
chr8 (137-185)||(20505402-20505449)
chr8 (161-205)||(24297589-24297633)
chr8 (161-229)||(41289055-41289123)
[»] chr1 (27 HSPs)
chr1 (178-312)||(7524121-7524256)
chr1 (239-357)||(11049213-11049333)
chr1 (211-319)||(30557505-30557612)
chr1 (163-340)||(28287260-28287441)
chr1 (239-325)||(6021799-6021887)
chr1 (263-304)||(15084623-15084664)
chr1 (163-322)||(48548943-48549099)
chr1 (161-290)||(47053436-47053571)
chr1 (215-322)||(1514341-1514449)
chr1 (238-325)||(7790643-7790732)
chr1 (161-295)||(34915091-34915226)
chr1 (211-324)||(2099662-2099777)
chr1 (239-322)||(3416078-3416163)
chr1 (215-322)||(28083867-28083975)
chr1 (263-312)||(51500862-51500911)
chr1 (247-324)||(30996038-30996117)
chr1 (116-228)||(47978314-47978426)
chr1 (165-204)||(6932113-6932152)
chr1 (265-312)||(27849147-27849194)
chr1 (165-224)||(47725162-47725221)
chr1 (165-224)||(47732154-47732213)
chr1 (263-295)||(3016187-3016219)
chr1 (137-209)||(14644833-14644905)
chr1 (140-224)||(15986125-15986209)
chr1 (239-295)||(26373546-26373601)
chr1 (267-295)||(31362237-31362265)
chr1 (137-185)||(47899403-47899451)
[»] chr4 (23 HSPs)
chr4 (160-322)||(8604543-8604709)
chr4 (211-324)||(21691187-21691301)
chr4 (218-324)||(32818352-32818459)
chr4 (137-234)||(33843798-33843895)
chr4 (249-324)||(9134606-9134681)
chr4 (239-357)||(1616354-1616473)
chr4 (239-311)||(16551966-16552038)
chr4 (261-325)||(30357507-30357571)
chr4 (211-295)||(39733615-39733698)
chr4 (211-291)||(35065092-35065173)
chr4 (155-187)||(45694730-45694762)
chr4 (244-317)||(49138770-49138845)
chr4 (252-324)||(55186979-55187051)
chr4 (171-229)||(20712749-20712807)
chr4 (261-295)||(45011899-45011933)
chr4 (264-293)||(4243414-4243443)
chr4 (160-197)||(7946704-7946741)
chr4 (267-324)||(14596685-14596742)
chr4 (263-323)||(30357644-30357704)
chr4 (239-295)||(33456399-33456455)
chr4 (161-229)||(36150625-36150693)
chr4 (261-297)||(37566247-37566283)
chr4 (272-324)||(55927807-55927859)
[»] chr3 (18 HSPs)
chr3 (162-253)||(14022042-14022132)
chr3 (163-293)||(35058388-35058512)
chr3 (178-293)||(35264353-35264469)
chr3 (189-295)||(31708192-31708299)
chr3 (163-293)||(46853461-46853592)
chr3 (163-295)||(5406931-5407058)
chr3 (164-217)||(46018693-46018746)
chr3 (178-295)||(37334976-37335094)
chr3 (249-357)||(42375488-42375596)
chr3 (249-357)||(42404202-42404310)
chr3 (271-345)||(21367137-21367211)
chr3 (261-295)||(32523366-32523400)
chr3 (263-325)||(47356273-47356335)
chr3 (197-295)||(41596110-41596209)
chr3 (178-234)||(1441349-1441405)
chr3 (263-295)||(44771719-44771751)
chr3 (239-324)||(52364047-52364134)
chr3 (314-346)||(54596774-54596806)
[»] scaffold0005 (1 HSPs)
scaffold0005 (267-324)||(220636-220693)
[»] scaffold0360 (1 HSPs)
scaffold0360 (314-346)||(13288-13320)

Alignment Details
Target: chr5 (Bit Score: 352; Significance: 0; HSPs: 15)
Name: chr5

Target: chr5; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 7 - 358
Target Start/End: Complemental strand, 18637597 - 18637246
7 atttattatagcttaaacgcttgtcatcacttatatcagttttaatttgaaacaatctcggctgaggtcagttactacgtgacaatgttacaagttactg 106  Q
18637597 atttattatagcttaaacgcttgtcatcacttatatcagttttaatttgaaacaatctcggctgaggtcagttactacgtgacaatgttacaagttactg 18637498  T
107 agctgtggcctgtttggatatacgactcactgtatgttttgttttgagttgaaaagaattgattttgagtgaattgattctaactaaaagtgagttgaga 206  Q
18637497 agctgtggcctgtttggatatacgactcactgtatgttttgttttgagttgaaaagaattgattttgagtgaattgattctaactaaaagtgagttgaga 18637398  T
207 gtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagct 306  Q
18637397 gtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagct 18637298  T
307 tcaagtggaatcaattctacttgaaagcaaccaaacatgtaggaatcaattg 358  Q
18637297 tcaagtggaatcaattctacttgaaagcaaccaaacatgtaggaatcaattg 18637246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 213 - 322
Target Start/End: Complemental strand, 38845552 - 38845441
213 tgatttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaa 310  Q
    ||||||||||||||||| |||| | | |||| |||||| ||||||| ||  |||||| |||||||||||||||||||||| ||||  |||||||||||||    
38845552 tgatttgtgtttggatatattcatgtaaaaagtgagtttaactatatatttgtgtgtgaaaatcaattctagaatcaaaaactacaaatcttagcttcaa 38845453  T
311 gtggaatcaatt 322  Q
    || |||||||||    
38845452 gtagaatcaatt 38845441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 239 - 322
Target Start/End: Complemental strand, 9818818 - 9818732
239 taaaattgagttgaactataaatgtgtgt---aaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    ||||| ||||||||||||||||| |||||   ||||||||||||||||||||||||||||  ||| ||||||||||| |||||||||    
9818818 taaaagtgagttgaactataaatttgtgtttaaaaaatcaattctagaatcaaaagctacaaatcatagcttcaagtagaatcaatt 9818732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 239 - 322
Target Start/End: Original strand, 18851084 - 18851169
239 taaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    ||||| |||||| ||||||||||  |||||| ||||||||||||| |||||||||||||  ||| ||||||||||| |||||||||    
18851084 taaaagtgagtttaactataaatatgtgtgtgaaaatcaattctataatcaaaagctacaaatcatagcttcaagtagaatcaatt 18851169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 325
Target Start/End: Original strand, 34250281 - 34250441
163 aattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatg 262  Q
    ||||||||||||||||||||||| | |||| || ||||||||   || |||||||| |||||||| | ||||   | |||| | |||||||| | ||||     
34250281 aattgattttgagtgaattgattttgactataattgagttgaagctaaagtgatttatgtttggaaacattc--ataaaaagtaagttgaacaaaaaatt 34250378  T
263 tgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattcta 325  Q
    ||||| |||| ||||| ||||||||||||||||   |  |||| |||||| ||||||||||||    
34250379 tgtgtgaaaaacaattgtagaatcaaaagctacaatttctagcatcaagtagaatcaattcta 34250441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 263 - 346
Target Start/End: Complemental strand, 39097303 - 39097220
263 tgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatgt 346  Q
    ||||| |||||||||| || ||| ||||| |||  || |||||||||||| ||||||||||||| ||||| |||||||||||||    
39097303 tgtgtgaaaatcaattatataattaaaagttacaaattttagcttcaagtagaatcaattctacctgaaaccaaccaaacatgt 39097220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 188 - 322
Target Start/End: Original strand, 6951257 - 6951392
188 aactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgt--gtgtaaaaatcaattctagaat 285  Q
    |||||||||||||| || |||| | ||| |||| |||||||| |||| | | |||| ||| ||||| ||||||| |  ||||| ||||||||| ||||||    
6951257 aactaaaagtgagtcgaaagtaaaatgacttgtatttggataaattcatgt-aaaagtgaattgaattataaatttatgtgtacaaatcaattatagaat 6951355  T
286 caaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    ||||||||||  ||| || |||||||| |||||||||    
6951356 caaaagctacaaatcctaacttcaagtagaatcaatt 6951392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 239 - 322
Target Start/End: Complemental strand, 11648163 - 11648080
239 taaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    ||||||||||||||| ||||   |||||| |||||||||| || ||||||||  |||  ||||||||||||||| |||||||||    
11648163 taaaattgagttgaattatattcgtgtgtgaaaatcaattttataatcaaaatgtacaaatcttagcttcaagtagaatcaatt 11648080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 239 - 325
Target Start/End: Complemental strand, 42858191 - 42858103
239 taaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattcta 325  Q
    ||||| |||||||||||||||||  |||||| |||||||||| |||||| ||||||| |  ||| || ||||||||  |||||||||||    
42858191 taaaagtgagttgaactataaatttgtgtgtgaaaatcaattatagaattaaaagctccaaatcctaacttcaagtaaaatcaattcta 42858103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 165 - 224
Target Start/End: Original strand, 34454045 - 34454104
165 ttgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgttt 224  Q
    |||||||||| |||||||||||| ||||||||||||||| | ||  | ||||||||||||    
34454045 ttgattttgaatgaattgattctgactaaaagtgagttgcgggtggattgatttgtgttt 34454104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 137 - 194
Target Start/End: Complemental strand, 9818918 - 9818861
137 tgtatgttttgttttgagttgaaaagaattgattttgagtgaattgattctaactaaa 194  Q
    ||||||||| ||| || | ||| ||||||| |||||||||||||||||||| ||||||    
9818918 tgtatgtttggttctgcggtgacaagaatttattttgagtgaattgattcttactaaa 9818861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 137 - 234
Target Start/End: Original strand, 36927588 - 36927685
137 tgtatgttttgttttgagttgaaaagaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattc 234  Q
    ||||||||| ||||||  |||| || |||||||||||| |||||||||||| ||| ||   ||| |||  ||| |||||||| |||||||||| ||||    
36927588 tgtatgtttggttttgcattgagaaaaattgattttgactgaattgattctgactgaattagagatgatggtaaagtgatttatgtttggatacattc 36927685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 211 - 322
Target Start/End: Original strand, 13171735 - 13171848
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgt---aaaaatcaattctagaatcaaaagctacttatcttagctt 307  Q
    |||||||| | |||||||| ||| ||| |||||||||||| |||||||||| | |||   |||||||| || |||||||||||  |||  |||||  |||    
13171735 agtgatttttatttggataaatt-tttgtaaaattgagtttaactataaatttttgtatgaaaaatcatttatagaatcaaaatttacaaatcttttctt 13171833  T
308 caagtggaatcaatt 322  Q
    ||||| |||||||||    
13171834 caagtagaatcaatt 13171848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 302 - 346
Target Start/End: Complemental strand, 25548518 - 25548474
302 tagcttcaagtggaatcaattctacttgaaagcaaccaaacatgt 346  Q
    ||||||||||| ||||||||| ||||| ||||||| |||||||||    
25548518 tagcttcaagtagaatcaattttacttaaaagcaatcaaacatgt 25548474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 302 - 346
Target Start/End: Complemental strand, 39229190 - 39229146
302 tagcttcaagtggaatcaattctacttgaaagcaaccaaacatgt 346  Q
    ||||||||||| ||||||||| |||||||||| || |||||||||    
39229190 tagcttcaagtagaatcaattttacttgaaagtaatcaaacatgt 39229146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 74; Significance: 7e-34; HSPs: 33)
Name: chr6

Target: chr6; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 178 - 324
