View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9312-LTR4-TNT-insertion-4 (Length: 367)

Name: F9312-LTR4-TNT-insertion-4
Description: F9312-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9312-LTR4-TNT-insertion-4
F9312-LTR4-TNT-insertion-4
[»] chr5 (15 HSPs)
chr5 (7-358)||(18637246-18637597)
chr5 (213-322)||(38845441-38845552)
chr5 (239-322)||(9818732-9818818)
chr5 (239-322)||(18851084-18851169)
chr5 (163-325)||(34250281-34250441)
chr5 (263-346)||(39097220-39097303)
chr5 (188-322)||(6951257-6951392)
chr5 (239-322)||(11648080-11648163)
chr5 (239-325)||(42858103-42858191)
chr5 (165-224)||(34454045-34454104)
chr5 (137-194)||(9818861-9818918)
chr5 (137-234)||(36927588-36927685)
chr5 (211-322)||(13171735-13171848)
chr5 (302-346)||(25548474-25548518)
chr5 (302-346)||(39229146-39229190)
[»] chr6 (33 HSPs)
chr6 (178-324)||(765327-765475)
chr6 (157-295)||(34910972-34911106)
chr6 (211-322)||(4910906-4911018)
chr6 (240-324)||(30927039-30927120)
chr6 (166-294)||(34620912-34621041)
chr6 (166-294)||(34748349-34748478)
chr6 (163-293)||(1485073-1485204)
chr6 (211-325)||(3482041-3482156)
chr6 (261-357)||(957649-957745)
chr6 (239-295)||(17225877-17225935)
chr6 (161-294)||(434161-434296)
chr6 (178-295)||(46230-46350)
chr6 (239-324)||(26280601-26280688)
chr6 (180-294)||(25195876-25195989)
chr6 (239-293)||(947594-947648)
chr6 (261-322)||(5724656-5724717)
chr6 (269-346)||(6895984-6896061)
chr6 (314-346)||(18690628-18690660)
chr6 (161-204)||(6208060-6208103)
chr6 (315-346)||(7280446-7280477)
chr6 (166-229)||(28466914-28466977)
chr6 (166-229)||(34736756-34736819)
chr6 (264-322)||(2234513-2234571)
chr6 (249-324)||(6654102-6654179)
chr6 (239-322)||(16540105-16540190)
chr6 (165-234)||(882773-882842)
chr6 (163-204)||(19601379-19601420)
chr6 (264-293)||(34027446-34027475)
chr6 (211-291)||(6653843-6653926)
chr6 (156-204)||(10400661-10400709)
chr6 (265-293)||(10874521-10874549)
chr6 (211-323)||(25195341-25195452)
chr6 (168-204)||(34026417-34026453)
[»] chr2 (20 HSPs)
chr2 (211-357)||(43501088-43501233)
chr2 (264-322)||(42740975-42741033)
chr2 (189-291)||(33502266-33502366)
chr2 (167-322)||(30503207-30503361)
chr2 (169-295)||(4894090-4894217)
chr2 (190-324)||(16518775-16518909)
chr2 (163-229)||(7632521-7632587)
chr2 (211-293)||(22536025-22536108)
chr2 (211-325)||(33019131-33019246)
chr2 (209-325)||(12037056-12037172)
chr2 (315-346)||(7630372-7630403)
chr2 (261-320)||(42982544-42982603)
chr2 (261-319)||(2002721-2002779)
chr2 (287-357)||(7632640-7632710)
chr2 (239-285)||(15928460-15928506)
chr2 (194-324)||(44439249-44439381)
chr2 (140-185)||(11650661-11650706)
chr2 (162-234)||(3853940-3854012)
chr2 (137-185)||(11759746-11759794)
chr2 (137-185)||(37745785-37745833)
[»] chr7 (15 HSPs)
chr7 (162-336)||(45557349-45557524)
chr7 (160-357)||(17111820-17112006)
chr7 (168-346)||(38123598-38123777)
chr7 (178-324)||(40491574-40491721)
chr7 (240-324)||(41386818-41386904)
chr7 (165-234)||(40561687-40561756)
chr7 (264-322)||(30182325-30182383)
chr7 (137-234)||(29842173-29842268)
chr7 (163-234)||(29829296-29829367)
chr7 (163-234)||(33853411-33853482)
chr7 (164-205)||(36270832-36270873)
chr7 (239-324)||(597948-598034)
chr7 (165-229)||(15050385-15050449)
chr7 (139-187)||(40491726-40491774)
chr7 (305-357)||(48159006-48159058)
[»] chr8 (27 HSPs)
chr8 (245-358)||(15677823-15677939)
chr8 (178-320)||(32927892-32928035)
chr8 (239-322)||(38868496-38868581)
chr8 (261-344)||(32994268-32994351)
chr8 (191-355)||(38335816-38335981)
chr8 (239-322)||(13384656-13384741)
chr8 (178-325)||(26100088-26100236)
chr8 (178-320)||(35494990-35495133)
chr8 (246-323)||(4662912-4662991)
chr8 (269-325)||(7244635-7244691)
chr8 (246-346)||(18355859-18355959)
chr8 (160-311)||(32767396-32767548)
chr8 (178-283)||(18356031-18356135)
chr8 (178-343)||(30098887-30099051)
chr8 (168-224)||(7720282-7720338)
chr8 (211-324)||(37684401-37684515)
chr8 (177-295)||(16972005-16972124)
chr8 (161-229)||(3619066-3619133)
chr8 (315-346)||(7533753-7533784)
chr8 (246-322)||(44141059-44141137)
chr8 (239-322)||(6027051-6027136)
chr8 (255-324)||(36200154-36200221)
chr8 (267-307)||(75533-75573)
chr8 (161-205)||(8130101-8130145)
chr8 (137-185)||(20505402-20505449)
chr8 (161-205)||(24297589-24297633)
chr8 (161-229)||(41289055-41289123)
[»] chr1 (27 HSPs)
chr1 (178-312)||(7524121-7524256)
chr1 (239-357)||(11049213-11049333)
chr1 (211-319)||(30557505-30557612)
chr1 (163-340)||(28287260-28287441)
chr1 (239-325)||(6021799-6021887)
chr1 (263-304)||(15084623-15084664)
chr1 (163-322)||(48548943-48549099)
chr1 (161-290)||(47053436-47053571)
chr1 (215-322)||(1514341-1514449)
chr1 (238-325)||(7790643-7790732)
chr1 (161-295)||(34915091-34915226)
chr1 (211-324)||(2099662-2099777)
chr1 (239-322)||(3416078-3416163)
chr1 (215-322)||(28083867-28083975)
chr1 (263-312)||(51500862-51500911)
chr1 (247-324)||(30996038-30996117)
chr1 (116-228)||(47978314-47978426)
chr1 (165-204)||(6932113-6932152)
chr1 (265-312)||(27849147-27849194)
chr1 (165-224)||(47725162-47725221)
chr1 (165-224)||(47732154-47732213)
chr1 (263-295)||(3016187-3016219)
chr1 (137-209)||(14644833-14644905)
chr1 (140-224)||(15986125-15986209)
chr1 (239-295)||(26373546-26373601)
chr1 (267-295)||(31362237-31362265)
chr1 (137-185)||(47899403-47899451)
[»] chr4 (23 HSPs)
chr4 (160-322)||(8604543-8604709)
chr4 (211-324)||(21691187-21691301)
chr4 (218-324)||(32818352-32818459)
chr4 (137-234)||(33843798-33843895)
chr4 (249-324)||(9134606-9134681)
chr4 (239-357)||(1616354-1616473)
chr4 (239-311)||(16551966-16552038)
chr4 (261-325)||(30357507-30357571)
chr4 (211-295)||(39733615-39733698)
chr4 (211-291)||(35065092-35065173)
chr4 (155-187)||(45694730-45694762)
chr4 (244-317)||(49138770-49138845)
chr4 (252-324)||(55186979-55187051)
chr4 (171-229)||(20712749-20712807)
chr4 (261-295)||(45011899-45011933)
chr4 (264-293)||(4243414-4243443)
chr4 (160-197)||(7946704-7946741)
chr4 (267-324)||(14596685-14596742)
chr4 (263-323)||(30357644-30357704)
chr4 (239-295)||(33456399-33456455)
chr4 (161-229)||(36150625-36150693)
chr4 (261-297)||(37566247-37566283)
chr4 (272-324)||(55927807-55927859)
[»] chr3 (18 HSPs)
chr3 (162-253)||(14022042-14022132)
chr3 (163-293)||(35058388-35058512)
chr3 (178-293)||(35264353-35264469)
chr3 (189-295)||(31708192-31708299)
chr3 (163-293)||(46853461-46853592)
chr3 (163-295)||(5406931-5407058)
chr3 (164-217)||(46018693-46018746)
chr3 (178-295)||(37334976-37335094)
chr3 (249-357)||(42375488-42375596)
chr3 (249-357)||(42404202-42404310)
chr3 (271-345)||(21367137-21367211)
chr3 (261-295)||(32523366-32523400)
chr3 (263-325)||(47356273-47356335)
chr3 (197-295)||(41596110-41596209)
chr3 (178-234)||(1441349-1441405)
chr3 (263-295)||(44771719-44771751)
chr3 (239-324)||(52364047-52364134)
chr3 (314-346)||(54596774-54596806)
[»] scaffold0005 (1 HSPs)
scaffold0005 (267-324)||(220636-220693)
[»] scaffold0360 (1 HSPs)
scaffold0360 (314-346)||(13288-13320)


Alignment Details
Target: chr5 (Bit Score: 352; Significance: 0; HSPs: 15)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 7 - 358
Target Start/End: Complemental strand, 18637597 - 18637246
Alignment:
7 atttattatagcttaaacgcttgtcatcacttatatcagttttaatttgaaacaatctcggctgaggtcagttactacgtgacaatgttacaagttactg 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18637597 atttattatagcttaaacgcttgtcatcacttatatcagttttaatttgaaacaatctcggctgaggtcagttactacgtgacaatgttacaagttactg 18637498  T
107 agctgtggcctgtttggatatacgactcactgtatgttttgttttgagttgaaaagaattgattttgagtgaattgattctaactaaaagtgagttgaga 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18637497 agctgtggcctgtttggatatacgactcactgtatgttttgttttgagttgaaaagaattgattttgagtgaattgattctaactaaaagtgagttgaga 18637398  T
207 gtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagct 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18637397 gtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagct 18637298  T
307 tcaagtggaatcaattctacttgaaagcaaccaaacatgtaggaatcaattg 358  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
18637297 tcaagtggaatcaattctacttgaaagcaaccaaacatgtaggaatcaattg 18637246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 213 - 322
Target Start/End: Complemental strand, 38845552 - 38845441
Alignment:
213 tgatttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaa 310  Q
    ||||||||||||||||| |||| | | |||| |||||| ||||||| ||  |||||| |||||||||||||||||||||| ||||  |||||||||||||    
38845552 tgatttgtgtttggatatattcatgtaaaaagtgagtttaactatatatttgtgtgtgaaaatcaattctagaatcaaaaactacaaatcttagcttcaa 38845453  T
311 gtggaatcaatt 322  Q
    || |||||||||    
38845452 gtagaatcaatt 38845441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 239 - 322
Target Start/End: Complemental strand, 9818818 - 9818732
Alignment:
239 taaaattgagttgaactataaatgtgtgt---aaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    ||||| ||||||||||||||||| |||||   ||||||||||||||||||||||||||||  ||| ||||||||||| |||||||||    
9818818 taaaagtgagttgaactataaatttgtgtttaaaaaatcaattctagaatcaaaagctacaaatcatagcttcaagtagaatcaatt 9818732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 239 - 322
Target Start/End: Original strand, 18851084 - 18851169
Alignment:
239 taaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    ||||| |||||| ||||||||||  |||||| ||||||||||||| |||||||||||||  ||| ||||||||||| |||||||||    
18851084 taaaagtgagtttaactataaatatgtgtgtgaaaatcaattctataatcaaaagctacaaatcatagcttcaagtagaatcaatt 18851169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 325
Target Start/End: Original strand, 34250281 - 34250441
Alignment:
163 aattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatg 262  Q
    ||||||||||||||||||||||| | |||| || ||||||||   || |||||||| |||||||| | ||||   | |||| | |||||||| | ||||     
34250281 aattgattttgagtgaattgattttgactataattgagttgaagctaaagtgatttatgtttggaaacattc--ataaaaagtaagttgaacaaaaaatt 34250378  T
263 tgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattcta 325  Q
    ||||| |||| ||||| ||||||||||||||||   |  |||| |||||| ||||||||||||    
34250379 tgtgtgaaaaacaattgtagaatcaaaagctacaatttctagcatcaagtagaatcaattcta 34250441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 263 - 346
Target Start/End: Complemental strand, 39097303 - 39097220
Alignment:
263 tgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatgt 346  Q
    ||||| |||||||||| || ||| ||||| |||  || |||||||||||| ||||||||||||| ||||| |||||||||||||    
39097303 tgtgtgaaaatcaattatataattaaaagttacaaattttagcttcaagtagaatcaattctacctgaaaccaaccaaacatgt 39097220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 188 - 322