Target Start/End: Original strand, 765327 - 765475
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattcttttt--aaaattgagttgaactataaatgtgtgtaaaaatca 275  Q
    |||||||||||||||||||| |||||| |||| ||||||||||||||  ||| |||||| ||  |||| ||||||||||||||||| | | ||| |||||    
765327 aattgattctaactaaaagtaagttgaaagtaaagtgatttgtgtttccatacattcttcttgtaaaaatgagttgaactataaatttctttaataatca 765426  T
276 attctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    ||||||||||||||||||||  ||| ||||||||||| |||||||||||    
765427 attctagaatcaaaagctacaaatcatagcttcaagtagaatcaattct 765475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 157 - 295
Target Start/End: Complemental strand, 34911106 - 34910972
157 gaaaagaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaacta 256  Q
    ||||| ||||||||||||||||||||||||  ||||||||||||||||  ||| |||||||| |||||||||  ||||  | ||||| | |||| |||||    
34911106 gaaaataattgattttgagtgaattgattccgactaaaagtgagttgaaggta-agtgatttatgtttggat--attc-atgtaaaagttagttaaacta 34911011  T
257 taaatgtgtgtaaaaatcaattctagaatcaaaagctac 295  Q
    ||| ||||||| |||||||||||||||||||||||||||    
34911010 taattgtgtgtcaaaatcaattctagaatcaaaagctac 34910972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 211 - 322
Target Start/End: Complemental strand, 4911018 - 4910906
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgt--gtaaaaatcaattctagaatcaaaagctacttatcttagcttc 308  Q
    |||||||| |||||||||| ||| | | ||||| ||||| ||||||||||| |||  || |||||||||||||||||||||||||||  ||| |||||||    
4911018 agtgatttatgtttggatacatt-tatgtaaaagtgagtcgaactataaatttgtatgtgaaaatcaattctagaatcaaaagctacaaatcatagcttc 4910920  T
309 aagtggaatcaatt 322  Q
    |||| |||||||||    
4910919 aagtagaatcaatt 4910906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 240 - 324
Target Start/End: Complemental strand, 30927120 - 30927039
240 aaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    |||| |||||||||||||   ||||||||||||||||||||| |||||||||||||  |||||||||||||||  ||||||||||    
30927120 aaaagtgagttgaactat---tgtgtgtaaaaatcaattctataatcaaaagctacgaatcttagcttcaagtataatcaattct 30927039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 166 - 294
Target Start/End: Complemental strand, 34621041 - 34620912
166 tgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgt-- 263  Q
    ||||||||||||||| ||||||  ||| || ||||||||  ||| |||||||| |||||||||| ||| | | ||||| |||||||||  |||||| |      
34621041 tgattttgagtgaatggattctggctagaattgagttgaaggtaaagtgatttatgtttggatacatt-tatgtaaaagtgagttgaaaaataaatttta 34620943  T
264 gtgtaaaaatcaattctagaatcaaaagcta 294  Q
    |||||||||||||||||||||||| ||||||    
34620942 gtgtaaaaatcaattctagaatcagaagcta 34620912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 166 - 294
Target Start/End: Complemental strand, 34748478 - 34748349
166 tgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgt-- 263  Q
    ||||||||||||||| ||||||  ||| || ||||||||  ||| |||||||| |||||||||| ||| | | ||||| |||||||||  |||||| |      
34748478 tgattttgagtgaatggattctggctagaattgagttgaaggtaaagtgatttatgtttggatacatt-tatgtaaaagtgagttgaaaaataaatttta 34748380  T
264 gtgtaaaaatcaattctagaatcaaaagcta 294  Q
    |||||||||||||||||||||||| ||||||    
34748379 gtgtaaaaatcaattctagaatcagaagcta 34748349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 163 - 293
Target Start/End: Original strand, 1485073 - 1485204
163 aattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaa-- 260  Q
    ||||| |||| | ||||||||||||| ||||||||||||| | |||  ||||||||  ||||||||| | | | | ||||| |||||||||| |||||      
1485073 aattgttttttaatgaattgattctagctaaaagtgagtttaaagttgagtgatttacgtttggatacact-tatgtaaaagtgagttgaacaataaatt 1485171  T
261 tgtgtgtaaaaatcaattctagaatcaaaagct 293  Q
    || |||| |||||||||||||||||||||||||    
1485172 tgagtgttaaaatcaattctagaatcaaaagct 1485204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 211 - 325
Target Start/End: Complemental strand, 3482156 - 3482041
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaa--tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttc 308  Q
    ||||||||||||||| ||| |||| | | |||| | ||||||||||||||  ||||||| ||||||||||||| ||||||| |||||  |||||| ||||    
3482156 agtgatttgtgtttgaatacattcatgt-aaaagtaagttgaactataaacttgtgtgtgaaaatcaattctaaaatcaaaggctacaaatcttaacttc 3482058  T
309 aagtggaatcaattcta 325  Q
    ||||  |||||||||||    
3482057 aagtataatcaattcta 3482041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 261 - 357
Target Start/End: Original strand, 957649 - 957745
261 tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatgtaggaatcaatt 357  Q
    |||||||||||||| ||| | ||||||||| |||   ||||||||| |||||  ||||||||||||| |||||||| ||||||||| | ||||||||    
957649 tgtgtgtaaaaatcgattatggaatcaaaaactataaatcttagctacaagtaaaatcaattctactcgaaagcaatcaaacatgtcgtaatcaatt 957745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 239 - 295
Target Start/End: Complemental strand, 17225935 - 17225877
239 taaaattgagttgaactataaatgtgt--gtaaaaatcaattctagaatcaaaagctac 295  Q
    ||||| ||||||||||||||||| |||  ||||||||||||||||||||||||||||||    
17225935 taaaactgagttgaactataaatttgtatgtaaaaatcaattctagaatcaaaagctac 17225877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 161 - 294
Target Start/End: Original strand, 434161 - 434296
161 agaattgattttgagt-gaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataa 259  Q
    |||||||||||||||| |||| |||| |  ||||||||||||||   ||| | ||||||||||||||||| |||| | | |||| ||||||||| | |||    
434161 agaattgattttgagttgaatggattatggctaaaagtgagttgcaggtaaaatgatttgtgtttggatatattcgtgt-aaaagtgagttgaaatttaa 434259  T
260 atgtgtgta--aaaatcaattctagaatcaaaagcta 294  Q
    || | ||||  ||||||||||||| ||||||||||||    
434260 atttatgtataaaaatcaattctaaaatcaaaagcta 434296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 178 - 295
Target Start/End: Original strand, 46230 - 46350
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaa----tgtgtgtaaaaat 273  Q
    ||||||||||||||||||||||||||  | || ||| ||||||||||||||| ||||  |  |||| ||||||||| ||||||    ||| ||| | |||    
46230 aattgattctaactaaaagtgagttgcaattaaagttatttgtgtttggatacattc-gtggaaaagtgagttgaattataaaaatttgtttgttagaat 46328  T
274 caattctagaatcaaaagctac 295  Q
    | ||||||||||||||||||||    
46329 ctattctagaatcaaaagctac 46350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 239 - 324
Target Start/End: Complemental strand, 26280688 - 26280601
239 taaaattgagttgaactataaatgtgt--gtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    ||||| |||||| |||||||||| |||  ||||||||||||| | ||||||||| ||||  ||  |||||||||||||||||||||||    
26280688 taaaagtgagtttaactataaatttgtacgtaaaaatcaattttggaatcaaaaactacaaattctagcttcaagtggaatcaattct 26280601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 180 - 294
Target Start/End: Complemental strand, 25195989 - 25195876
180 ttgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatcaat 277  Q
    ||||||| |||||||| ||||||||| | | |||  |||||||||||||| |||  | |   || |||||||||||||||||  ||||||| || |||||    
25195989 ttgattccaactaaaaatgagttgagggcaaagttgtttgtgtttggatacatttatgt---aagtgagttgaactataaatttgtgtgtacaattcaat 25195893  T
278 tctagaatcaaaagcta 294  Q
25195892 tctagaatcaaaagcta 25195876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 239 - 293
Target Start/End: Complemental strand, 947648 - 947594
239 taaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagct 293  Q
    ||||| ||||||||| ||||| ||||| ||| |||||||||||||||||||||||    
947648 taaaagtgagttgaattataattgtgtttaagaatcaattctagaatcaaaagct 947594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 261 - 322
Target Start/End: Original strand, 5724656 - 5724717
261 tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    |||||||||||||||||| |||||| ||||| |||  ||| ||||||||||| |||||||||    
5724656 tgtgtgtaaaaatcaattatagaataaaaagttacaaatcctagcttcaagtagaatcaatt 5724717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 346
Target Start/End: Original strand, 6895984 - 6896061
269 aaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatgt 346  Q
    ||||| |||||||||||||||||||||  ||| || ||||| || ||||||||| |||| || | |||||||||||||    
6895984 aaaataaattctagaatcaaaagctacaaatcctaacttcaggtagaatcaattgtactcgacaacaaccaaacatgt 6896061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 314 - 346
Target Start/End: Complemental strand, 18690660 - 18690628
314 gaatcaattctacttgaaagcaaccaaacatgt 346  Q
18690660 gaatcaattctacttgaaagcaaccaaacatgt 18690628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 161 - 204
Target Start/End: Original strand, 6208060 - 6208103
161 agaattgattttgagtgaattgattctaactaaaagtgagttga 204  Q
    ||||||||||||||||||||||||| | | ||||||||||||||    
6208060 agaattgattttgagtgaattgattttgattaaaagtgagttga 6208103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 315 - 346
Target Start/End: Complemental strand, 7280477 - 7280446
315 aatcaattctacttgaaagcaaccaaacatgt 346  Q
7280477 aatcaattctacttgaaagcaaccaaacatgt 7280446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 166 - 229
Target Start/End: Original strand, 28466914 - 28466977
166 tgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggata 229  Q
    ||||||||||||||||||||||  |||||| ||||||||  ||| |||| ||| ||||||||||    
28466914 tgattttgagtgaattgattctggctaaaattgagttgaaggtatagtggtttatgtttggata 28466977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 166 - 229
Target Start/End: Complemental strand, 34736819 - 34736756
166 tgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggata 229  Q
    ||||||||||||||||||||||  |||||| ||||||||  ||| |||| ||| ||||||||||    
34736819 tgattttgagtgaattgattctggctaaaattgagttgaaggtatagtggtttatgtttggata 34736756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 264 - 322
Target Start/End: Complemental strand, 2234571 - 2234513
264 gtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    |||| ||||||||||||||||||||||||| |   | |||||||||||| |||||||||    
2234571 gtgttaaaatcaattctagaatcaaaagcttcagtttttagcttcaagttgaatcaatt 2234513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 249 - 324
Target Start/End: Original strand, 6654102 - 6654179
249 ttgaactataaatgt--gtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    ||||||||||||| |  |||| |||||||| |||||||| |||||||||  ||| ||||||||||| |||| ||||||    
6654102 ttgaactataaatttctgtgtgaaaatcaaatctagaattaaaagctacaaatcctagcttcaagtagaattaattct 6654179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 239 - 322
Target Start/End: Complemental strand, 16540190 - 16540105
239 taaaattgagttgaactataaatgtgt--gtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    ||||| |||||| |||||||||| |||  || ||| ||||||| | |||||||||||||  ||| ||||||||||| |||||||||    
16540190 taaaagtgagtttaactataaatatgtaagtgaaactcaattcaataatcaaaagctacaaatcctagcttcaagtagaatcaatt 16540105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 234
Target Start/End: Complemental strand, 882842 - 882773
165 ttgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattc 234  Q
    |||| |||||||||||||||||||  ||||| ||||||||  ||| | |||||| |||||||||| ||||    
882842 ttgagtttgagtgaattgattctagttaaaattgagttgaaggtaaaatgatttatgtttggatacattc 882773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 19601379 - 19601420
163 aattgattttgagtgaattgattctaactaaaagtgagttga 204  Q
    |||||||||||| |||||||||| ||||||| ||||||||||    
19601379 aattgattttgattgaattgattttaactaatagtgagttga 19601420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 264 - 293
Target Start/End: Original strand, 34027446 - 34027475
264 gtgtaaaaatcaattctagaatcaaaagct 293  Q
34027446 gtgtaaaaatcaattctagaatcaaaagct 34027475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 211 - 291
Target Start/End: Complemental strand, 6653926 - 6653843
211 agtgatttgtgtttggatagattctttt-taaaattgagttgaactataaatgtg--tgtaaaaatcaattctagaatcaaaag 291  Q
    ||||||||||||||||||| | || | | ||||| |||||| |||||||||| ||  ||| ||| |||||||||||||||||||    
6653926 agtgatttgtgtttggatacaatcatatgtaaaagtgagttaaactataaatttgcatgtgaaactcaattctagaatcaaaag 6653843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 156 - 204
Target Start/End: Original strand, 10400661 - 10400709
156 tgaaaagaattgattttgagtgaattgattctaactaaaagtgagttga 204  Q
    |||||||||||||||||||||||| ||||||   |||| ||||||||||    
10400661 tgaaaagaattgattttgagtgaactgattccgtctaagagtgagttga 10400709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 265 - 293
Target Start/End: Complemental strand, 10874549 - 10874521
265 tgtaaaaatcaattctagaatcaaaagct 293  Q
10874549 tgtaaaaatcaattctagaatcaaaagct 10874521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 211 - 323
Target Start/End: Original strand, 25195341 - 25195452
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgta--aaaatcaattctagaatcaaaagctacttatcttagcttc 308  Q
    ||||||||||||||||||| ||| | | ||||| ||||||||| | ||||| ||||||  |||||||||| |||||| |||| ||||  |||   |||||    
25195341 agtgatttgtgtttggatacatt-tatgtaaaagtgagttgaattgtaaatttgtgtatgaaaatcaattatagaatgaaaaactacaaatc--cgcttc 25195437  T
309 aagtggaatcaattc 323  Q
    |||| ||||||||||    
25195438 aagtagaatcaattc 25195452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 168 - 204
Target Start/End: Original strand, 34026417 - 34026453
168 attttgagtgaattgattctaactaaaagtgagttga 204  Q
    ||||||||||||||||||||  |||||||||||||||    
34026417 attttgagtgaattgattctggctaaaagtgagttga 34026453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 67; Significance: 1e-29; HSPs: 20)
Name: chr2

Target: chr2; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 211 - 357
Target Start/End: Complemental strand, 43501233 - 43501088
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaa 310  Q
    ||||||||||||||| ||| |||| | | |||| ||||||||| ||||| | ||||| | ||||||||||| |||||||||||||  ||| ||| |||||    
43501233 agtgatttgtgtttgtatacattcatgt-aaaactgagttgaattataattttgtgttagaatcaattctaaaatcaaaagctacaaatcctagtttcaa 43501135  T
311 gtggaatcaattctacttgaaagcaaccaaacatgtaggaatcaatt 357  Q
    || |||||||||||||||||||||||||||||||||  |||||||||    
43501134 gtagaatcaattctacttgaaagcaaccaaacatgtcagaatcaatt 43501088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 264 - 322
Target Start/End: Complemental strand, 42741033 - 42740975
264 gtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    ||||||||||||||||||||||||||||||||  ||||||||||||||| |||||||||    
42741033 gtgtaaaaatcaattctagaatcaaaagctacaaatcttagcttcaagtagaatcaatt 42740975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 189 - 291
Target Start/End: Complemental strand, 33502366 - 33502266
189 actaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataa--atgtgtgtaaaaatcaattctagaatc 286  Q
    ||||||||| ||||||  ||| |||||||||||||||||||    | || ||||| |||||||||||||||  ||||||||||||||||||| |||||||    
33502366 actaaaagtaagttgaatgtaaagtgatttgtgtttggata----cattgtaaaagtgagttgaactataaatatgtgtgtaaaaatcaattttagaatc 33502271  T
287 aaaag 291  Q
33502270 aaaag 33502266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 167 - 322
Target Start/End: Complemental strand, 30503361 - 30503207
167 gattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatg--tg 264  Q
    ||||||||||||||||||||| ||||||||| ||||||  ||| | |||||| ||||||||||   || | | ||||| ||||| || | |||||   ||    
30503361 gattttgagtgaattgattctgactaaaagttagttgaaggtaaactgatttttgtttggataa--tcgtgtaaaaat-gagttcaagtttaaattcatg 30503265  T
265 tgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    |||||||||||||||| ||||||||||||||  ||| | ||||||||| |||||||||    
30503264 tgtaaaaatcaattcttgaatcaaaagctacgaatcctggcttcaagtagaatcaatt 30503207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 169 - 295
Target Start/End: Original strand, 4894090 - 4894217
169 ttttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaa--tgtgtg 266  Q
    |||||||||||||||||||| |||||| | ||||||  ||| |||||||| ||||| |||| ||||  ||||||| ||| |||||  |||||  || ||     
4894090 ttttgagtgaattgattctagctaaaattaagttgaaggtaaagtgatttatgtttagatacattc-atttaaaagtgacttgaataataaatttgagta 4894188  T
267 taaaaatcaattctagaatcaaaagctac 295  Q
    ||| |||||||| ||||||||||||||||    
4894189 taataatcaattatagaatcaaaagctac 4894217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 190 - 324
Target Start/End: Complemental strand, 16518909 - 16518775
190 ctaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtg--taaaaatcaattctagaatca 287  Q
    |||||||||||||||| ||| | ||||||||||||||||| |||| | | |||| ||||||||||||||||| ||||  ||||| |||  | || |||||    
16518909 ctaaaagtgagttgagggtaaaatgatttgtgtttggatacattcatgt-aaaagtgagttgaactataaatttgtgcgtaaaagtcatct-tataatca 16518812  T
288 aaagctacttatcttagcttcaagtggaatcaattct 324  Q
    ||||||||  ||| || |||| ||| |||||||||||    
16518811 aaagctacaaatcctatcttctagtagaatcaattct 16518775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 229
Target Start/End: Original strand, 7632521 - 7632587
163 aattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggata 229  Q
    ||||||||||||||||||| ||||| | ||||||||| ||||  ||| |||||| ||||||||||||    
7632521 aattgattttgagtgaatttattctgattaaaagtgaattgaaggtaaagtgatatgtgtttggata 7632587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 211 - 293
Target Start/End: Complemental strand, 22536108 - 22536025
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgt--aaaaatcaattctagaatcaaaagct 293  Q
    ||||||||||||||||||| ||| | | ||||| |||||| |||||||||| |||||  |||||| ||||||| |||||||||||    
22536108 agtgatttgtgtttggatacatt-tatgtaaaaatgagtttaactataaatatgtgtgcaaaaattaattctaaaatcaaaagct 22536025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 211 - 325
Target Start/End: Original strand, 33019131 - 33019246
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgt--gtgtaaaaatcaattctagaatcaaaagctacttatcttagcttc 308  Q
    ||||||||||||||||||  |||| | | |||| ||||||||||||||||| |  |||| ||||||||||||| || ||||||||||  ||  |||||||    
33019131 agtgatttgtgtttggatgcattcatgt-aaaagtgagttgaactataaatttatgtgtgaaaatcaattctaaaaccaaaagctacaaattctagcttc 33019229  T
309 aagtggaatcaattcta 325  Q
    || |  |||||||||||    
33019230 aaatataatcaattcta 33019246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 209 - 325
Target Start/End: Complemental strand, 12037172 - 12037056
209 acagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgta--aaaatcaattctagaatcaaaagctacttatcttagct 306  Q
    |||||| ||||||||| |||| |||| | | ||||  ||||||||| |||||| ||| ||  |||||||||| ||||||||||||||||  || |||| |    
12037172 acagtggtttgtgtttcgataaattcatctaaaaa--gagttgaaccataaatttgtttatgaaaatcaattgtagaatcaaaagctacaaattttagtt 12037075  T
307 tcaagtggaatcaattcta 325  Q
    |||| | ||||||||||||    
12037074 tcaactagaatcaattcta 12037056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 315 - 346
Target Start/End: Complemental strand, 7630403 - 7630372
315 aatcaattctacttgaaagcaaccaaacatgt 346  Q
7630403 aatcaattctacttgaaagcaaccaaacatgt 7630372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 261 - 320
Target Start/End: Complemental strand, 42982603 - 42982544
261 tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaa 320  Q
    |||||||||||||||||||| ||||||||||||||   |  ||||||||||| |||||||    
42982603 tgtgtgtaaaaatcaattctggaatcaaaagctacaatttctagcttcaagtagaatcaa 42982544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 319
Target Start/End: Original strand, 2002721 - 2002779
261 tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatca 319  Q
    |||||||||||||||||| |||||| |||| ||||  ||| ||||||||||| ||||||    
2002721 tgtgtgtaaaaatcaattttagaatgaaaaactacaaatcctagcttcaagtagaatca 2002779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 287 - 357
Target Start/End: Original strand, 7632640 - 7632710
287 aaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatgtaggaatcaatt 357  Q
    |||||||||  || |||||||||||| | |||| ||||||| ||| |||| ||||||||| ||||||||||    
7632640 aaaagctacaaattttagcttcaagtaggatcagttctactcgaaggcaatcaaacatgttggaatcaatt 7632710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 239 - 285