Target Start/End: Original strand, 6951257 - 6951392
Alignment:
188 aactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgt--gtgtaaaaatcaattctagaat 285  Q
    |||||||||||||| || |||| | ||| |||| |||||||| |||| | | |||| ||| ||||| ||||||| |  ||||| ||||||||| ||||||    
6951257 aactaaaagtgagtcgaaagtaaaatgacttgtatttggataaattcatgt-aaaagtgaattgaattataaatttatgtgtacaaatcaattatagaat 6951355  T
286 caaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    ||||||||||  ||| || |||||||| |||||||||    
6951356 caaaagctacaaatcctaacttcaagtagaatcaatt 6951392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 239 - 322
Target Start/End: Complemental strand, 11648163 - 11648080
Alignment:
239 taaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    ||||||||||||||| ||||   |||||| |||||||||| || ||||||||  |||  ||||||||||||||| |||||||||    
11648163 taaaattgagttgaattatattcgtgtgtgaaaatcaattttataatcaaaatgtacaaatcttagcttcaagtagaatcaatt 11648080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 239 - 325
Target Start/End: Complemental strand, 42858191 - 42858103
Alignment:
239 taaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattcta 325  Q
    ||||| |||||||||||||||||  |||||| |||||||||| |||||| ||||||| |  ||| || ||||||||  |||||||||||    
42858191 taaaagtgagttgaactataaatttgtgtgtgaaaatcaattatagaattaaaagctccaaatcctaacttcaagtaaaatcaattcta 42858103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 165 - 224
Target Start/End: Original strand, 34454045 - 34454104
Alignment:
165 ttgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgttt 224  Q
    |||||||||| |||||||||||| ||||||||||||||| | ||  | ||||||||||||    
34454045 ttgattttgaatgaattgattctgactaaaagtgagttgcgggtggattgatttgtgttt 34454104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 137 - 194
Target Start/End: Complemental strand, 9818918 - 9818861
Alignment:
137 tgtatgttttgttttgagttgaaaagaattgattttgagtgaattgattctaactaaa 194  Q
    ||||||||| ||| || | ||| ||||||| |||||||||||||||||||| ||||||    
9818918 tgtatgtttggttctgcggtgacaagaatttattttgagtgaattgattcttactaaa 9818861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 137 - 234
Target Start/End: Original strand, 36927588 - 36927685
Alignment:
137 tgtatgttttgttttgagttgaaaagaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattc 234  Q
    ||||||||| ||||||  |||| || |||||||||||| |||||||||||| ||| ||   ||| |||  ||| |||||||| |||||||||| ||||    
36927588 tgtatgtttggttttgcattgagaaaaattgattttgactgaattgattctgactgaattagagatgatggtaaagtgatttatgtttggatacattc 36927685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 211 - 322
Target Start/End: Original strand, 13171735 - 13171848
Alignment:
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgt---aaaaatcaattctagaatcaaaagctacttatcttagctt 307  Q
    |||||||| | |||||||| ||| ||| |||||||||||| |||||||||| | |||   |||||||| || |||||||||||  |||  |||||  |||    
13171735 agtgatttttatttggataaatt-tttgtaaaattgagtttaactataaatttttgtatgaaaaatcatttatagaatcaaaatttacaaatcttttctt 13171833  T
308 caagtggaatcaatt 322  Q
    ||||| |||||||||    
13171834 caagtagaatcaatt 13171848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 302 - 346
Target Start/End: Complemental strand, 25548518 - 25548474
Alignment:
302 tagcttcaagtggaatcaattctacttgaaagcaaccaaacatgt 346  Q
    ||||||||||| ||||||||| ||||| ||||||| |||||||||    
25548518 tagcttcaagtagaatcaattttacttaaaagcaatcaaacatgt 25548474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 302 - 346
Target Start/End: Complemental strand, 39229190 - 39229146
Alignment:
302 tagcttcaagtggaatcaattctacttgaaagcaaccaaacatgt 346  Q
    ||||||||||| ||||||||| |||||||||| || |||||||||    
39229190 tagcttcaagtagaatcaattttacttgaaagtaatcaaacatgt 39229146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 74; Significance: 7e-34; HSPs: 33)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 178 - 324
Target Start/End: Original strand, 765327 - 765475
Alignment:
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattcttttt--aaaattgagttgaactataaatgtgtgtaaaaatca 275  Q
    |||||||||||||||||||| |||||| |||| ||||||||||||||  ||| |||||| ||  |||| ||||||||||||||||| | | ||| |||||    
765327 aattgattctaactaaaagtaagttgaaagtaaagtgatttgtgtttccatacattcttcttgtaaaaatgagttgaactataaatttctttaataatca 765426  T
276 attctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    ||||||||||||||||||||  ||| ||||||||||| |||||||||||    
765427 attctagaatcaaaagctacaaatcatagcttcaagtagaatcaattct 765475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 157 - 295
Target Start/End: Complemental strand, 34911106 - 34910972
Alignment:
157 gaaaagaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaacta 256  Q
    ||||| ||||||||||||||||||||||||  ||||||||||||||||  ||| |||||||| |||||||||  ||||  | ||||| | |||| |||||    
34911106 gaaaataattgattttgagtgaattgattccgactaaaagtgagttgaaggta-agtgatttatgtttggat--attc-atgtaaaagttagttaaacta 34911011  T
257 taaatgtgtgtaaaaatcaattctagaatcaaaagctac 295  Q
    ||| ||||||| |||||||||||||||||||||||||||    
34911010 taattgtgtgtcaaaatcaattctagaatcaaaagctac 34910972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 211 - 322
Target Start/End: Complemental strand, 4911018 - 4910906
Alignment:
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgt--gtaaaaatcaattctagaatcaaaagctacttatcttagcttc 308  Q
    |||||||| |||||||||| ||| | | ||||| ||||| ||||||||||| |||  || |||||||||||||||||||||||||||  ||| |||||||    
4911018 agtgatttatgtttggatacatt-tatgtaaaagtgagtcgaactataaatttgtatgtgaaaatcaattctagaatcaaaagctacaaatcatagcttc 4910920  T
309 aagtggaatcaatt 322  Q
    |||| |||||||||    
4910919 aagtagaatcaatt 4910906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 240 - 324
Target Start/End: Complemental strand, 30927120 - 30927039
Alignment:
240 aaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    |||| |||||||||||||   ||||||||||||||||||||| |||||||||||||  |||||||||||||||  ||||||||||    
30927120 aaaagtgagttgaactat---tgtgtgtaaaaatcaattctataatcaaaagctacgaatcttagcttcaagtataatcaattct 30927039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 166 - 294
Target Start/End: Complemental strand, 34621041 - 34620912
Alignment:
166 tgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgt-- 263  Q
    ||||||||||||||| ||||||  ||| || ||||||||  ||| |||||||| |||||||||| ||| | | ||||| |||||||||  |||||| |      
34621041 tgattttgagtgaatggattctggctagaattgagttgaaggtaaagtgatttatgtttggatacatt-tatgtaaaagtgagttgaaaaataaatttta 34620943  T
264 gtgtaaaaatcaattctagaatcaaaagcta 294  Q
    |||||||||||||||||||||||| ||||||    
34620942 gtgtaaaaatcaattctagaatcagaagcta 34620912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 166 - 294
Target Start/End: Complemental strand, 34748478 - 34748349
Alignment:
166 tgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgt-- 263  Q
    ||||||||||||||| ||||||  ||| || ||||||||  ||| |||||||| |||||||||| ||| | | ||||| |||||||||  |||||| |      
34748478 tgattttgagtgaatggattctggctagaattgagttgaaggtaaagtgatttatgtttggatacatt-tatgtaaaagtgagttgaaaaataaatttta 34748380  T
264 gtgtaaaaatcaattctagaatcaaaagcta 294  Q
    |||||||||||||||||||||||| ||||||    
34748379 gtgtaaaaatcaattctagaatcagaagcta 34748349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 163 - 293
Target Start/End: Original strand, 1485073 - 1485204
Alignment:
163 aattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaa-- 260  Q
    ||||| |||| | ||||||||||||| ||||||||||||| | |||  ||||||||  ||||||||| | | | | ||||| |||||||||| |||||      
1485073 aattgttttttaatgaattgattctagctaaaagtgagtttaaagttgagtgatttacgtttggatacact-tatgtaaaagtgagttgaacaataaatt 1485171  T
261 tgtgtgtaaaaatcaattctagaatcaaaagct 293  Q
    || |||| |||||||||||||||||||||||||    
1485172 tgagtgttaaaatcaattctagaatcaaaagct 1485204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 211 - 325
Target Start/End: Complemental strand, 3482156 - 3482041
Alignment:
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaa--tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttc 308  Q
    ||||||||||||||| ||| |||| | | |||| | ||||||||||||||  ||||||| ||||||||||||| ||||||| |||||  |||||| ||||    
3482156 agtgatttgtgtttgaatacattcatgt-aaaagtaagttgaactataaacttgtgtgtgaaaatcaattctaaaatcaaaggctacaaatcttaacttc 3482058  T
309 aagtggaatcaattcta 325  Q
    ||||  |||||||||||    
3482057 aagtataatcaattcta 3482041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 261 - 357
Target Start/End: Original strand, 957649 - 957745
Alignment:
261 tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatgtaggaatcaatt 357  Q
    |||||||||||||| ||| | ||||||||| |||   ||||||||| |||||  ||||||||||||| |||||||| ||||||||| | ||||||||    
957649 tgtgtgtaaaaatcgattatggaatcaaaaactataaatcttagctacaagtaaaatcaattctactcgaaagcaatcaaacatgtcgtaatcaatt 957745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 239 - 295
Target Start/End: Complemental strand, 17225935 - 17225877
Alignment:
239 taaaattgagttgaactataaatgtgt--gtaaaaatcaattctagaatcaaaagctac 295  Q
    ||||| ||||||||||||||||| |||  ||||||||||||||||||||||||||||||    
17225935 taaaactgagttgaactataaatttgtatgtaaaaatcaattctagaatcaaaagctac 17225877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 161 - 294
Target Start/End: Original strand, 434161 - 434296
Alignment:
161 agaattgattttgagt-gaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataa 259  Q
    |||||||||||||||| |||| |||| |  ||||||||||||||   ||| | ||||||||||||||||| |||| | | |||| ||||||||| | |||    
434161 agaattgattttgagttgaatggattatggctaaaagtgagttgcaggtaaaatgatttgtgtttggatatattcgtgt-aaaagtgagttgaaatttaa 434259  T
260 atgtgtgta--aaaatcaattctagaatcaaaagcta 294  Q
    || | ||||  ||||||||||||| ||||||||||||    
434260 atttatgtataaaaatcaattctaaaatcaaaagcta 434296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 178 - 295
Target Start/End: Original strand, 46230 - 46350
Alignment:
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaa----tgtgtgtaaaaat 273  Q
    ||||||||||||||||||||||||||  | || ||| ||||||||||||||| ||||  |  |||| ||||||||| ||||||    ||| ||| | |||    
46230 aattgattctaactaaaagtgagttgcaattaaagttatttgtgtttggatacattc-gtggaaaagtgagttgaattataaaaatttgtttgttagaat 46328  T
274 caattctagaatcaaaagctac 295  Q
    | ||||||||||||||||||||    
46329 ctattctagaatcaaaagctac 46350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 239 - 324
Target Start/End: Complemental strand, 26280688 - 26280601
Alignment:
239 taaaattgagttgaactataaatgtgt--gtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    ||||| |||||| |||||||||| |||  ||||||||||||| | ||||||||| ||||  ||  |||||||||||||||||||||||    