Target Start/End: Original strand, 15928460 - 15928506
239 taaaattgagttgaactataaatgtgtgtaaaaatcaattctagaat 285  Q
    ||||| |||||| |||| ||||||||||||| |||||||||||||||    
15928460 taaaagtgagttaaactttaaatgtgtgtaagaatcaattctagaat 15928506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 194 - 324
Target Start/End: Complemental strand, 44439381 - 44439249
194 aagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtg--tgtaaaaatcaattctagaatcaaaag 291  Q
    ||||||||| |  ||| |||||||| ||||||||||  || | | ||||| |||||||||| |||||| ||  ||| |||||||||| ||||||||||||    
44439381 aagtgagttaaatgtaaagtgatttatgtttggatatgtt-tatgtaaaagtgagttgaacaataaatttgagtgttaaaatcaattttagaatcaaaag 44439283  T
292 ctacttatcttagcttcaag-tggaatcaattct 324  Q
    || |  || ||||||||||| | |||||||||||    
44439282 ctccaaattttagcttcaagttagaatcaattct 44439249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 140 - 185
Target Start/End: Original strand, 11650661 - 11650706
140 atgttttgttttgagttgaaaagaattgattttgagtgaattgatt 185  Q
    |||||| |||||| ||||| || |||||||||||||||||||||||    
11650661 atgtttggttttgcgttgacaaaaattgattttgagtgaattgatt 11650706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 162 - 234
Target Start/End: Complemental strand, 3854012 - 3853940
162 gaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattc 234  Q
    |||||||||||||  ||||||||| | | ||||||||||||||  ||| | |||||| |||||||||| ||||    
3854012 gaattgattttgatagaattgattttgattaaaagtgagttgaatgtaaattgatttatgtttggatacattc 3853940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 137 - 185
Target Start/End: Original strand, 11759746 - 11759794
137 tgtatgttttgttttgagttgaaaagaattgattttgagtgaattgatt 185  Q
    ||||||||| ||| |||| |||||| |||||| ||||||||||||||||    
11759746 tgtatgtttggttatgaggtgaaaaaaattgagtttgagtgaattgatt 11759794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 137 - 185
Target Start/End: Original strand, 37745785 - 37745833
137 tgtatgttttgttttgagttgaaaagaattgattttgagtgaattgatt 185  Q
    ||||||||| |||||| | ||| || |||||||||||||||||||||||    
37745785 tgtatgtttggttttgcggtgataataattgattttgagtgaattgatt 37745833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 66; Significance: 4e-29; HSPs: 15)
Name: chr7

Target: chr7; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 162 - 336
Target Start/End: Complemental strand, 45557524 - 45557349
162 gaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaa- 260  Q
    ||||||||||||| |||||||||||| ||||||||||||||||  ||| ||||||||||||||||||| ||||  | ||||| |||||||| ||| |||     
45557524 gaattgattttgaatgaattgattctgactaaaagtgagttgaaggtaaagtgatttgtgtttggatacattc-atgtaaaagtgagttgagctacaaat 45557426  T
261 -tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaa 336  Q
     ||||||||||||||||| ||||||| |||||||||  ||  ||||||| ||   |||||||||||||  |||||||    
45557425 ttgtgtgtaaaaatcaatcctagaattaaaagctacagattctagcttctagcaaaatcaattctactcaaaagcaa 45557349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 160 - 357
Target Start/End: Complemental strand, 17112006 - 17111820
160 aagaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataa 259  Q
    |||||||||||||||||||||||||| | ||||||| ||| |||   ||| ||||||||||||||||||  |||| | | ||||| |||| ||| |||||    
17112006 aagaattgattttgagtgaattgattttgactaaaattgaattgtaggtaaagtgatttgtgtttggatgcattcatgtaaaaat-gagtagaattataa 17111908  T
260 atgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatgtaggaatcaatt 357  Q
    || |||||  ||          ||||||||||||||  ||| ||||||||||| |||||||||||||| ||||||||||||||||||  |||||||||    
17111907 atttgtgtgtaa----------gaatcaaaagctacaaatcatagcttcaagtagaatcaattctactcgaaagcaaccaaacatgtcagaatcaatt 17111820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 168 - 346
Target Start/End: Original strand, 38123598 - 38123777
168 attttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtg--t 265  Q
    ||||||||| |||||||| | ||||||| ||||||||  ||| ||| ||||||||| ||| | |||| | | |||| |||||||| | |||||| ||  |    
38123598 attttgagtaaattgattatgactaaaattgagttgaaggtaaagtaatttgtgttcggacacattcatgt-aaaagtgagttgaccaataaatttgagt 38123696  T
266 gtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatgt 346  Q
    |||||||||||||||||||| | |||||||   |  ||||||||||| ||||||||||||||| | || ||||||||||||    
38123697 gtaaaaatcaattctagaattagaagctacaatttctagcttcaagtagaatcaattctactttataggaaccaaacatgt 38123777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 178 - 324
Target Start/End: Complemental strand, 40491721 - 40491574
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatca 275  Q
    |||||||| | ||||||||||||||||  ||| |||||||| | |||||||| |||| | | |||| |||||| |||| |||||  |||||||||| |||    
40491721 aattgattttgactaaaagtgagttgaaggtaaagtgatttatttttggatacattcatgt-aaaagtgagttaaactttaaatttgtgtgtaaaagtca 40491623  T
276 attctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    ||||||||||||||||||||  | |||| |||||||| || ||||||||    
40491622 attctagaatcaaaagctacaaaacttaacttcaagtagagtcaattct 40491574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 240 - 324
Target Start/End: Original strand, 41386818 - 41386904
240 aaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    |||| ||||||||| |||||||  ||||||||| |||||||||||||| |||||||||  ||| ||||||||||| |||||||||||    
41386818 aaaagtgagttgaattataaatttgtgtgtaaatatcaattctagaattaaaagctacaaatcctagcttcaagtagaatcaattct 41386904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 234
Target Start/End: Original strand, 40561687 - 40561756
165 ttgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattc 234  Q
    ||||||||||||||||||||||||   |||| |||||||| |||| |||||||| |||||||||| ||||    
40561687 ttgattttgagtgaattgattctagtaaaaattgagttgaaagtaaagtgatttatgtttggatacattc 40561756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 264 - 322
Target Start/End: Original strand, 30182325 - 30182383
264 gtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    |||||||||| |||||||||||||||||||||   | |||||||||||| |||||||||    
30182325 gtgtaaaaattaattctagaatcaaaagctacaatttttagcttcaagtagaatcaatt 30182383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 137 - 234
Target Start/End: Complemental strand, 29842268 - 29842173
137 tgtatgttttgttttgagttgaaaagaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattc 234  Q
    ||||||||| ||| || ||||| |||| ||| |||||||||| |||||| | ||||||| || |||||  ||| ||||||||||||||||||||||||    
29842268 tgtatgtttggttctgtgttgacaagacttggttttgagtga-ttgattttgactaaaa-tgggttgaaggtaaagtgatttgtgtttggatagattc 29842173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 163 - 234
Target Start/End: Original strand, 29829296 - 29829367
163 aattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattc 234  Q
    |||||||| ||| ||||||||||||  |||||| ||||||||  ||| |||||||| |||||||||| ||||    
29829296 aattgattctgaatgaattgattctggctaaaaatgagttgaatgtaaagtgatttatgtttggatacattc 29829367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 163 - 234
Target Start/End: Original strand, 33853411 - 33853482
163 aattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattc 234  Q
    |||||||||| ||||||||||||||  |||| ||||||||||   || |||||||| |||||||||| ||||    
33853411 aattgatttttagtgaattgattctggctaagagtgagttgaagctaaagtgatttatgtttggatacattc 33853482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 205
Target Start/End: Original strand, 36270832 - 36270873
164 attgattttgagtgaattgattctaactaaaagtgagttgag 205  Q
    ||||||||||| |||||||||| ||| |||||||||||||||    
36270832 attgattttgaatgaattgattttaattaaaagtgagttgag 36270873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 239 - 324
Target Start/End: Original strand, 597948 - 598034
239 taaaattgagttgaactataaatgt--gtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    ||||| |||||||||| |||||| |  ||| || |||||||| ||||||| ||||||||  || |||||||||||| |||||||||||    
597948 taaaagtgagttgaacaataaattttagtgcaagaatcaattatagaatcgaaagctaca-attttagcttcaagtagaatcaattct 598034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 165 - 229
Target Start/End: Complemental strand, 15050449 - 15050385
165 ttgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggata 229  Q
    |||||||||||| ||||||||||| |||||| ||| || || ||| ||| |||| ||||||||||    
15050449 ttgattttgagttaattgattctagctaaaaatgaatttagggtaaagtaatttatgtttggata 15050385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 139 - 187
Target Start/End: Complemental strand, 40491774 - 40491726
139 tatgttttgttttgagttgaaaagaattgattttgagtgaattgattct 187  Q
    ||||||| ||| || | ||| ||||||||||||||||||||||||||||    
40491774 tatgtttggttctgcggtgacaagaattgattttgagtgaattgattct 40491726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 305 - 357
Target Start/End: Original strand, 48159006 - 48159058
305 cttcaagtggaatcaattctacttgaaagcaaccaaacatgtaggaatcaatt 357  Q
    |||||| | |||||||||||||| |||||||||||||||| |  |||||||||    
48159006 cttcaaatcgaatcaattctactggaaagcaaccaaacatctgagaatcaatt 48159058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 63; Significance: 3e-27; HSPs: 27)
Name: chr8

Target: chr8; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 245 - 358
Target Start/End: Original strand, 15677823 - 15677939
245 tgagttgaactataaatgtgtgt---aaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaa 341  Q
    ||||||||||||||||| |||||   |||||||||||||| ||||||||||||   ||| ||||||||||| |||||||||||| |||||||||||||||    
15677823 tgagttgaactataaatttgtgtgtaaaaaatcaattctataatcaaaagctataaatcctagcttcaagtagaatcaattctatttgaaagcaaccaaa 15677922  T
342 catgtaggaatcaattg 358  Q
    |||||  ||||||||||    
15677923 catgtcagaatcaattg 15677939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 178 - 320
Target Start/End: Complemental strand, 32928035 - 32927892
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatca 275  Q
    |||||||||| ||||||| ||||||||  | | ||||||||||||||||||| |||| | | |||| |||||||||||||||||  |||||||||||| |    
32928035 aattgattcttactaaaattgagttgaaggcaaagtgatttgtgtttggatacattcatgt-aaaagtgagttgaactataaatttgtgtgtaaaaatga 32927937  T
276 attctagaatcaaaagctacttatcttagcttcaagtggaatcaa 320  Q
    |||||| |||||||||||||  ||| ||||||||||| |||||||    
32927936 attctataatcaaaagctacaaatcctagcttcaagtagaatcaa 32927892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 239 - 322
Target Start/End: Complemental strand, 38868581 - 38868496
239 taaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    |||||||||||||||||||||||  |||||| |||||||||| ||||| ||||||||||  ||||||||||||||| |||||||||    
38868581 taaaattgagttgaactataaatttgtgtgtgaaaatcaattatagaaccaaaagctacaaatcttagcttcaagtagaatcaatt 38868496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 261 - 344
Target Start/End: Original strand, 32994268 - 32994351
261 tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacat 344  Q
    ||||| ||||||||||||||||| ||||||||||   ||| ||||||||||| |||||||||||||  ||||||||||||||||    
32994268 tgtgtataaaaatcaattctagactcaaaagctagaaatcatagcttcaagtagaatcaattctacacgaaagcaaccaaacat 32994351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 191 - 355
Target Start/End: Original strand, 38335816 - 38335981
191 taaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtg--taaaaatcaattctagaatcaa 288  Q
    ||||||||||||||  ||  | ||||||||||| ||||| |||| | | |||| ||||||  | ||||||| ||||  ||||||||||||||| ||||||    
38335816 taaaagtgagttgaaggtgaattgatttgtgttcggatacattcatgt-aaaagtgagttagaatataaatttgtgcgtaaaaatcaattctaaaatcaa 38335914  T
289 aagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatgtaggaatcaa 355  Q
    |||| ||  ||||||||||||| ||||||||||| |||| |||| ||| |||||||||  |||||||    
38335915 aagcaacaaatcttagcttcaactggaatcaattatactcgaaaacaaacaaacatgtcagaatcaa 38335981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 239 - 322
Target Start/End: Original strand, 13384656 - 13384741
239 taaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    ||||| |||||||||||||||||  |||||| |||||||||||||||||||||||||||  || |||||||||| | |||||||||    
13384656 taaaagtgagttgaactataaatttgtgtgtgaaaatcaattctagaatcaaaagctacaaattttagcttcaaatagaatcaatt 13384741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 178 - 325
Target Start/End: Original strand, 26100088 - 26100236
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatca 275  Q
    |||||||||| |||||||  |||||||  ||| ||  ||||||||||||||  ||| | | ||||| |||||||||| ||||||  ||||||||||||||    
26100088 aattgattctgactaaaaacgagttgaaggtaaagctatttgtgtttggatgcatt-tatgtaaaagtgagttgaaccataaatttgtgtgtaaaaatca 26100186  T
276 attctagaatcaaaagctacttatcttagcttcaagtggaatcaattcta 325  Q
    ||| ||||||||||||||||  ||| ||||||||| | ||| ||||||||    
26100187 attatagaatcaaaagctacaaatcctagcttcaaatagaaccaattcta 26100236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 178 - 320
Target Start/End: Complemental strand, 35495133 - 35494990
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatca 275  Q
    ||||| |||| | |||||||| |||||   || ||||||||||||||||||| |||| | | |||| | |||||||||||| ||  ||||||||||| ||    
35495133 aattgcttctgattaaaagtgggttgaatataaagtgatttgtgtttggatatattcatgt-aaaagtaagttgaactatagatttgtgtgtaaaaaaca 35495035  T
276 attctagaatcaaaagctacttatcttagcttcaagtggaatcaa 320  Q
    ||||||||||||||||||||  ||| |||||||| || |||||||    
35495034 attctagaatcaaaagctacaaatcctagcttcatgtagaatcaa 35494990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 246 - 323
Target Start/End: Original strand, 4662912 - 4662991
246 gagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattc 323  Q
    ||||||||||||| ||  ||||||||||||||||||||||| ||||||||||  ||| ||||||||||| |||| |||||    
4662912 gagttgaactatacatttgtgtgtaaaaatcaattctagaaacaaaagctacaaatcctagcttcaagtagaataaattc 4662991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 269 - 325
Target Start/End: Original strand, 7244635 - 7244691
269 aaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattcta 325  Q
    |||||||||||||||||||||| |||| |||||||| ||||||| ||||||||||||    
7244635 aaaatcaattctagaatcaaaaactacatatcttagtttcaagtagaatcaattcta 7244691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 246 - 346
Target Start/End: Original strand, 18355859 - 18355959
246 gagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatg 345  Q
    |||||||||| ||||| |||||||||||||||| ||||||||||||  ||  ||| |||||||||   |||||||||||||| |||| ||| || |||||    
18355859 gagttgaactttaaatttgtgtaaaaatcaattttagaatcaaaagacacaaatcctagcttcaatcagaatcaattctactcgaaaacaatcatacatg 18355958  T
346 t 346  Q
18355959 t 18355959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 160 - 311
Target Start/End: Complemental strand, 32767548 - 32767396
160 aagaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttt-taaaattgagttgaactata 258  Q
    ||||||| |||||||||||||||||| |   |||||||||||||   ||| | |||||| |||||||||| |||| | | ||||| |||||||||| |||    
32767548 aagaattaattttgagtgaattgattatg--taaaagtgagttggatgtaaattgatttatgtttggatacattcatgtgtaaaagtgagttgaacaata 32767451  T
259 aatgt--gtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaag 311  Q
    ||| |  |||||||| ||| |||| |||||||||||||   ||||||||||||||    
32767450 aatttaagtgtaaaagtcagttctcgaatcaaaagctatgaatcttagcttcaag 32767396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 283
Target Start/End: Original strand, 18356031 - 18356135
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgtaaaaatcaat 277  Q
    |||||||||||||||||||||||||||  |||  | | ||| |||| ||||| ||| | | ||||  ||||||||| ||||||| |||||||||||||||    
18356031 aattgattctaactaaaagtgagttgaaggtaagggggtttatgttcggatacatt-tatctaaacgtgagttgaattataaatttgtgtaaaaatcaat 18356129  T
278 tctaga 283  Q
18356130 tctaga 18356135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 343
Target Start/End: Complemental strand, 30099051 - 30098887
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgtaaaaatcaat 277  Q
    |||||||||| || |||||||| | ||  ||| |||||||| || | ||||| ||| | | ||||| |||||| |||||||||| | ||||||||| |||    
30099051 aattgattctgaccaaaagtgaatagaatgtaaagtgatttatgatcggatatatt-tatgtaaaagtgagttaaactataaatttttgtaaaaattaat 30098953  T
278 tctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaaca 343  Q
    ||||||||| ||||||||  ||  ||||||||| |  |||||||| |||||||   ||||||||||    
30098952 tctagaatcgaaagctacaaattctagcttcaaataaaatcaattttacttgatcacaaccaaaca 30098887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 168 - 224
Target Start/End: Complemental strand, 7720338 - 7720282
168 attttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgttt 224  Q
    |||| ||||||||||||||| ||||||  ||||||||||||| ||||||||||||||    
7720338 atttcgagtgaattgattctgactaaatatgagttgagagtaaagtgatttgtgttt 7720282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 211 - 324
Target Start/End: Complemental strand, 37684515 - 37684401
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgta--aaaatcaattctagaatcaaaagctacttatcttagcttc 308  Q
    ||||||||||||||||||| ||| | | ||||| ||||||||| ||||||| | || |  |||||||||| ||||||||||||| ||  ||| || ||||    
37684515 agtgatttgtgtttggatacatt-tatgtaaaagtgagttgaattataaatttttgcattaaaatcaattttagaatcaaaagccacaaatcctaacttc 37684417  T
309 aagtggaatcaattct 324  Q
    |||| |||||||||||    
37684416 aagtagaatcaattct 37684401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 177 - 295
Target Start/End: Original strand, 16972005 - 16972124
177 gaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaa--tgtgtgtaaaaatc 274  Q
    ||||||||||  ||||||||||||||||  ||| | ||||||||||||| ||| ||||  | ||||| ||| |||||| |||||  ||||| ||||||||    
16972005 gaattgattcagactaaaagtgagttgaaggtaaaatgatttgtgtttgaatacattc-atgtaaaagtgatttgaacaataaatttgtgtttaaaaatc 16972103  T
275 aattctagaatcaaaagctac 295  Q
    ||||||| ||| |||| ||||    
16972104 aattctaaaattaaaaactac 16972124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 161 - 229
Target Start/End: Original strand, 3619066 - 3619133
161 agaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggata 229  Q
    |||||||||||||| |||||||||||| |  |||||||||||||| | | | |||||||||||||||||    
3619066 agaattgattttgaatgaattgattctgatcaaaagtgagttgagtg-aaattgatttgtgtttggata 3619133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 315 - 346
Target Start/End: Complemental strand, 7533784 - 7533753
315 aatcaattctacttgaaagcaaccaaacatgt 346  Q
7533784 aatcaattctacttgaaagcaaccaaacatgt 7533753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 246 - 322
Target Start/End: Original strand, 44141059 - 44141137
246 gagttgaactataaa--tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    |||||||||||||||  | ||||| |||||||| ||||||||||||| ||||  ||| || |||||||| |||||||||    
44141059 gagttgaactataaaattatgtgtgaaaatcaactctagaatcaaaaactacaaatcctaacttcaagtagaatcaatt 44141137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 239 - 322
Target Start/End: Original strand, 6027051 - 6027136
239 taaaattgagttgaactataaatgtgtgta--aaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    ||||| |||||| |||| ||||| ||| ||  ||||||||||||||||||||||||||| ||  ||| || ||||| |||||||||    
6027051 taaaaatgagttaaactgtaaatttgtatatgaaaatcaattctagaatcaaaagctacatactttaactacaagtagaatcaatt 6027136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 255 - 324
Target Start/End: Original strand, 36200154 - 36200221
255 tataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    ||||||||||||  |||||||||||||||||||||| | ||  ||| || |||||||| |||||||||||    
36200154 tataaatgtgtg--aaaatcaattctagaatcaaaatcgacaaatcataacttcaagttgaatcaattct 36200221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 267 - 307
Target Start/End: Complemental strand, 75573 - 75533
267 taaaaatcaattctagaatcaaaagctacttatcttagctt 307  Q
    |||||||||||||||| ||||||||||||| || |||||||    
75573 taaaaatcaattctaggatcaaaagctactaattttagctt 75533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 205
Target Start/End: Original strand, 8130101 - 8130145
161 agaattgattttgagtgaattgattctaactaaaagtgagttgag 205  Q
    |||||||||||||| ||||||||||| || | |||||||||||||    