26280688 taaaagtgagtttaactataaatttgtacgtaaaaatcaattttggaatcaaaaactacaaattctagcttcaagtggaatcaattct 26280601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 180 - 294
Target Start/End: Complemental strand, 25195989 - 25195876
Alignment:
180 ttgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatcaat 277  Q
    ||||||| |||||||| ||||||||| | | |||  |||||||||||||| |||  | |   || |||||||||||||||||  ||||||| || |||||    
25195989 ttgattccaactaaaaatgagttgagggcaaagttgtttgtgtttggatacatttatgt---aagtgagttgaactataaatttgtgtgtacaattcaat 25195893  T
278 tctagaatcaaaagcta 294  Q
    |||||||||||||||||    
25195892 tctagaatcaaaagcta 25195876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 239 - 293
Target Start/End: Complemental strand, 947648 - 947594
Alignment:
239 taaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagct 293  Q
    ||||| ||||||||| ||||| ||||| ||| |||||||||||||||||||||||    
947648 taaaagtgagttgaattataattgtgtttaagaatcaattctagaatcaaaagct 947594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 261 - 322
Target Start/End: Original strand, 5724656 - 5724717
Alignment:
261 tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    |||||||||||||||||| |||||| ||||| |||  ||| ||||||||||| |||||||||    
5724656 tgtgtgtaaaaatcaattatagaataaaaagttacaaatcctagcttcaagtagaatcaatt 5724717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 346
Target Start/End: Original strand, 6895984 - 6896061
Alignment:
269 aaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatgt 346  Q
    ||||| |||||||||||||||||||||  ||| || ||||| || ||||||||| |||| || | |||||||||||||    
6895984 aaaataaattctagaatcaaaagctacaaatcctaacttcaggtagaatcaattgtactcgacaacaaccaaacatgt 6896061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 314 - 346
Target Start/End: Complemental strand, 18690660 - 18690628
Alignment:
314 gaatcaattctacttgaaagcaaccaaacatgt 346  Q
    |||||||||||||||||||||||||||||||||    
18690660 gaatcaattctacttgaaagcaaccaaacatgt 18690628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 161 - 204
Target Start/End: Original strand, 6208060 - 6208103
Alignment:
161 agaattgattttgagtgaattgattctaactaaaagtgagttga 204  Q
    ||||||||||||||||||||||||| | | ||||||||||||||    
6208060 agaattgattttgagtgaattgattttgattaaaagtgagttga 6208103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 315 - 346
Target Start/End: Complemental strand, 7280477 - 7280446
Alignment:
315 aatcaattctacttgaaagcaaccaaacatgt 346  Q
    ||||||||||||||||||||||||||||||||    
7280477 aatcaattctacttgaaagcaaccaaacatgt 7280446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 166 - 229
Target Start/End: Original strand, 28466914 - 28466977
Alignment:
166 tgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggata 229  Q
    ||||||||||||||||||||||  |||||| ||||||||  ||| |||| ||| ||||||||||    
28466914 tgattttgagtgaattgattctggctaaaattgagttgaaggtatagtggtttatgtttggata 28466977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 166 - 229
Target Start/End: Complemental strand, 34736819 - 34736756
Alignment:
166 tgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggata 229  Q
    ||||||||||||||||||||||  |||||| ||||||||  ||| |||| ||| ||||||||||    
34736819 tgattttgagtgaattgattctggctaaaattgagttgaaggtatagtggtttatgtttggata 34736756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 264 - 322
Target Start/End: Complemental strand, 2234571 - 2234513
Alignment:
264 gtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    |||| ||||||||||||||||||||||||| |   | |||||||||||| |||||||||    
2234571 gtgttaaaatcaattctagaatcaaaagcttcagtttttagcttcaagttgaatcaatt 2234513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 249 - 324
Target Start/End: Original strand, 6654102 - 6654179
Alignment:
249 ttgaactataaatgt--gtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    ||||||||||||| |  |||| |||||||| |||||||| |||||||||  ||| ||||||||||| |||| ||||||    
6654102 ttgaactataaatttctgtgtgaaaatcaaatctagaattaaaagctacaaatcctagcttcaagtagaattaattct 6654179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 239 - 322
Target Start/End: Complemental strand, 16540190 - 16540105
Alignment:
239 taaaattgagttgaactataaatgtgt--gtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    ||||| |||||| |||||||||| |||  || ||| ||||||| | |||||||||||||  ||| ||||||||||| |||||||||    
16540190 taaaagtgagtttaactataaatatgtaagtgaaactcaattcaataatcaaaagctacaaatcctagcttcaagtagaatcaatt 16540105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 234
Target Start/End: Complemental strand, 882842 - 882773
Alignment:
165 ttgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattc 234  Q
    |||| |||||||||||||||||||  ||||| ||||||||  ||| | |||||| |||||||||| ||||    
882842 ttgagtttgagtgaattgattctagttaaaattgagttgaaggtaaaatgatttatgtttggatacattc 882773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 19601379 - 19601420
Alignment:
163 aattgattttgagtgaattgattctaactaaaagtgagttga 204  Q
    |||||||||||| |||||||||| ||||||| ||||||||||    
19601379 aattgattttgattgaattgattttaactaatagtgagttga 19601420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 264 - 293
Target Start/End: Original strand, 34027446 - 34027475
Alignment:
264 gtgtaaaaatcaattctagaatcaaaagct 293  Q
    ||||||||||||||||||||||||||||||    
34027446 gtgtaaaaatcaattctagaatcaaaagct 34027475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 211 - 291
Target Start/End: Complemental strand, 6653926 - 6653843
Alignment:
211 agtgatttgtgtttggatagattctttt-taaaattgagttgaactataaatgtg--tgtaaaaatcaattctagaatcaaaag 291  Q
    ||||||||||||||||||| | || | | ||||| |||||| |||||||||| ||  ||| ||| |||||||||||||||||||    
6653926 agtgatttgtgtttggatacaatcatatgtaaaagtgagttaaactataaatttgcatgtgaaactcaattctagaatcaaaag 6653843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 156 - 204
Target Start/End: Original strand, 10400661 - 10400709
Alignment:
156 tgaaaagaattgattttgagtgaattgattctaactaaaagtgagttga 204  Q
    |||||||||||||||||||||||| ||||||   |||| ||||||||||    
10400661 tgaaaagaattgattttgagtgaactgattccgtctaagagtgagttga 10400709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 265 - 293
Target Start/End: Complemental strand, 10874549 - 10874521
Alignment:
265 tgtaaaaatcaattctagaatcaaaagct 293  Q
    |||||||||||||||||||||||||||||    
10874549 tgtaaaaatcaattctagaatcaaaagct 10874521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 211 - 323
Target Start/End: Original strand, 25195341 - 25195452
Alignment:
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgta--aaaatcaattctagaatcaaaagctacttatcttagcttc 308  Q
    ||||||||||||||||||| ||| | | ||||| ||||||||| | ||||| ||||||  |||||||||| |||||| |||| ||||  |||   |||||    
25195341 agtgatttgtgtttggatacatt-tatgtaaaagtgagttgaattgtaaatttgtgtatgaaaatcaattatagaatgaaaaactacaaatc--cgcttc 25195437  T
309 aagtggaatcaattc 323  Q
    |||| ||||||||||    
25195438 aagtagaatcaattc 25195452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 168 - 204
Target Start/End: Original strand, 34026417 - 34026453
Alignment:
168 attttgagtgaattgattctaactaaaagtgagttga 204  Q
    ||||||||||||||||||||  |||||||||||||||    
34026417 attttgagtgaattgattctggctaaaagtgagttga 34026453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 67; Significance: 1e-29; HSPs: 20)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 211 - 357
Target Start/End: Complemental strand, 43501233 - 43501088
Alignment:
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaa 310  Q
    ||||||||||||||| ||| |||| | | |||| ||||||||| ||||| | ||||| | ||||||||||| |||||||||||||  ||| ||| |||||    
43501233 agtgatttgtgtttgtatacattcatgt-aaaactgagttgaattataattttgtgttagaatcaattctaaaatcaaaagctacaaatcctagtttcaa 43501135  T
311 gtggaatcaattctacttgaaagcaaccaaacatgtaggaatcaatt 357  Q
    || |||||||||||||||||||||||||||||||||  |||||||||    
43501134 gtagaatcaattctacttgaaagcaaccaaacatgtcagaatcaatt 43501088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 264 - 322
Target Start/End: Complemental strand, 42741033 - 42740975
Alignment:
264 gtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    ||||||||||||||||||||||||||||||||  ||||||||||||||| |||||||||    
42741033 gtgtaaaaatcaattctagaatcaaaagctacaaatcttagcttcaagtagaatcaatt 42740975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 189 - 291
Target Start/End: Complemental strand, 33502366 - 33502266
Alignment:
189 actaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataa--atgtgtgtaaaaatcaattctagaatc 286  Q
    ||||||||| ||||||  ||| |||||||||||||||||||    | || ||||| |||||||||||||||  ||||||||||||||||||| |||||||    
33502366 actaaaagtaagttgaatgtaaagtgatttgtgtttggata----cattgtaaaagtgagttgaactataaatatgtgtgtaaaaatcaattttagaatc 33502271  T
287 aaaag 291  Q
    |||||    
33502270 aaaag 33502266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 167 - 322
Target Start/End: Complemental strand, 30503361 - 30503207
Alignment:
167 gattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatg--tg 264  Q
    ||||||||||||||||||||| ||||||||| ||||||  ||| | |||||| ||||||||||   || | | ||||| ||||| || | |||||   ||    
30503361 gattttgagtgaattgattctgactaaaagttagttgaaggtaaactgatttttgtttggataa--tcgtgtaaaaat-gagttcaagtttaaattcatg 30503265  T
265 tgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    |||||||||||||||| ||||||||||||||  ||| | ||||||||| |||||||||    
30503264 tgtaaaaatcaattcttgaatcaaaagctacgaatcctggcttcaagtagaatcaatt 30503207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 169 - 295
Target Start/End: Original strand, 4894090 - 4894217
Alignment:
169 ttttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaa--tgtgtg 266  Q
    |||||||||||||||||||| |||||| | ||||||  ||| |||||||| ||||| |||| ||||  ||||||| ||| |||||  |||||  || ||     
4894090 ttttgagtgaattgattctagctaaaattaagttgaaggtaaagtgatttatgtttagatacattc-atttaaaagtgacttgaataataaatttgagta 4894188  T
267 taaaaatcaattctagaatcaaaagctac 295  Q
    ||| |||||||| ||||||||||||||||    
4894189 taataatcaattatagaatcaaaagctac 4894217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 190 - 324
Target Start/End: Complemental strand, 16518909 - 16518775
Alignment:
190 ctaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtg--taaaaatcaattctagaatca 287  Q
    |||||||||||||||| ||| | ||||||||||||||||| |||| | | |||| ||||||||||||||||| ||||  ||||| |||  | || |||||    
16518909 ctaaaagtgagttgagggtaaaatgatttgtgtttggatacattcatgt-aaaagtgagttgaactataaatttgtgcgtaaaagtcatct-tataatca 16518812  T
288 aaagctacttatcttagcttcaagtggaatcaattct 324  Q
    ||||||||  ||| || |||| ||| |||||||||||    
16518811 aaagctacaaatcctatcttctagtagaatcaattct 16518775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 229
Target Start/End: Original strand, 7632521 - 7632587
Alignment:
163 aattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggata 229  Q
    ||||||||||||||||||| ||||| | ||||||||| ||||  ||| |||||| ||||||||||||    
7632521 aattgattttgagtgaatttattctgattaaaagtgaattgaaggtaaagtgatatgtgtttggata 7632587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 211 - 293
Target Start/End: Complemental strand, 22536108 - 22536025
Alignment:
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgt--aaaaatcaattctagaatcaaaagct 293  Q
    ||||||||||||||||||| ||| | | ||||| |||||| |||||||||| |||||  |||||| ||||||| |||||||||||    
22536108 agtgatttgtgtttggatacatt-tatgtaaaaatgagtttaactataaatatgtgtgcaaaaattaattctaaaatcaaaagct 22536025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 211 - 325
Target Start/End: Original strand, 33019131 - 33019246
Alignment:
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgt--gtgtaaaaatcaattctagaatcaaaagctacttatcttagcttc 308  Q
    ||||||||||||||||||  |||| | | |||| ||||||||||||||||| |  |||| ||||||||||||| || ||||||||||  ||  |||||||    
33019131 agtgatttgtgtttggatgcattcatgt-aaaagtgagttgaactataaatttatgtgtgaaaatcaattctaaaaccaaaagctacaaattctagcttc 33019229  T
309 aagtggaatcaattcta 325  Q
    || |  |||||||||||    
33019230 aaatataatcaattcta 33019246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 209 - 325
Target Start/End: Complemental strand, 12037172 - 12037056
Alignment:
209 acagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgta--aaaatcaattctagaatcaaaagctacttatcttagct 306  Q
    |||||| ||||||||| |||| |||| | | ||||  ||||||||| |||||| ||| ||  |||||||||| ||||||||||||||||  || |||| |    
12037172 acagtggtttgtgtttcgataaattcatctaaaaa--gagttgaaccataaatttgtttatgaaaatcaattgtagaatcaaaagctacaaattttagtt 12037075  T
307 tcaagtggaatcaattcta 325  Q
    |||| | ||||||||||||    
12037074 tcaactagaatcaattcta 12037056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 315 - 346
Target Start/End: Complemental strand, 7630403 - 7630372
Alignment:
315 aatcaattctacttgaaagcaaccaaacatgt 346  Q
    ||||||||||||||||||||||||||||||||    
7630403 aatcaattctacttgaaagcaaccaaacatgt 7630372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 261 - 320
Target Start/End: Complemental strand, 42982603 - 42982544
Alignment:
261 tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaa 320  Q
    |||||||||||||||||||| ||||||||||||||   |  ||||||||||| |||||||    
42982603 tgtgtgtaaaaatcaattctggaatcaaaagctacaatttctagcttcaagtagaatcaa 42982544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 319
Target Start/End: Original strand, 2002721 - 2002779
Alignment:
261 tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatca 319  Q
    |||||||||||||||||| |||||| |||| ||||  ||| ||||||||||| ||||||    
2002721 tgtgtgtaaaaatcaattttagaatgaaaaactacaaatcctagcttcaagtagaatca 2002779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 287 - 357
Target Start/End: Original strand, 7632640 - 7632710
Alignment:
287 aaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatgtaggaatcaatt 357  Q
    |||||||||  || |||||||||||| | |||| ||||||| ||| |||| ||||||||| ||||||||||    
7632640 aaaagctacaaattttagcttcaagtaggatcagttctactcgaaggcaatcaaacatgttggaatcaatt 7632710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 239 - 285
Target Start/End: Original strand, 15928460 - 15928506
Alignment:
239 taaaattgagttgaactataaatgtgtgtaaaaatcaattctagaat 285  Q
    ||||| |||||| |||| ||||||||||||| |||||||||||||||    
15928460 taaaagtgagttaaactttaaatgtgtgtaagaatcaattctagaat 15928506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 194 - 324
Target Start/End: Complemental strand, 44439381 - 44439249
Alignment:
194 aagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtg--tgtaaaaatcaattctagaatcaaaag 291  Q
    ||||||||| |  ||| |||||||| ||||||||||  || | | ||||| |||||||||| |||||| ||  ||| |||||||||| ||||||||||||    
44439381 aagtgagttaaatgtaaagtgatttatgtttggatatgtt-tatgtaaaagtgagttgaacaataaatttgagtgttaaaatcaattttagaatcaaaag 44439283  T
292 ctacttatcttagcttcaag-tggaatcaattct 324  Q
    || |  || ||||||||||| | |||||||||||    
44439282 ctccaaattttagcttcaagttagaatcaattct 44439249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 140 - 185
Target Start/End: Original strand, 11650661 - 11650706
Alignment:
140 atgttttgttttgagttgaaaagaattgattttgagtgaattgatt 185  Q
    |||||| |||||| ||||| || |||||||||||||||||||||||    
11650661 atgtttggttttgcgttgacaaaaattgattttgagtgaattgatt 11650706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 162 - 234
Target Start/End: Complemental strand, 3854012 - 3853940
Alignment:
162 gaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattc 234  Q
    |||||||||||||  ||||||||| | | ||||||||||||||  ||| | |||||| |||||||||| ||||    
3854012 gaattgattttgatagaattgattttgattaaaagtgagttgaatgtaaattgatttatgtttggatacattc 3853940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 137 - 185
Target Start/End: Original strand, 11759746 - 11759794
Alignment:
137 tgtatgttttgttttgagttgaaaagaattgattttgagtgaattgatt 185  Q
    ||||||||| ||| |||| |||||| |||||| ||||||||||||||||    
11759746 tgtatgtttggttatgaggtgaaaaaaattgagtttgagtgaattgatt 11759794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 137 - 185
Target Start/End: Original strand, 37745785 - 37745833
Alignment:
137 tgtatgttttgttttgagttgaaaagaattgattttgagtgaattgatt 185  Q
    ||||||||| |||||| | ||| || |||||||||||||||||||||||    
37745785 tgtatgtttggttttgcggtgataataattgattttgagtgaattgatt 37745833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 66; Significance: 4e-29; HSPs: 15)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 162 - 336
Target Start/End: Complemental strand, 45557524 - 45557349
Alignment:
162 gaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaa- 260  Q
    ||||||||||||| |||||||||||| ||||||||||||||||  ||| ||||||||||||||||||| ||||  | ||||| |||||||| ||| |||     
45557524 gaattgattttgaatgaattgattctgactaaaagtgagttgaaggtaaagtgatttgtgtttggatacattc-atgtaaaagtgagttgagctacaaat 45557426  T
261 -tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaa 336  Q
     ||||||||||||||||| ||||||| |||||||||  ||  ||||||| ||   |||||||||||||  |||||||    
45557425 ttgtgtgtaaaaatcaatcctagaattaaaagctacagattctagcttctagcaaaatcaattctactcaaaagcaa 45557349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 160 - 357
Target Start/End: Complemental strand, 17112006 - 17111820
Alignment:
160 aagaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataa 259  Q
    |||||||||||||||||||||||||| | ||||||| ||| |||   ||| ||||||||||||||||||  |||| | | ||||| |||| ||| |||||    
17112006 aagaattgattttgagtgaattgattttgactaaaattgaattgtaggtaaagtgatttgtgtttggatgcattcatgtaaaaat-gagtagaattataa 17111908  T
260 atgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatgtaggaatcaatt 357  Q
    || |||||  ||          ||||||||||||||  ||| ||||||||||| |||||||||||||| ||||||||||||||||||  |||||||||    
17111907 atttgtgtgtaa----------gaatcaaaagctacaaatcatagcttcaagtagaatcaattctactcgaaagcaaccaaacatgtcagaatcaatt 17111820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 168 - 346
Target Start/End: Original strand, 38123598 - 38123777
Alignment:
168 attttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtg--t 265  Q
    ||||||||| |||||||| | ||||||| ||||||||  ||| ||| ||||||||| ||| | |||| | | |||| |||||||| | |||||| ||  |    
38123598 attttgagtaaattgattatgactaaaattgagttgaaggtaaagtaatttgtgttcggacacattcatgt-aaaagtgagttgaccaataaatttgagt 38123696  T
266 gtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatgt 346  Q
    |||||||||||||||||||| | |||||||   |  ||||||||||| ||||||||||||||| | || ||||||||||||    
38123697 gtaaaaatcaattctagaattagaagctacaatttctagcttcaagtagaatcaattctactttataggaaccaaacatgt 38123777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 178 - 324
Target Start/End: Complemental strand, 40491721 - 40491574
Alignment:
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatca 275  Q
    |||||||| | ||||||||||||||||  ||| |||||||| | |||||||| |||| | | |||| |||||| |||| |||||  |||||||||| |||    
40491721 aattgattttgactaaaagtgagttgaaggtaaagtgatttatttttggatacattcatgt-aaaagtgagttaaactttaaatttgtgtgtaaaagtca 40491623  T
276 attctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    ||||||||||||||||||||  | |||| |||||||| || ||||||||    
40491622 attctagaatcaaaagctacaaaacttaacttcaagtagagtcaattct 40491574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 240 - 324
Target Start/End: Original strand, 41386818 - 41386904
Alignment:
240 aaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    |||| ||||||||| |||||||  ||||||||| |||||||||||||| |||||||||  ||| ||||||||||| |||||||||||    
41386818 aaaagtgagttgaattataaatttgtgtgtaaatatcaattctagaattaaaagctacaaatcctagcttcaagtagaatcaattct 41386904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 234
Target Start/End: Original strand, 40561687 - 40561756
Alignment:
165 ttgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattc 234  Q
    ||||||||||||||||||||||||   |||| |||||||| |||| |||||||| |||||||||| ||||    
40561687 ttgattttgagtgaattgattctagtaaaaattgagttgaaagtaaagtgatttatgtttggatacattc 40561756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 264 - 322
Target Start/End: Original strand, 30182325 - 30182383
Alignment:
264 gtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    |||||||||| |||||||||||||||||||||   | |||||||||||| |||||||||    
30182325 gtgtaaaaattaattctagaatcaaaagctacaatttttagcttcaagtagaatcaatt 30182383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 137 - 234
Target Start/End: Complemental strand, 29842268 - 29842173
Alignment:
137 tgtatgttttgttttgagttgaaaagaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattc 234  Q
    ||||||||| ||| || ||||| |||| ||| |||||||||| |||||| | ||||||| || |||||  ||| ||||||||||||||||||||||||    
29842268 tgtatgtttggttctgtgttgacaagacttggttttgagtga-ttgattttgactaaaa-tgggttgaaggtaaagtgatttgtgtttggatagattc 29842173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 163 - 234
Target Start/End: Original strand, 29829296 - 29829367
Alignment:
163 aattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattc 234  Q
    |||||||| ||| ||||||||||||  |||||| ||||||||  ||| |||||||| |||||||||| ||||    
29829296 aattgattctgaatgaattgattctggctaaaaatgagttgaatgtaaagtgatttatgtttggatacattc 29829367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 163 - 234
Target Start/End: Original strand, 33853411 - 33853482
Alignment:
163 aattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattc 234  Q
    |||||||||| ||||||||||||||  |||| ||||||||||   || |||||||| |||||||||| ||||    
33853411 aattgatttttagtgaattgattctggctaagagtgagttgaagctaaagtgatttatgtttggatacattc 33853482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 205
Target Start/End: Original strand, 36270832 - 36270873
Alignment:
164 attgattttgagtgaattgattctaactaaaagtgagttgag 205  Q
    ||||||||||| |||||||||| ||| |||||||||||||||    
36270832 attgattttgaatgaattgattttaattaaaagtgagttgag 36270873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 239 - 324
Target Start/End: Original strand, 597948 - 598034
Alignment:
239 taaaattgagttgaactataaatgt--gtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    ||||| |||||||||| |||||| |  ||| || |||||||| ||||||| ||||||||  || |||||||||||| |||||||||||    
597948 taaaagtgagttgaacaataaattttagtgcaagaatcaattatagaatcgaaagctaca-attttagcttcaagtagaatcaattct 598034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 165 - 229
Target Start/End: Complemental strand, 15050449 - 15050385
Alignment:
165 ttgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggata 229  Q
    |||||||||||| ||||||||||| |||||| ||| || || ||| ||| |||| ||||||||||    
15050449 ttgattttgagttaattgattctagctaaaaatgaatttagggtaaagtaatttatgtttggata 15050385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 139 - 187
Target Start/End: Complemental strand, 40491774 - 40491726
Alignment:
139 tatgttttgttttgagttgaaaagaattgattttgagtgaattgattct 187  Q
    ||||||| ||| || | ||| ||||||||||||||||||||||||||||    
40491774 tatgtttggttctgcggtgacaagaattgattttgagtgaattgattct 40491726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 305 - 357
Target Start/End: Original strand, 48159006 - 48159058
Alignment:
305 cttcaagtggaatcaattctacttgaaagcaaccaaacatgtaggaatcaatt 357  Q
    |||||| | |||||||||||||| |||||||||||||||| |  |||||||||    
48159006 cttcaaatcgaatcaattctactggaaagcaaccaaacatctgagaatcaatt 48159058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 63; Significance: 3e-27; HSPs: 27)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 245 - 358
Target Start/End: Original strand, 15677823 - 15677939
Alignment:
245 tgagttgaactataaatgtgtgt---aaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaa 341  Q
    ||||||||||||||||| |||||   |||||||||||||| ||||||||||||   ||| ||||||||||| |||||||||||| |||||||||||||||    
15677823 tgagttgaactataaatttgtgtgtaaaaaatcaattctataatcaaaagctataaatcctagcttcaagtagaatcaattctatttgaaagcaaccaaa 15677922  T
342 catgtaggaatcaattg 358  Q
    |||||  ||||||||||    
15677923 catgtcagaatcaattg 15677939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 178 - 320
Target Start/End: Complemental strand, 32928035 - 32927892
Alignment:
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatca 275  Q
    |||||||||| ||||||| ||||||||  | | ||||||||||||||||||| |||| | | |||| |||||||||||||||||  |||||||||||| |    
32928035 aattgattcttactaaaattgagttgaaggcaaagtgatttgtgtttggatacattcatgt-aaaagtgagttgaactataaatttgtgtgtaaaaatga 32927937  T
276 attctagaatcaaaagctacttatcttagcttcaagtggaatcaa 320  Q
    |||||| |||||||||||||  ||| ||||||||||| |||||||    
32927936 attctataatcaaaagctacaaatcctagcttcaagtagaatcaa 32927892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 239 - 322
Target Start/End: Complemental strand, 38868581 - 38868496
Alignment:
239 taaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    |||||||||||||||||||||||  |||||| |||||||||| ||||| ||||||||||  ||||||||||||||| |||||||||    
38868581 taaaattgagttgaactataaatttgtgtgtgaaaatcaattatagaaccaaaagctacaaatcttagcttcaagtagaatcaatt 38868496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 261 - 344
Target Start/End: Original strand, 32994268 - 32994351
Alignment:
261 tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacat 344  Q
    ||||| ||||||||||||||||| ||||||||||   ||| ||||||||||| |||||||||||||  ||||||||||||||||    
32994268 tgtgtataaaaatcaattctagactcaaaagctagaaatcatagcttcaagtagaatcaattctacacgaaagcaaccaaacat 32994351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 191 - 355
Target Start/End: Original strand, 38335816 - 38335981
Alignment:
191 taaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtg--taaaaatcaattctagaatcaa 288  Q
    ||||||||||||||  ||  | ||||||||||| ||||| |||| | | |||| ||||||  | ||||||| ||||  ||||||||||||||| ||||||    
38335816 taaaagtgagttgaaggtgaattgatttgtgttcggatacattcatgt-aaaagtgagttagaatataaatttgtgcgtaaaaatcaattctaaaatcaa 38335914  T
289 aagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatgtaggaatcaa 355  Q
    |||| ||  ||||||||||||| ||||||||||| |||| |||| ||| |||||||||  |||||||    
38335915 aagcaacaaatcttagcttcaactggaatcaattatactcgaaaacaaacaaacatgtcagaatcaa 38335981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 239 - 322
Target Start/End: Original strand, 13384656 - 13384741
Alignment:
239 taaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    ||||| |||||||||||||||||  |||||| |||||||||||||||||||||||||||  || |||||||||| | |||||||||    
13384656 taaaagtgagttgaactataaatttgtgtgtgaaaatcaattctagaatcaaaagctacaaattttagcttcaaatagaatcaatt 13384741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 178 - 325
Target Start/End: Original strand, 26100088 - 26100236
Alignment:
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatca 275  Q
    |||||||||| |||||||  |||||||  ||| ||  ||||||||||||||  ||| | | ||||| |||||||||| ||||||  ||||||||||||||    
26100088 aattgattctgactaaaaacgagttgaaggtaaagctatttgtgtttggatgcatt-tatgtaaaagtgagttgaaccataaatttgtgtgtaaaaatca 26100186  T
276 attctagaatcaaaagctacttatcttagcttcaagtggaatcaattcta 325  Q
    ||| ||||||||||||||||  ||| ||||||||| | ||| ||||||||    
26100187 attatagaatcaaaagctacaaatcctagcttcaaatagaaccaattcta 26100236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 178 - 320
Target Start/End: Complemental strand, 35495133 - 35494990
Alignment:
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatca 275  Q
    ||||| |||| | |||||||| |||||   || ||||||||||||||||||| |||| | | |||| | |||||||||||| ||  ||||||||||| ||    
35495133 aattgcttctgattaaaagtgggttgaatataaagtgatttgtgtttggatatattcatgt-aaaagtaagttgaactatagatttgtgtgtaaaaaaca 35495035  T
276 attctagaatcaaaagctacttatcttagcttcaagtggaatcaa 320  Q
    ||||||||||||||||||||  ||| |||||||| || |||||||    
35495034 attctagaatcaaaagctacaaatcctagcttcatgtagaatcaa 35494990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 246 - 323
Target Start/End: Original strand, 4662912 - 4662991
Alignment:
246 gagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattc 323  Q
    ||||||||||||| ||  ||||||||||||||||||||||| ||||||||||  ||| ||||||||||| |||| |||||    
4662912 gagttgaactatacatttgtgtgtaaaaatcaattctagaaacaaaagctacaaatcctagcttcaagtagaataaattc 4662991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 269 - 325
Target Start/End: Original strand, 7244635 - 7244691
Alignment:
269 aaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattcta 325  Q
    |||||||||||||||||||||| |||| |||||||| ||||||| ||||||||||||    
7244635 aaaatcaattctagaatcaaaaactacatatcttagtttcaagtagaatcaattcta 7244691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 246 - 346
Target Start/End: Original strand, 18355859 - 18355959
Alignment:
246 gagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatg 345  Q
    |||||||||| ||||| |||||||||||||||| ||||||||||||  ||  ||| |||||||||   |||||||||||||| |||| ||| || |||||    
18355859 gagttgaactttaaatttgtgtaaaaatcaattttagaatcaaaagacacaaatcctagcttcaatcagaatcaattctactcgaaaacaatcatacatg 18355958  T
346 t 346  Q
    |    
18355959 t 18355959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 160 - 311
Target Start/End: Complemental strand, 32767548 - 32767396
Alignment:
160 aagaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttt-taaaattgagttgaactata 258  Q
    ||||||| |||||||||||||||||| |   |||||||||||||   ||| | |||||| |||||||||| |||| | | ||||| |||||||||| |||    
32767548 aagaattaattttgagtgaattgattatg--taaaagtgagttggatgtaaattgatttatgtttggatacattcatgtgtaaaagtgagttgaacaata 32767451  T
259 aatgt--gtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaag 311  Q
    ||| |  |||||||| ||| |||| |||||||||||||   ||||||||||||||    
32767450 aatttaagtgtaaaagtcagttctcgaatcaaaagctatgaatcttagcttcaag 32767396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 283
Target Start/End: Original strand, 18356031 - 18356135
Alignment:
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgtaaaaatcaat 277  Q
    |||||||||||||||||||||||||||  |||  | | ||| |||| ||||| ||| | | ||||  ||||||||| ||||||| |||||||||||||||    
18356031 aattgattctaactaaaagtgagttgaaggtaagggggtttatgttcggatacatt-tatctaaacgtgagttgaattataaatttgtgtaaaaatcaat 18356129  T
278 tctaga 283  Q
    ||||||    
18356130 tctaga 18356135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 343
Target Start/End: Complemental strand, 30099051 - 30098887
Alignment:
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgtaaaaatcaat 277  Q
    |||||||||| || |||||||| | ||  ||| |||||||| || | ||||| ||| | | ||||| |||||| |||||||||| | ||||||||| |||    
30099051 aattgattctgaccaaaagtgaatagaatgtaaagtgatttatgatcggatatatt-tatgtaaaagtgagttaaactataaatttttgtaaaaattaat 30098953  T
278 tctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaaca 343  Q
    ||||||||| ||||||||  ||  ||||||||| |  |||||||| |||||||   ||||||||||    
30098952 tctagaatcgaaagctacaaattctagcttcaaataaaatcaattttacttgatcacaaccaaaca 30098887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 168 - 224
Target Start/End: Complemental strand, 7720338 - 7720282
Alignment:
168 attttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgttt 224  Q
    |||| ||||||||||||||| ||||||  ||||||||||||| ||||||||||||||    
7720338 atttcgagtgaattgattctgactaaatatgagttgagagtaaagtgatttgtgttt 7720282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 211 - 324
Target Start/End: Complemental strand, 37684515 - 37684401
Alignment:
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgta--aaaatcaattctagaatcaaaagctacttatcttagcttc 308  Q
    ||||||||||||||||||| ||| | | ||||| ||||||||| ||||||| | || |  |||||||||| ||||||||||||| ||  ||| || ||||    
37684515 agtgatttgtgtttggatacatt-tatgtaaaagtgagttgaattataaatttttgcattaaaatcaattttagaatcaaaagccacaaatcctaacttc 37684417  T
309 aagtggaatcaattct 324  Q
    |||| |||||||||||    
37684416 aagtagaatcaattct 37684401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 177 - 295
Target Start/End: Original strand, 16972005 - 16972124
Alignment:
177 gaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaa--tgtgtgtaaaaatc 274  Q