8130101 agaattgattttgaatgaattgattcgaatttaaagtgagttgag 8130145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 137 - 185
Target Start/End: Original strand, 20505402 - 20505449
137 tgtatgttttgttttgagttgaaaagaattgattttgagtgaattgatt 185  Q
    |||| ||||||||||| || || ||||||||||||||||||||||||||    
20505402 tgtaagttttgttttgtgt-gacaagaattgattttgagtgaattgatt 20505449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 205
Target Start/End: Original strand, 24297589 - 24297633
161 agaattgattttgagtgaattgattctaactaaaagtgagttgag 205  Q
    |||||||||||||| ||||||||||| ||  ||||||||||||||    
24297589 agaattgattttgaatgaattgattcgaatcaaaagtgagttgag 24297633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 229
Target Start/End: Original strand, 41289055 - 41289123
161 agaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggata 229  Q
    |||||||| |||||| ||||||||| ||| ||||||||||||||  ||  | |||||| ||||||||||    
41289055 agaattgagtttgagagaattgattttaattaaaagtgagttgattgtgaattgatttatgtttggata 41289123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 27)
Name: chr1

Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 178 - 312
Target Start/End: Complemental strand, 7524256 - 7524121
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatca 275  Q
    ||||||||||||||||||||||| | |  ||| ||||||||||||||||| | ||| | | ||||| |||||||||||||||||  ||||||||||||||    
7524256 aattgattctaactaaaagtgagctcaaggtaaagtgatttgtgtttggacacatt-tatgtaaaagtgagttgaactataaatttgtgtgtaaaaatca 7524158  T
276 attctagaatcaaaagctacttatcttagcttcaagt 312  Q
    |||||| |||||||||||||  ||| || ||||||||    
7524157 attctataatcaaaagctacaaatcctaacttcaagt 7524121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 239 - 357
Target Start/End: Complemental strand, 11049333 - 11049213
239 taaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaa 336  Q
    ||||| ||| |||||||||||||  ||||||||||||||||| ||||||||||||||||  ||| ||||||||||| ||||| |||||||| ||||||||    
11049333 taaaagtgacttgaactataaatttgtgtgtaaaaatcaattttagaatcaaaagctacaaatcctagcttcaagtagaatcgattctactcgaaagcaa 11049234  T
337 ccaaacatgtaggaatcaatt 357  Q
      ||||||||  |||||||||    
11049233 tgaaacatgtctgaatcaatt 11049213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 211 - 319
Target Start/End: Complemental strand, 30557612 - 30557505
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaa 310  Q
    ||||||||||||||||||| |||| | | |||| ||||||||||||||||| ||||| |||||||||||||||||||||| ||||  ||| |||||||||    
30557612 agtgatttgtgtttggatacattcatat-aaaagtgagttgaactataaatttgtgtgaaaatcaattctagaatcaaaaactacaaatcctagcttcaa 30557514  T
311 gtggaatca 319  Q
     | ||||||    
30557513 ctagaatca 30557505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 163 - 340
Target Start/End: Original strand, 28287260 - 28287441
163 aattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttt--taaaattgagttgaactataaa 260  Q
    |||||| ||||||||||||||||||| |||||||||||||||  | | | |  ||| ||||| |||| |||  | |  ||||| | |||||||| |||||    
28287260 aattgactttgagtgaattgattctagctaaaagtgagttgaatggaaactagtttatgtttagatatatttatgtagtaaaagttagttgaacaataaa 28287359  T
261 tgtg--tgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaa 340  Q
    | ||  ||| ||||||||||||| |||||||||||||  ||| | ||||||||| ||| ||||||||||  |||||||||||    
28287360 tttgagtgttaaaatcaattctaaaatcaaaagctacaaatccttgcttcaagtagaaccaattctactcaaaagcaaccaa 28287441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 239 - 325
Target Start/End: Complemental strand, 6021887 - 6021799
239 taaaattgagttgaactataaa--tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattcta 325  Q
    ||||| |||||||||| |||||  || ||||||||||| ||| |||||||||||||||| |||| ||||||||||| ||||| ||||||    
6021887 taaaagtgagttgaaccataaacttgagtgtaaaaatctattatagaatcaaaagctacatatcctagcttcaagtagaatcgattcta 6021799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 263 - 304
Target Start/End: Original strand, 15084623 - 15084664
263 tgtgtaaaaatcaattctagaatcaaaagctacttatcttag 304  Q
15084623 tgtgtaaaaatcaattctagaatcaaaagctacttatcttag 15084664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 163 - 322
Target Start/End: Original strand, 48548943 - 48549099
163 aattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatg 262  Q
    ||||||||||||||||||   || | ||| ||| ||||||||  ||| | |||||| ||||| |||| ||| | | ||||| |||||||||| |||||||    
48548943 aattgattttgagtgaatg--ttttgactcaaattgagttgaaggtaaaatgatttatgttttgatacatt-tatgtaaaagtgagttgaacaataaatg 48549039  T
263 tgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
     || ||||||||||||||||||||| |||||||   |  ||||||||||| |||||||||    
48549040 agtttaaaaatcaattctagaatcagaagctacaatttctagcttcaagtagaatcaatt 48549099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 161 - 290
Target Start/End: Complemental strand, 47053571 - 47053436
161 agaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttgga---tagattctt---tttaaaattgagttgaac 254  Q
    |||||||||||||||| |||||||||| ||||| |||||||||   ||| ||||||| |||||||||   | ||| | |   | ||||| |||||| |||    
47053571 agaattgattttgagtaaattgattctgactaatagtgagttggaggtaaagtgattggtgtttggaatttggatacattcatgtaaaagtgagttaaac 47053472  T
255 tataaatgtgtgtaaaaatcaattctagaatcaaaa 290  Q
    |||||||| |||||||| ||||||||||||| ||||    
47053471 tataaatgagtgtaaaattcaattctagaataaaaa 47053436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 215 - 322
Target Start/End: Complemental strand, 1514449 - 1514341
215 atttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagt 312  Q
    ||||||||||||||| |||| | | ||||| ||||||||| ||||||  ||||||||||||||||| || ||| |||||||||  ||| |||||||||||    
1514449 atttgtgtttggatacattcatgtaaaaat-gagttgaacaataaatttgtgtgtaaaaatcaattatataataaaaagctacaaatcctagcttcaagt 1514351  T
313 ggaatcaatt 322  Q
     |||| ||||    
1514350 agaataaatt 1514341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 238 - 325
Target Start/End: Original strand, 7790643 - 7790732
238 ttaaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattcta 325  Q
    |||||| |||||||||| ||||||  ||||||||||||||||| ||||||| ||| ||||  ||| || |||||||| ||||||||||||    
7790643 ttaaaagtgagttgaacaataaatttgtgtgtaaaaatcaattatagaatctaaatctacaaatcataacttcaagtagaatcaattcta 7790732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 161 - 295
Target Start/End: Complemental strand, 34915226 - 34915091
161 agaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaa 260  Q
    |||||||||||| |||||||| ||  | |||||||||||||||   ||| | |||||| |||||| ||| |||| | | |||| ||||||||| ||||||    
34915226 agaattgattttaagtgaatttataatgactaaaagtgagttgcaggtaaaatgatttatgtttgaatacattcatgt-aaaagtgagttgaattataaa 34915128  T
261 t--gtgtgtaaaaatcaattctagaatcaaaagctac 295  Q
       |||||| | |||||||||||||||||||||||||    
34915127 atggtgtgttagaatcaattctagaatcaaaagctac 34915091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 211 - 324
Target Start/End: Original strand, 2099662 - 2099777
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaa--tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttc 308  Q
    ||||||||||||||||||| |||| | | |||| |||||||| |||||||  | ||||| ||||||||||||| || ||||| ||||  |||| ||||||    
2099662 agtgatttgtgtttggatacattcatataaaaaatgagttgagctataaatttatgtgtgaaaatcaattctataaccaaaatctacaaatctcagcttc 2099761  T
309 aagtggaatcaattct 324  Q
    || |  ||||||||||    
2099762 aattacaatcaattct 2099777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 239 - 322
Target Start/End: Complemental strand, 3416163 - 3416078
239 taaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    |||||||||||| ||||||||||  |||||||||||||||||||| ||| |||| ||||  |||||| ||| ||||  ||||||||    
3416163 taaaattgagttaaactataaatttgtgtgtaaaaatcaattctaaaataaaaaactacaaatcttaactttaagtataatcaatt 3416078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 215 - 322
Target Start/End: Original strand, 28083867 - 28083975
215 atttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagt 312  Q
    ||||||||||||||| |||| | | |||| |||| ||||||  ||||  |||||||||||| |||| ||||||||||||||||  ||  |||||||||||    
28083867 atttgtgtttggatatattcatgt-aaaagtgagctgaacttgaaatttgtgtgtaaaaattaattatagaatcaaaagctacaaattctagcttcaagt 28083965  T
313 ggaatcaatt 322  Q
28083966 agaatcaatt 28083975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 263 - 312
Target Start/End: Original strand, 51500862 - 51500911
263 tgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagt 312  Q
    |||||||||||||||||||||||||||||||||  ||| ||| |||||||    
51500862 tgtgtaaaaatcaattctagaatcaaaagctacaaatcctaggttcaagt 51500911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 247 - 324
Target Start/End: Complemental strand, 30996117 - 30996038
247 agttgaactataaatgtgtg--taaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    ||||||||||||||||||||  ||||||  ||||||| ||| |||| ||||| ||| || |||||||| |||||||||||    
30996117 agttgaactataaatgtgtgggtaaaaactaattctataataaaaaactactaatcataacttcaagtagaatcaattct 30996038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 116 - 228
Target Start/End: Original strand, 47978314 - 47978426
116 ctgtttggatatacgactcactgtatgttttgttttgagttgaaaagaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtga 215  Q
    ||||||||||| ||  || | ||||||| | |||||| | ||| ||||||| |||||||||||||||||| |   ||||||||||||||  ||| |||||    
47978314 ctgtttggataaacagcttagtgtatgtatggttttgcggtgacaagaattcattttgagtgaattgattttgggtaaaagtgagttgaatgtaaagtga 47978413  T
216 tttgtgtttggat 228  Q
    ||| || ||||||    
47978414 tttatggttggat 47978426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 165 - 204
Target Start/End: Original strand, 6932113 - 6932152
165 ttgattttgagtgaattgattctaactaaaagtgagttga 204  Q
    |||||||||| |||||||||||| ||||||||||||||||    
6932113 ttgattttgaatgaattgattctgactaaaagtgagttga 6932152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 265 - 312
Target Start/End: Complemental strand, 27849194 - 27849147
265 tgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagt 312  Q
    |||||||||||||||||| ||||||||||||  ||| |||||||||||    
27849194 tgtaaaaatcaattctagtatcaaaagctacacatcgtagcttcaagt 27849147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 165 - 224
Target Start/End: Original strand, 47725162 - 47725221
165 ttgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgttt 224  Q
    |||||||||| |||||||||||| ||||||||||||||| | ||  | ||||||||||||    
47725162 ttgattttgaatgaattgattctgactaaaagtgagttgcgggtggattgatttgtgttt 47725221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 165 - 224
Target Start/End: Original strand, 47732154 - 47732213
165 ttgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgttt 224  Q
    |||||||||| |||||||||||| ||||||||||||||| | ||  | ||||||||||||    
47732154 ttgattttgaatgaattgattctgactaaaagtgagttgcgggtggattgatttgtgttt 47732213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 3016219 - 3016187
263 tgtgtaaaaatcaattctagaatcaaaagctac 295  Q
    |||||||| ||||||||||||||||||||||||    
3016219 tgtgtaaacatcaattctagaatcaaaagctac 3016187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 137 - 209
Target Start/End: Complemental strand, 14644905 - 14644833
137 tgtatgttttgttttgagttgaaaagaattgattttgagtgaattgattctaactaaaagtgagttgagagta 209  Q
    |||||||||  ||||| | ||| ||||||| ||||| |||||||||||| | |||||||||| ||||| ||||    
14644905 tgtatgtttgattttgcggtgacaagaattaattttaagtgaattgattatgactaaaagtgtgttgaaagta 14644833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 140 - 224
Target Start/End: Original strand, 15986125 - 15986209
140 atgttttgttttgagttgaaaagaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgttt 224  Q
    |||||||||| || | ||| || |||||||||||| |||||||||| | |||||  ||||||| | |||| |||| |||||||||    
15986125 atgttttgttctgcggtgacaataattgattttgactgaattgattttgactaactgtgagttcaaagtaaagtggtttgtgttt 15986209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 239 - 295
Target Start/End: Original strand, 26373546 - 26373601
239 taaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctac 295  Q
    ||||| |||| |||| | ||||| ||||||||| |||||||||||||||||||||||    
26373546 taaaagtgagatgaattttaaatttgtgtaaaa-tcaattctagaatcaaaagctac 26373601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 267 - 295
Target Start/End: Original strand, 31362237 - 31362265
267 taaaaatcaattctagaatcaaaagctac 295  Q
31362237 taaaaatcaattctagaatcaaaagctac 31362265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 137 - 185
Target Start/End: Complemental strand, 47899451 - 47899403
137 tgtatgttttgttttgagttgaaaagaattgattttgagtgaattgatt 185  Q
    ||||||||||||| |   |||| ||||||||||||||||||||||||||    
47899451 tgtatgttttgttatactttgacaagaattgattttgagtgaattgatt 47899403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 51; Significance: 4e-20; HSPs: 23)
Name: chr4

Target: chr4; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 160 - 322
Target Start/End: Original strand, 8604543 - 8604709
160 aagaattgattttgagtgaattgattctaactaaaagtgagttgaga---gtacagtgatttgtgtttggatagattctttttaaaattgagttgaacta 256  Q
    |||||||||||||||| ||||||||||  || |||| | |||||| |   ||| |||||||| |||||||||| |||| | | |||| ||  || |||||    
8604543 aagaattgattttgagagaattgattccgaccaaaatttagttgaaaaaggtaaagtgatttatgtttggatacattcatgt-aaaagtgcattcaacta 8604641  T
257 taaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    |||||  |||||| |||||||||||||||||| ||||||||  ||||||||||||||| |||||||||    
8604642 taaatttgtgtgtgaaaatcaattctagaatcgaaagctacaaatcttagcttcaagtagaatcaatt 8604709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 211 - 324
Target Start/End: Original strand, 21691187 - 21691301
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttc 308  Q
    ||||||||||||||||||| |||| | | |||| || ||||||||||||||  |||||| ||||||||||||| || ||||||||||  ||||||| |||    
21691187 agtgatttgtgtttggatatattcatgt-aaaagtgtgttgaactataaatttgtgtgtgaaaatcaattctacaaccaaaagctacaaatcttagtttc 21691285  T
309 aagtggaatcaattct 324  Q
    |||| |||||||||||    
21691286 aagttgaatcaattct 21691301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 218 - 324
Target Start/End: Original strand, 32818352 - 32818459
218 tgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgt--aaaaatcaattctagaatcaaaagctacttatcttagcttcaagtgga 315  Q
    |||||||||||| |||| | | ||| || ||||||||||||||| |||||  ||||||||||||||||||||||||||||  ||  ||||||||| | ||    
32818352 tgtgtttggatacattcatgtaaaagtt-agttgaactataaatttgtgtgcaaaaatcaattctagaatcaaaagctacaaattctagcttcaaataga 32818450  T
316 atcaattct 324  Q
32818451 atcaattct 32818459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 137 - 234
Target Start/End: Complemental strand, 33843895 - 33843798
137 tgtatgttttgttttgagttgaaaagaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattc 234  Q
    ||||||||| | |||| ||||| || |||||||||||| ||||||||||||  ||||||||||||||   ||| |||||||| |||||||||| ||||    
33843895 tgtatgtttggctttgtgttgacaaaaattgattttgattgaattgattctggctaaaagtgagttggatgtaaagtgatttatgtttggatatattc 33843798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 249 - 324
Target Start/End: Complemental strand, 9134681 - 9134606
249 ttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    |||| |||||||| ||||| ||||||||||||| |||||||||||||  || |||||||||||| | |||||||||    
9134681 ttgagctataaatttgtgtgaaaatcaattctaaaatcaaaagctacaaattttagcttcaagtaggatcaattct 9134606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 239 - 357
Target Start/End: Complemental strand, 1616473 - 1616354
239 taaaattgagttgaactataaa--tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaa 336  Q
    ||||| ||||||||||| ||||  |||||||   |||||||||||||||||||||||||  ||  |||||| |||| |||||||||||||| || | |||    
1616473 taaaaatgagttgaactttaaacatgtgtgtgggaatcaattctagaatcaaaagctacaaattgtagctt-aagtagaatcaattctactcgataacaa 1616375  T
337 ccaaacatgtaggaatcaatt 357  Q
    |||| |||||  |||||||||    
1616374 ccaatcatgtcagaatcaatt 1616354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 239 - 311
Target Start/End: Complemental strand, 16552038 - 16551966
239 taaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaag 311  Q
    ||||| ||||||||||||||||| ||||| ||||||||||||||||  |||| ||||  ||| ||||||||||    
16552038 taaaagtgagttgaactataaatttgtgtgaaaatcaattctagaactaaaaactacaaatcctagcttcaag 16551966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 261 - 325
Target Start/End: Complemental strand, 30357571 - 30357507
261 tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattcta 325  Q
    |||||||||||||||||| || |||||||||||||  |||  |||||||||| ||||||||||||    
30357571 tgtgtgtaaaaatcaattatataatcaaaagctacaaatcacagcttcaagtagaatcaattcta 30357507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 211 - 295
Target Start/End: Original strand, 39733615 - 39733698
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctac 295  Q
    ||||||||||||||||||| ||| | |  ||||  |||||||||| ||||||||||| | ||||||||||| |||||||||||||    
39733615 agtgatttgtgtttggatacatt-tatgaaaaaaggagttgaactttaaatgtgtgtgataatcaattctacaatcaaaagctac 39733698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 211 - 291
Target Start/End: Complemental strand, 35065173 - 35065092
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaag 291  Q
    ||||||||||||||||||| |||| | | |||| ||||| ||  |||||||  ||||||||||||||||||||||||||||||    
35065173 agtgatttgtgtttggatacattcatgt-aaaagtgagtggagatataaatttgtgtgtaaaaatcaattctagaatcaaaag 35065092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 155 - 187
Target Start/End: Complemental strand, 45694762 - 45694730
155 ttgaaaagaattgattttgagtgaattgattct 187  Q
45694762 ttgaaaagaattgattttgagtgaattgattct 45694730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 244 - 317
Target Start/End: Original strand, 49138770 - 49138845
244 ttgagttgaactataaa--tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaat 317  Q
    ||||||||||||||||   ||||| |||||||||||| |||||||||||| |||  ||| ||||||||||| ||||    
49138770 ttgagttgaactataagcttgtgtataaaaatcaattttagaatcaaaagttacaaatcctagcttcaagtagaat 49138845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 252 - 324
Target Start/End: Original strand, 55186979 - 55187051
252 aactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    |||||||||| ||||| ||||||||||||| ||| ||||| |||  ||| || |||||||| |||||||||||    
55186979 aactataaatatgtgtgaaaatcaattctataattaaaagttacaaatcctaacttcaagtagaatcaattct 55187051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 229
Target Start/End: Original strand, 20712749 - 20712807
171 ttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggata 229  Q
    ||||||||||||||||  ||||||| ||||||||  ||| ||| |||||||||||||||    
20712749 ttgagtgaattgattccgactaaaaatgagttgaaggtaaagttatttgtgtttggata 20712807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 295
Target Start/End: Complemental strand, 45011933 - 45011899
261 tgtgtgtaaaaatcaattctagaatcaaaagctac 295  Q
    ||||||| |||||||||||||||||||||||||||    
45011933 tgtgtgtgaaaatcaattctagaatcaaaagctac 45011899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 264 - 293
Target Start/End: Complemental strand, 4243443 - 4243414
264 gtgtaaaaatcaattctagaatcaaaagct 293  Q
4243443 gtgtaaaaatcaattctagaatcaaaagct 4243414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 197
Target Start/End: Complemental strand, 7946741 - 7946704
160 aagaattgattttgagtgaattgattctaactaaaagt 197  Q
    |||||||||||||||||||||||||||  |||||||||    
7946741 aagaattgattttgagtgaattgattcagactaaaagt 7946704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 267 - 324
Target Start/End: Complemental strand, 14596742 - 14596685
267 taaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    |||||||||||||||||||||||| || |  | | ||||||||||| |||||||||||    
14596742 taaaaatcaattctagaatcaaaaactgcaaaacatagcttcaagtagaatcaattct 14596685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 323
Target Start/End: Complemental strand, 30357704 - 30357644