    ||||||||||  ||||||||||||||||  ||| | ||||||||||||| ||| ||||  | ||||| ||| |||||| |||||  ||||| ||||||||    
16972005 gaattgattcagactaaaagtgagttgaaggtaaaatgatttgtgtttgaatacattc-atgtaaaagtgatttgaacaataaatttgtgtttaaaaatc 16972103  T
275 aattctagaatcaaaagctac 295  Q
    ||||||| ||| |||| ||||    
16972104 aattctaaaattaaaaactac 16972124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 161 - 229
Target Start/End: Original strand, 3619066 - 3619133
Alignment:
161 agaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggata 229  Q
    |||||||||||||| |||||||||||| |  |||||||||||||| | | | |||||||||||||||||    
3619066 agaattgattttgaatgaattgattctgatcaaaagtgagttgagtg-aaattgatttgtgtttggata 3619133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 315 - 346
Target Start/End: Complemental strand, 7533784 - 7533753
Alignment:
315 aatcaattctacttgaaagcaaccaaacatgt 346  Q
    ||||||||||||||||||||||||||||||||    
7533784 aatcaattctacttgaaagcaaccaaacatgt 7533753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 246 - 322
Target Start/End: Original strand, 44141059 - 44141137
Alignment:
246 gagttgaactataaa--tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    |||||||||||||||  | ||||| |||||||| ||||||||||||| ||||  ||| || |||||||| |||||||||    
44141059 gagttgaactataaaattatgtgtgaaaatcaactctagaatcaaaaactacaaatcctaacttcaagtagaatcaatt 44141137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 239 - 322
Target Start/End: Original strand, 6027051 - 6027136
Alignment:
239 taaaattgagttgaactataaatgtgtgta--aaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    ||||| |||||| |||| ||||| ||| ||  ||||||||||||||||||||||||||| ||  ||| || ||||| |||||||||    
6027051 taaaaatgagttaaactgtaaatttgtatatgaaaatcaattctagaatcaaaagctacatactttaactacaagtagaatcaatt 6027136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 255 - 324
Target Start/End: Original strand, 36200154 - 36200221
Alignment:
255 tataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    ||||||||||||  |||||||||||||||||||||| | ||  ||| || |||||||| |||||||||||    
36200154 tataaatgtgtg--aaaatcaattctagaatcaaaatcgacaaatcataacttcaagttgaatcaattct 36200221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 267 - 307
Target Start/End: Complemental strand, 75573 - 75533
Alignment:
267 taaaaatcaattctagaatcaaaagctacttatcttagctt 307  Q
    |||||||||||||||| ||||||||||||| || |||||||    
75573 taaaaatcaattctaggatcaaaagctactaattttagctt 75533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 205
Target Start/End: Original strand, 8130101 - 8130145
Alignment:
161 agaattgattttgagtgaattgattctaactaaaagtgagttgag 205  Q
    |||||||||||||| ||||||||||| || | |||||||||||||    
8130101 agaattgattttgaatgaattgattcgaatttaaagtgagttgag 8130145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 137 - 185
Target Start/End: Original strand, 20505402 - 20505449
Alignment:
137 tgtatgttttgttttgagttgaaaagaattgattttgagtgaattgatt 185  Q
    |||| ||||||||||| || || ||||||||||||||||||||||||||    
20505402 tgtaagttttgttttgtgt-gacaagaattgattttgagtgaattgatt 20505449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 205
Target Start/End: Original strand, 24297589 - 24297633
Alignment:
161 agaattgattttgagtgaattgattctaactaaaagtgagttgag 205  Q
    |||||||||||||| ||||||||||| ||  ||||||||||||||    
24297589 agaattgattttgaatgaattgattcgaatcaaaagtgagttgag 24297633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 229
Target Start/End: Original strand, 41289055 - 41289123
Alignment:
161 agaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggata 229  Q
    |||||||| |||||| ||||||||| ||| ||||||||||||||  ||  | |||||| ||||||||||    
41289055 agaattgagtttgagagaattgattttaattaaaagtgagttgattgtgaattgatttatgtttggata 41289123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 27)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 178 - 312
Target Start/End: Complemental strand, 7524256 - 7524121
Alignment:
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatca 275  Q
    ||||||||||||||||||||||| | |  ||| ||||||||||||||||| | ||| | | ||||| |||||||||||||||||  ||||||||||||||    
7524256 aattgattctaactaaaagtgagctcaaggtaaagtgatttgtgtttggacacatt-tatgtaaaagtgagttgaactataaatttgtgtgtaaaaatca 7524158  T
276 attctagaatcaaaagctacttatcttagcttcaagt 312  Q
    |||||| |||||||||||||  ||| || ||||||||    
7524157 attctataatcaaaagctacaaatcctaacttcaagt 7524121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 239 - 357
Target Start/End: Complemental strand, 11049333 - 11049213
Alignment:
239 taaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaa 336  Q
    ||||| ||| |||||||||||||  ||||||||||||||||| ||||||||||||||||  ||| ||||||||||| ||||| |||||||| ||||||||    
11049333 taaaagtgacttgaactataaatttgtgtgtaaaaatcaattttagaatcaaaagctacaaatcctagcttcaagtagaatcgattctactcgaaagcaa 11049234  T
337 ccaaacatgtaggaatcaatt 357  Q
      ||||||||  |||||||||    
11049233 tgaaacatgtctgaatcaatt 11049213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 211 - 319
Target Start/End: Complemental strand, 30557612 - 30557505
Alignment:
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaa 310  Q
    ||||||||||||||||||| |||| | | |||| ||||||||||||||||| ||||| |||||||||||||||||||||| ||||  ||| |||||||||    
30557612 agtgatttgtgtttggatacattcatat-aaaagtgagttgaactataaatttgtgtgaaaatcaattctagaatcaaaaactacaaatcctagcttcaa 30557514  T
311 gtggaatca 319  Q
     | ||||||    
30557513 ctagaatca 30557505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 163 - 340
Target Start/End: Original strand, 28287260 - 28287441
Alignment:
163 aattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttt--taaaattgagttgaactataaa 260  Q
    |||||| ||||||||||||||||||| |||||||||||||||  | | | |  ||| ||||| |||| |||  | |  ||||| | |||||||| |||||    
28287260 aattgactttgagtgaattgattctagctaaaagtgagttgaatggaaactagtttatgtttagatatatttatgtagtaaaagttagttgaacaataaa 28287359  T
261 tgtg--tgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaa 340  Q
    | ||  ||| ||||||||||||| |||||||||||||  ||| | ||||||||| ||| ||||||||||  |||||||||||    
28287360 tttgagtgttaaaatcaattctaaaatcaaaagctacaaatccttgcttcaagtagaaccaattctactcaaaagcaaccaa 28287441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 239 - 325
Target Start/End: Complemental strand, 6021887 - 6021799
Alignment:
239 taaaattgagttgaactataaa--tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattcta 325  Q
    ||||| |||||||||| |||||  || ||||||||||| ||| |||||||||||||||| |||| ||||||||||| ||||| ||||||    
6021887 taaaagtgagttgaaccataaacttgagtgtaaaaatctattatagaatcaaaagctacatatcctagcttcaagtagaatcgattcta 6021799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 263 - 304
Target Start/End: Original strand, 15084623 - 15084664
Alignment:
263 tgtgtaaaaatcaattctagaatcaaaagctacttatcttag 304  Q
    ||||||||||||||||||||||||||||||||||||||||||    
15084623 tgtgtaaaaatcaattctagaatcaaaagctacttatcttag 15084664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 163 - 322
Target Start/End: Original strand, 48548943 - 48549099
Alignment:
163 aattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatg 262  Q
    ||||||||||||||||||   || | ||| ||| ||||||||  ||| | |||||| ||||| |||| ||| | | ||||| |||||||||| |||||||    
48548943 aattgattttgagtgaatg--ttttgactcaaattgagttgaaggtaaaatgatttatgttttgatacatt-tatgtaaaagtgagttgaacaataaatg 48549039  T
263 tgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
     || ||||||||||||||||||||| |||||||   |  ||||||||||| |||||||||    
48549040 agtttaaaaatcaattctagaatcagaagctacaatttctagcttcaagtagaatcaatt 48549099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 161 - 290
Target Start/End: Complemental strand, 47053571 - 47053436
Alignment:
161 agaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttgga---tagattctt---tttaaaattgagttgaac 254  Q
    |||||||||||||||| |||||||||| ||||| |||||||||   ||| ||||||| |||||||||   | ||| | |   | ||||| |||||| |||    
47053571 agaattgattttgagtaaattgattctgactaatagtgagttggaggtaaagtgattggtgtttggaatttggatacattcatgtaaaagtgagttaaac 47053472  T
255 tataaatgtgtgtaaaaatcaattctagaatcaaaa 290  Q
    |||||||| |||||||| ||||||||||||| ||||    
47053471 tataaatgagtgtaaaattcaattctagaataaaaa 47053436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 215 - 322
Target Start/End: Complemental strand, 1514449 - 1514341
Alignment:
215 atttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagt 312  Q
    ||||||||||||||| |||| | | ||||| ||||||||| ||||||  ||||||||||||||||| || ||| |||||||||  ||| |||||||||||    
1514449 atttgtgtttggatacattcatgtaaaaat-gagttgaacaataaatttgtgtgtaaaaatcaattatataataaaaagctacaaatcctagcttcaagt 1514351  T
313 ggaatcaatt 322  Q
     |||| ||||    
1514350 agaataaatt 1514341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 238 - 325
Target Start/End: Original strand, 7790643 - 7790732
Alignment:
238 ttaaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattcta 325  Q
    |||||| |||||||||| ||||||  ||||||||||||||||| ||||||| ||| ||||  ||| || |||||||| ||||||||||||    
7790643 ttaaaagtgagttgaacaataaatttgtgtgtaaaaatcaattatagaatctaaatctacaaatcataacttcaagtagaatcaattcta 7790732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 161 - 295
Target Start/End: Complemental strand, 34915226 - 34915091
Alignment:
161 agaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaa 260  Q
    |||||||||||| |||||||| ||  | |||||||||||||||   ||| | |||||| |||||| ||| |||| | | |||| ||||||||| ||||||    
34915226 agaattgattttaagtgaatttataatgactaaaagtgagttgcaggtaaaatgatttatgtttgaatacattcatgt-aaaagtgagttgaattataaa 34915128  T
261 t--gtgtgtaaaaatcaattctagaatcaaaagctac 295  Q
       |||||| | |||||||||||||||||||||||||    
34915127 atggtgtgttagaatcaattctagaatcaaaagctac 34915091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 211 - 324
Target Start/End: Original strand, 2099662 - 2099777
Alignment:
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaa--tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttc 308  Q
    ||||||||||||||||||| |||| | | |||| |||||||| |||||||  | ||||| ||||||||||||| || ||||| ||||  |||| ||||||    
2099662 agtgatttgtgtttggatacattcatataaaaaatgagttgagctataaatttatgtgtgaaaatcaattctataaccaaaatctacaaatctcagcttc 2099761  T
309 aagtggaatcaattct 324  Q
    || |  ||||||||||    
2099762 aattacaatcaattct 2099777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 239 - 322
Target Start/End: Complemental strand, 3416163 - 3416078
Alignment:
239 taaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    |||||||||||| ||||||||||  |||||||||||||||||||| ||| |||| ||||  |||||| ||| ||||  ||||||||    
3416163 taaaattgagttaaactataaatttgtgtgtaaaaatcaattctaaaataaaaaactacaaatcttaactttaagtataatcaatt 3416078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 215 - 322
Target Start/End: Original strand, 28083867 - 28083975
Alignment:
215 atttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagt 312  Q
    ||||||||||||||| |||| | | |||| |||| ||||||  ||||  |||||||||||| |||| ||||||||||||||||  ||  |||||||||||    
28083867 atttgtgtttggatatattcatgt-aaaagtgagctgaacttgaaatttgtgtgtaaaaattaattatagaatcaaaagctacaaattctagcttcaagt 28083965  T
313 ggaatcaatt 322  Q
     |||||||||    
28083966 agaatcaatt 28083975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 263 - 312
Target Start/End: Original strand, 51500862 - 51500911
Alignment:
263 tgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagt 312  Q
    |||||||||||||||||||||||||||||||||  ||| ||| |||||||    
51500862 tgtgtaaaaatcaattctagaatcaaaagctacaaatcctaggttcaagt 51500911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 247 - 324
Target Start/End: Complemental strand, 30996117 - 30996038
Alignment:
247 agttgaactataaatgtgtg--taaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    ||||||||||||||||||||  ||||||  ||||||| ||| |||| ||||| ||| || |||||||| |||||||||||    
30996117 agttgaactataaatgtgtgggtaaaaactaattctataataaaaaactactaatcataacttcaagtagaatcaattct 30996038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 116 - 228
Target Start/End: Original strand, 47978314 - 47978426
Alignment:
116 ctgtttggatatacgactcactgtatgttttgttttgagttgaaaagaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtga 215  Q
    ||||||||||| ||  || | ||||||| | |||||| | ||| ||||||| |||||||||||||||||| |   ||||||||||||||  ||| |||||    
47978314 ctgtttggataaacagcttagtgtatgtatggttttgcggtgacaagaattcattttgagtgaattgattttgggtaaaagtgagttgaatgtaaagtga 47978413  T
216 tttgtgtttggat 228  Q
    ||| || ||||||    
47978414 tttatggttggat 47978426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 165 - 204
Target Start/End: Original strand, 6932113 - 6932152
Alignment:
165 ttgattttgagtgaattgattctaactaaaagtgagttga 204  Q
    |||||||||| |||||||||||| ||||||||||||||||    
6932113 ttgattttgaatgaattgattctgactaaaagtgagttga 6932152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 265 - 312
Target Start/End: Complemental strand, 27849194 - 27849147
Alignment:
265 tgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagt 312  Q
    |||||||||||||||||| ||||||||||||  ||| |||||||||||    
27849194 tgtaaaaatcaattctagtatcaaaagctacacatcgtagcttcaagt 27849147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 165 - 224
Target Start/End: Original strand, 47725162 - 47725221
Alignment:
165 ttgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgttt 224  Q
    |||||||||| |||||||||||| ||||||||||||||| | ||  | ||||||||||||    
47725162 ttgattttgaatgaattgattctgactaaaagtgagttgcgggtggattgatttgtgttt 47725221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 165 - 224
Target Start/End: Original strand, 47732154 - 47732213
Alignment:
165 ttgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgttt 224  Q
    |||||||||| |||||||||||| ||||||||||||||| | ||  | ||||||||||||    
47732154 ttgattttgaatgaattgattctgactaaaagtgagttgcgggtggattgatttgtgttt 47732213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 3016219 - 3016187
Alignment:
263 tgtgtaaaaatcaattctagaatcaaaagctac 295  Q
    |||||||| ||||||||||||||||||||||||    
3016219 tgtgtaaacatcaattctagaatcaaaagctac 3016187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 137 - 209
Target Start/End: Complemental strand, 14644905 - 14644833
Alignment:
137 tgtatgttttgttttgagttgaaaagaattgattttgagtgaattgattctaactaaaagtgagttgagagta 209  Q
    |||||||||  ||||| | ||| ||||||| ||||| |||||||||||| | |||||||||| ||||| ||||    
14644905 tgtatgtttgattttgcggtgacaagaattaattttaagtgaattgattatgactaaaagtgtgttgaaagta 14644833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 140 - 224
Target Start/End: Original strand, 15986125 - 15986209
Alignment:
140 atgttttgttttgagttgaaaagaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgttt 224  Q
    |||||||||| || | ||| || |||||||||||| |||||||||| | |||||  ||||||| | |||| |||| |||||||||    
15986125 atgttttgttctgcggtgacaataattgattttgactgaattgattttgactaactgtgagttcaaagtaaagtggtttgtgttt 15986209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 239 - 295
Target Start/End: Original strand, 26373546 - 26373601
Alignment:
239 taaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctac 295  Q
    ||||| |||| |||| | ||||| ||||||||| |||||||||||||||||||||||    
26373546 taaaagtgagatgaattttaaatttgtgtaaaa-tcaattctagaatcaaaagctac 26373601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 267 - 295
Target Start/End: Original strand, 31362237 - 31362265
Alignment:
267 taaaaatcaattctagaatcaaaagctac 295  Q
    |||||||||||||||||||||||||||||    
31362237 taaaaatcaattctagaatcaaaagctac 31362265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 137 - 185
Target Start/End: Complemental strand, 47899451 - 47899403
Alignment:
137 tgtatgttttgttttgagttgaaaagaattgattttgagtgaattgatt 185  Q
    ||||||||||||| |   |||| ||||||||||||||||||||||||||    
47899451 tgtatgttttgttatactttgacaagaattgattttgagtgaattgatt 47899403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 51; Significance: 4e-20; HSPs: 23)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 160 - 322
Target Start/End: Original strand, 8604543 - 8604709
Alignment:
160 aagaattgattttgagtgaattgattctaactaaaagtgagttgaga---gtacagtgatttgtgtttggatagattctttttaaaattgagttgaacta 256  Q
    |||||||||||||||| ||||||||||  || |||| | |||||| |   ||| |||||||| |||||||||| |||| | | |||| ||  || |||||    
8604543 aagaattgattttgagagaattgattccgaccaaaatttagttgaaaaaggtaaagtgatttatgtttggatacattcatgt-aaaagtgcattcaacta 8604641  T
257 taaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaatt 322  Q
    |||||  |||||| |||||||||||||||||| ||||||||  ||||||||||||||| |||||||||    
8604642 taaatttgtgtgtgaaaatcaattctagaatcgaaagctacaaatcttagcttcaagtagaatcaatt 8604709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 211 - 324
Target Start/End: Original strand, 21691187 - 21691301
Alignment:
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttc 308  Q
    ||||||||||||||||||| |||| | | |||| || ||||||||||||||  |||||| ||||||||||||| || ||||||||||  ||||||| |||    
21691187 agtgatttgtgtttggatatattcatgt-aaaagtgtgttgaactataaatttgtgtgtgaaaatcaattctacaaccaaaagctacaaatcttagtttc 21691285  T
309 aagtggaatcaattct 324  Q
    |||| |||||||||||    
21691286 aagttgaatcaattct 21691301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 218 - 324
Target Start/End: Original strand, 32818352 - 32818459
Alignment:
218 tgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgt--aaaaatcaattctagaatcaaaagctacttatcttagcttcaagtgga 315  Q
    |||||||||||| |||| | | ||| || ||||||||||||||| |||||  ||||||||||||||||||||||||||||  ||  ||||||||| | ||    
32818352 tgtgtttggatacattcatgtaaaagtt-agttgaactataaatttgtgtgcaaaaatcaattctagaatcaaaagctacaaattctagcttcaaataga 32818450  T
316 atcaattct 324  Q
    |||||||||    
32818451 atcaattct 32818459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 137 - 234
Target Start/End: Complemental strand, 33843895 - 33843798
Alignment:
137 tgtatgttttgttttgagttgaaaagaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattc 234  Q
    ||||||||| | |||| ||||| || |||||||||||| ||||||||||||  ||||||||||||||   ||| |||||||| |||||||||| ||||    
33843895 tgtatgtttggctttgtgttgacaaaaattgattttgattgaattgattctggctaaaagtgagttggatgtaaagtgatttatgtttggatatattc 33843798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 249 - 324
Target Start/End: Complemental strand, 9134681 - 9134606
Alignment:
249 ttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    |||| |||||||| ||||| ||||||||||||| |||||||||||||  || |||||||||||| | |||||||||    
9134681 ttgagctataaatttgtgtgaaaatcaattctaaaatcaaaagctacaaattttagcttcaagtaggatcaattct 9134606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 239 - 357
Target Start/End: Complemental strand, 1616473 - 1616354
Alignment:
239 taaaattgagttgaactataaa--tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaa 336  Q
    ||||| ||||||||||| ||||  |||||||   |||||||||||||||||||||||||  ||  |||||| |||| |||||||||||||| || | |||    
1616473 taaaaatgagttgaactttaaacatgtgtgtgggaatcaattctagaatcaaaagctacaaattgtagctt-aagtagaatcaattctactcgataacaa 1616375  T
337 ccaaacatgtaggaatcaatt 357  Q
    |||| |||||  |||||||||    
1616374 ccaatcatgtcagaatcaatt 1616354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 239 - 311
Target Start/End: Complemental strand, 16552038 - 16551966
Alignment:
239 taaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaag 311  Q
    ||||| ||||||||||||||||| ||||| ||||||||||||||||  |||| ||||  ||| ||||||||||    
16552038 taaaagtgagttgaactataaatttgtgtgaaaatcaattctagaactaaaaactacaaatcctagcttcaag 16551966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 261 - 325
Target Start/End: Complemental strand, 30357571 - 30357507
Alignment:
261 tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattcta 325  Q
    |||||||||||||||||| || |||||||||||||  |||  |||||||||| ||||||||||||    
30357571 tgtgtgtaaaaatcaattatataatcaaaagctacaaatcacagcttcaagtagaatcaattcta 30357507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 211 - 295
Target Start/End: Original strand, 39733615 - 39733698
Alignment:
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctac 295  Q
    ||||||||||||||||||| ||| | |  ||||  |||||||||| ||||||||||| | ||||||||||| |||||||||||||    
39733615 agtgatttgtgtttggatacatt-tatgaaaaaaggagttgaactttaaatgtgtgtgataatcaattctacaatcaaaagctac 39733698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 211 - 291
Target Start/End: Complemental strand, 35065173 - 35065092
Alignment:
211 agtgatttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatcaaaag 291  Q
    ||||||||||||||||||| |||| | | |||| ||||| ||  |||||||  ||||||||||||||||||||||||||||||    
35065173 agtgatttgtgtttggatacattcatgt-aaaagtgagtggagatataaatttgtgtgtaaaaatcaattctagaatcaaaag 35065092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 155 - 187
Target Start/End: Complemental strand, 45694762 - 45694730
Alignment:
155 ttgaaaagaattgattttgagtgaattgattct 187  Q
    |||||||||||||||||||||||||||||||||    
45694762 ttgaaaagaattgattttgagtgaattgattct 45694730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 244 - 317
Target Start/End: Original strand, 49138770 - 49138845
Alignment:
244 ttgagttgaactataaa--tgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaat 317  Q
    ||||||||||||||||   ||||| |||||||||||| |||||||||||| |||  ||| ||||||||||| ||||    
49138770 ttgagttgaactataagcttgtgtataaaaatcaattttagaatcaaaagttacaaatcctagcttcaagtagaat 49138845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 252 - 324
Target Start/End: Original strand, 55186979 - 55187051
Alignment:
252 aactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    |||||||||| ||||| ||||||||||||| ||| ||||| |||  ||| || |||||||| |||||||||||    
55186979 aactataaatatgtgtgaaaatcaattctataattaaaagttacaaatcctaacttcaagtagaatcaattct 55187051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 229
Target Start/End: Original strand, 20712749 - 20712807
Alignment:
171 ttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggata 229  Q
    ||||||||||||||||  ||||||| ||||||||  ||| ||| |||||||||||||||    
20712749 ttgagtgaattgattccgactaaaaatgagttgaaggtaaagttatttgtgtttggata 20712807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 295
Target Start/End: Complemental strand, 45011933 - 45011899
Alignment:
261 tgtgtgtaaaaatcaattctagaatcaaaagctac 295  Q
    ||||||| |||||||||||||||||||||||||||    
45011933 tgtgtgtgaaaatcaattctagaatcaaaagctac 45011899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 264 - 293
Target Start/End: Complemental strand, 4243443 - 4243414
Alignment:
264 gtgtaaaaatcaattctagaatcaaaagct 293  Q
    ||||||||||||||||||||||||||||||    
4243443 gtgtaaaaatcaattctagaatcaaaagct 4243414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 197
Target Start/End: Complemental strand, 7946741 - 7946704
Alignment:
160 aagaattgattttgagtgaattgattctaactaaaagt 197  Q
    |||||||||||||||||||||||||||  |||||||||    
7946741 aagaattgattttgagtgaattgattcagactaaaagt 7946704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 267 - 324
Target Start/End: Complemental strand, 14596742 - 14596685
Alignment:
267 taaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    |||||||||||||||||||||||| || |  | | ||||||||||| |||||||||||    
14596742 taaaaatcaattctagaatcaaaaactgcaaaacatagcttcaagtagaatcaattct 14596685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 323
Target Start/End: Complemental strand, 30357704 - 30357644
Alignment:
263 tgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattc 323  Q
    ||||||||||| |||| || |||||||||||||  ||| ||||||||| | ||||||||||    
30357704 tgtgtaaaaataaattatataatcaaaagctacagatcatagcttcaattagaatcaattc 30357644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 239 - 295
Target Start/End: Complemental strand, 33456455 - 33456399
Alignment:
239 taaaattgagttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctac 295  Q
    ||||| ||| |||||||||| || | ||| |||||||||| ||||||||||||||||    
33456455 taaaagtgaattgaactatagatttatgtgaaaatcaattatagaatcaaaagctac 33456399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 229
Target Start/End: Complemental strand, 36150693 - 36150625
Alignment:
161 agaattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggata 229  Q
    ||||||||||||||   |||||||| | | ||||||||||||||  ||| |||||||| ||||||||||    
36150693 agaattgattttgatataattgattttgattaaaagtgagttgaatgtaaagtgatttatgtttggata 36150625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 261 - 297
Target Start/End: Original strand, 37566247 - 37566283
Alignment:
261 tgtgtgtaaaaatcaattctagaatcaaaagctactt 297  Q
    ||||||| ||||||||||||| |||||||||||||||    
37566247 tgtgtgtgaaaatcaattctaaaatcaaaagctactt 37566283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 272 - 324
Target Start/End: Original strand, 55927807 - 55927859
Alignment:
272 atcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    |||||||||||||||| |||||||   | ||||| ||||||||||||||||||    
55927807 atcaattctagaatcagaagctacaatttttagcctcaagtggaatcaattct 55927859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 18)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 162 - 253
Target Start/End: Complemental strand, 14022132 - 14022042
Alignment:
162 gaattgattttgagtgaattgattctaactaaaagtgagttg-agagtacagtgatttgtgtttggatagattctttttaaaattgagttgaa 253  Q
    |||||||||||||||||||| |||||| |||||||||||||| ||| || ||| ||||||||||||||| ||||  |||||||||||| ||||    
14022132 gaattgattttgagtgaatttattctatctaaaagtgagttgcaga-taaagtaatttgtgtttggatacattc-atttaaaattgagctgaa 14022042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 293
Target Start/End: Complemental strand, 35058512 - 35058388
Alignment:
163 aattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataa--- 259  Q
    ||||||||||||||| ||||||||||||||||||||||||||   || |||| ||| ||||||||||         ||||| |||||||||| ||||       
35058512 aattgattttgagtggattgattctaactaaaagtgagttgaagataaagtgctttatgtttggata---------taaaagtgagttgaacaataatat 35058422  T
260 atgtgtgtaaaaatcaattctagaatcaaaagct 293  Q
     || |||| |||||||||||||||||||||||||    
35058421 ttgagtgttaaaatcaattctagaatcaaaagct 35058388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 293
Target Start/End: Original strand, 35264353 - 35264469
Alignment:
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgt--gtgtaaaaatca 275  Q
    |||||||| |||| ||||||||||||| |||| ||||| || ||||||| || |||| | | ||||| || |||||| |||||| |  |||| |||||||    
35264353 aattgattgtaaccaaaagtgagttgaaagtaaagtgagttatgtttgggtacattcatgtaaaaat-gacttgaacaataaatttaagtgttaaaatca 35264451  T
276 attctagaatcaaaagct 293  Q
    ||||||||||||||||||    
35264452 attctagaatcaaaagct 35264469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 189 - 295
Target Start/End: Original strand, 31708192 - 31708299
Alignment:
189 actaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaat--gtgtgtaaaaatcaattctagaatc 286  Q
    |||||||||||||||    || |||| |||||||||||||| |||| | | |||| ||||||||| |||||||  |||||| | ||||||||||||||||    
31708192 actaaaagtgagttgctgataaagtggtttgtgtttggatacattcatgt-aaaagtgagttgaattataaatttgtgtgttagaatcaattctagaatc 31708290  T
287 aaaagctac 295  Q
    |||||||||    
31708291 aaaagctac 31708299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 293
Target Start/End: Original strand, 46853461 - 46853592
Alignment:
163 aattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatg 262  Q
    ||||||| ||||||||||||||| |  ||| |||| ||||||  ||| |||||||| |||  ||||| ||| | | ||||| |||||||||| ||||||     
46853461 aattgatcttgagtgaattgattttggctacaagtaagttgaaggtaaagtgatttatgtcaggatatatt-tatgtaaaagtgagttgaacaataaatt 46853559  T
263 tg--tgtaaaaatcaattctagaatcaaaagct 293  Q
    ||  ||| |||||||||||||||||||||||||    
46853560 tgagtgttaaaatcaattctagaatcaaaagct 46853592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 295
Target Start/End: Complemental strand, 5407058 - 5406931
Alignment:
163 aattgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatg 262  Q
    |||||||||||||||||||||||||| |||||| ||||||||  ||| ||    || |||||||||| ||||  | ||||| ||| |||||   |||||     
5407058 aattgattttgagtgaattgattctagctaaaattgagttgaaggtaaag----ttatgtttggatacattc-atgtaaaagtgatttgaagagtaaatt 5406964  T
263 tgtgtaaaaatcaattctagaatcaaaagctac 295  Q
    ||| ||||||||||||||| ||||| |||||||    
5406963 tgtttaaaaatcaattctataatcagaagctac 5406931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 164 - 217
Target Start/End: Complemental strand, 46018746 - 46018693
Alignment:
164 attgattttgagtgaattgattctaactaaaagtgagttgagagtacagtgatt 217  Q
    ||||||||||||||||||||||||| |||||  |||||||| |||| |||||||    
46018746 attgattttgagtgaattgattctagctaaagatgagttgatagtaaagtgatt 46018693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 295
Target Start/End: Original strand, 37334976 - 37335094
Alignment:
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaatgt--gtgtaaaaatca 275  Q
    |||||||||  ||||||| ||||||||  ||| |||||||| ||| || ||| |||| | | ||||| ||||||||| || |||    ||||||||||||    
37334976 aattgattccgactaaaattgagttgaaggtaaagtgatttatgtctgaatacattcatataaaaat-gagttgaacaatgaattcaagtgtaaaaatca 37335074  T
276 attctagaatcaaaagctac 295  Q
    ||||||||||||||||||||    
37335075 attctagaatcaaaagctac 37335094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 249 - 357
Target Start/End: Complemental strand, 42375596 - 42375488
Alignment:
249 ttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatgtag 348  Q
    |||||| | |||| ||| |||||||||||||||  |||||| |||||  ||  ||||||||||| ||||  |||||||||||  ||||||||| ||||      
42375596 ttgaacaaaaaatttgtataaaaatcaattctatgatcaaacgctacaaattatagcttcaagtagaattgattctacttgaccgcaaccaaaaatgtca 42375497  T
349 gaatcaatt 357  Q
    |||||||||    
42375496 gaatcaatt 42375488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 249 - 357
Target Start/End: Complemental strand, 42404310 - 42404202
Alignment:
249 ttgaactataaatgtgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatgtag 348  Q
    |||||| | |||| ||| |||||||||||||||  |||||| |||||  ||  ||||||||||| ||||  |||||||||||  ||||||||| ||||      
42404310 ttgaacaaaaaatttgtataaaaatcaattctatgatcaaacgctacaaattatagcttcaagtagaattgattctacttgaccgcaaccaaaaatgtca 42404211  T
349 gaatcaatt 357  Q
    |||||||||    
42404210 gaatcaatt 42404202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 271 - 345
Target Start/End: Original strand, 21367137 - 21367211
Alignment:
271 aatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattctacttgaaagcaaccaaacatg 345  Q
    ||||||||||||||||| |||||||  | | ||| |||| || |||| | ||||||| |||||||||||||||||    
21367137 aatcaattctagaatcagaagctacaaaccctagattcatgtagaataagttctactcgaaagcaaccaaacatg 21367211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 295
Target Start/End: Original strand, 32523366 - 32523400
Alignment:
261 tgtgtgtaaaaatcaattctagaatcaaaagctac 295  Q
    |||||||||||||||||| ||||||||||||||||    
32523366 tgtgtgtaaaaatcaattttagaatcaaaagctac 32523400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 263 - 325
Target Start/End: Original strand, 47356273 - 47356335
Alignment:
263 tgtgtaaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattcta 325  Q
    ||||||||||||||||||| |||||||  |||   |||||| |||||||||||||| ||||||    
47356273 tgtgtaaaaatcaattctataatcaaagactataaatcttaacttcaagtggaatcgattcta 47356335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 197 - 295
Target Start/End: Original strand, 41596110 - 41596209
Alignment:
197 tgagttgagagtacagtgatttgtgtttggatagattctttttaaaattgagttgaactataaa--tgtgtgtaaaaatcaattctagaatcaaaagcta 294  Q
    ||||||||  ||| |||||||| |||||||||| |||| |   |||| |||||  |||||||||  ||||||||||||||||||||  ||||||||||||    
41596110 tgagttgaatgtaaagtgatttctgtttggatacattcatgg-aaaagtgagtcaaactataaacttgtgtgtaaaaatcaattctttaatcaaaagcta 41596208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 178 - 234
Target Start