263 tgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattc 323  Q
    ||||||||||| |||| || |||||||||||||  ||| ||||||||| | ||||||||||    
30357704 tgtgtaaaaataaattatataatcaaaagctacagatcatagcttcaattagaatcaattc 30357644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 239 - 295
Target Start/End: Complemental strand, 33456455 - 33456399
239 taaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctac 295  Q
    ||||| ||| |||||||||| || | ||| |||||||||| ||||||||||||||||    
33456455 taaaagtgaattgaactatagatttatgtgaaaatcaattatagaatcaaaagctac 33456399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 229
Target Start/End: Complemental strand, 36150693 - 36150625
161 agaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggata 229  Q
    ||||||||||||||   |||||||| | | ||||||||||||||  ||| |||||||| ||||||||||    
36150693 agaattgattttgatataattgattttgattaaaagtgagttgaatgtaaagtgatttatgtttggata 36150625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 261 - 297
Target Start/End: Original strand, 37566247 - 37566283
261 tgtgtgtaaaaatcaattctagaatcaaaagctactt 297  Q
    ||||||| ||||||||||||| |||||||||||||||    
37566247 tgtgtgtgaaaatcaattctaaaatcaaaagctactt 37566283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 272 - 324
Target Start/End: Original strand, 55927807 - 55927859
272 atcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    |||||||||||||||| |||||||   | ||||| ||||||||||||||||||    
55927807 atcaattctagaatcagaagctacaatttttagcctcaagtggaatcaattct 55927859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 18)
Name: chr3

Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 162 - 253
Target Start/End: Complemental strand, 14022132 - 14022042
162 gaattgattttgagtgaattgattctaactaaaagtgagttg-agagtacagtgatttgtgtttggatagattctttttaaaattgagttgaa 253  Q
    |||||||||||||||||||| |||||| |||||||||||||| ||| || ||| ||||||||||||||| ||||  |||||||||||| ||||    
14022132 gaattgattttgagtgaatttattctatctaaaagtgagttgcaga-taaagtaatttgtgtttggatacattc-atttaaaattgagctgaa 14022042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 293
Target Start/End: Complemental strand, 35058512 - 35058388
163 aattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataa--- 259  Q
    ||||||||||||||| ||||||||||||||||||||||||||   || |||| ||| ||||||||||         ||||| |||||||||| ||||       
35058512 aattgattttgagtggattgattctaactaaaagtgagttgaagataaagtgctttatgtttggata---------taaaagtgagttgaacaataatat 35058422  T
260 atgtgtgtaaaaatcaattctagaatcaaaagct 293  Q
     || |||| |||||||||||||||||||||||||    
35058421 ttgagtgttaaaatcaattctagaatcaaaagct 35058388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 293
Target Start/End: Original strand, 35264353 - 35264469
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgt--gtgtaaaaatca 275  Q
    |||||||| |||| ||||||||||||| |||| ||||| || ||||||| || |||| | | ||||| || |||||| |||||| |  |||| |||||||    
35264353 aattgattgtaaccaaaagtgagttgaaagtaaagtgagttatgtttgggtacattcatgtaaaaat-gacttgaacaataaatttaagtgttaaaatca 35264451  T
276 attctagaatcaaaagct 293  Q
35264452 attctagaatcaaaagct 35264469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 189 - 295
Target Start/End: Original strand, 31708192 - 31708299
189 actaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatc 286  Q
    |||||||||||||||    || |||| |||||||||||||| |||| | | |||| ||||||||| |||||||  |||||| | ||||||||||||||||    
31708192 actaaaagtgagttgctgataaagtggtttgtgtttggatacattcatgt-aaaagtgagttgaattataaatttgtgtgttagaatcaattctagaatc 31708290  T
287 aaaagctac 295  Q
31708291 aaaagctac 31708299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 293
Target Start/End: Original strand, 46853461 - 46853592
163 aattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatg 262  Q
    ||||||| ||||||||||||||| |  ||| |||| ||||||  ||| |||||||| |||  ||||| ||| | | ||||| |||||||||| ||||||     
46853461 aattgatcttgagtgaattgattttggctacaagtaagttgaaggtaaagtgatttatgtcaggatatatt-tatgtaaaagtgagttgaacaataaatt 46853559  T
263 tg--tgtaaaaatcaattctagaatcaaaagct 293  Q
    ||  ||| |||||||||||||||||||||||||    
46853560 tgagtgttaaaatcaattctagaatcaaaagct 46853592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 295
Target Start/End: Complemental strand, 5407058 - 5406931
163 aattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatg 262  Q
    |||||||||||||||||||||||||| |||||| ||||||||  ||| ||    || |||||||||| ||||  | ||||| ||| |||||   |||||     
5407058 aattgattttgagtgaattgattctagctaaaattgagttgaaggtaaag----ttatgtttggatacattc-atgtaaaagtgatttgaagagtaaatt 5406964  T
263 tgtgtaaaaatcaattctagaatcaaaagctac 295  Q
    ||| ||||||||||||||| ||||| |||||||    
5406963 tgtttaaaaatcaattctataatcagaagctac 5406931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 164 - 217
Target Start/End: Complemental strand, 46018746 - 46018693
164 attgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatt 217  Q
    ||||||||||||||||||||||||| |||||  |||||||| |||| |||||||    
46018746 attgattttgagtgaattgattctagctaaagatgagttgatagtaaagtgatt 46018693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 295
Target Start/End: Original strand, 37334976 - 37335094
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgt--gtgtaaaaatca 275  Q
    |||||||||  ||||||| ||||||||  ||| |||||||| ||| || ||| |||| | | ||||| ||||||||| || |||    ||||||||||||    
37334976 aattgattccgactaaaattgagttgaaggtaaagtgatttatgtctgaatacattcatataaaaat-gagttgaacaatgaattcaagtgtaaaaatca 37335074  T
276 attctagaatcaaaagctac 295  Q
37335075 attctagaatcaaaagctac 37335094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 249 - 357
Target Start/End: Complemental strand, 42375596 - 42375488
249 ttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatgtag 348  Q
    |||||| | |||| ||| |||||||||||||||  |||||| |||||  ||  ||||||||||| ||||  |||||||||||  ||||||||| ||||      
42375596 ttgaacaaaaaatttgtataaaaatcaattctatgatcaaacgctacaaattatagcttcaagtagaattgattctacttgaccgcaaccaaaaatgtca 42375497  T
349 gaatcaatt 357  Q
42375496 gaatcaatt 42375488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 249 - 357
Target Start/End: Complemental strand, 42404310 - 42404202
249 ttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatgtag 348  Q
    |||||| | |||| ||| |||||||||||||||  |||||| |||||  ||  ||||||||||| ||||  |||||||||||  ||||||||| ||||      
42404310 ttgaacaaaaaatttgtataaaaatcaattctatgatcaaacgctacaaattatagcttcaagtagaattgattctacttgaccgcaaccaaaaatgtca 42404211  T
349 gaatcaatt 357  Q
42404210 gaatcaatt 42404202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 271 - 345
Target Start/End: Original strand, 21367137 - 21367211
271 aatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatg 345  Q
    ||||||||||||||||| |||||||  | | ||| |||| || |||| | ||||||| |||||||||||||||||    
21367137 aatcaattctagaatcagaagctacaaaccctagattcatgtagaataagttctactcgaaagcaaccaaacatg 21367211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 295
Target Start/End: Original strand, 32523366 - 32523400
261 tgtgtgtaaaaatcaattctagaatcaaaagctac 295  Q
    |||||||||||||||||| ||||||||||||||||    
32523366 tgtgtgtaaaaatcaattttagaatcaaaagctac 32523400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 263 - 325
Target Start/End: Original strand, 47356273 - 47356335
263 tgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattcta 325  Q
    ||||||||||||||||||| |||||||  |||   |||||| |||||||||||||| ||||||    
47356273 tgtgtaaaaatcaattctataatcaaagactataaatcttaacttcaagtggaatcgattcta 47356335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 197 - 295
Target Start/End: Original strand, 41596110 - 41596209
197 tgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaa--tgtgtgtaaaaatcaattctagaatcaaaagcta 294  Q
    ||||||||  ||| |||||||| |||||||||| |||| |   |||| |||||  |||||||||  ||||||||||||||||||||  ||||||||||||    
41596110 tgagttgaatgtaaagtgatttctgtttggatacattcatgg-aaaagtgagtcaaactataaacttgtgtgtaaaaatcaattctttaatcaaaagcta 41596208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 1441349 - 1441405
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattc 234  Q
    ||||||||||  |||||||||||||||  ||| |||||||||||||| |||| ||||    
1441349 aattgattctgtctaaaagtgagttgaacgtaaagtgatttgtgtttagatacattc 1441405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 44771751 - 44771719
263 tgtgtaaaaatcaattctagaatcaaaagctac 295  Q
    |||||||||||||||| ||||||||||||||||    
44771751 tgtgtaaaaatcaattttagaatcaaaagctac 44771719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 239 - 324
Target Start/End: Complemental strand, 52364134 - 52364047
239 taaaattgagttgaactataaatgtgtgta--aaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    ||||| ||||||||||| ||||| | |||   |||||||||| |||||||||||||||   ||| ||||||||||| ||| |||||||    
52364134 taaaagtgagttgaactgtaaatttatgtttgaaaatcaattatagaatcaaaagctataaatcatagcttcaagtagaaacaattct 52364047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 314 - 346
Target Start/End: Complemental strand, 54596806 - 54596774
314 gaatcaattctacttgaaagcaaccaaacatgt 346  Q
    ||||||||||||||||||| |||||||||||||    
54596806 gaatcaattctacttgaaaacaaccaaacatgt 54596774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0005

Target: scaffold0005; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 267 - 324
Target Start/End: Original strand, 220636 - 220693
267 taaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    |||||||||||||||||||||||| || |  | | ||||||||||| |||||||||||    
220636 taaaaatcaattctagaatcaaaaactgcaaaacatagcttcaagtagaatcaattct 220693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0360 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0360

Target: scaffold0360; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 314 - 346
Target Start/End: Original strand, 13288 - 13320
314 gaatcaattctacttgaaagcaaccaaacatgt 346  Q
    ||||||||||||||| |||||||||||||||||    
13288 gaatcaattctacttcaaagcaaccaaacatgt 13320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC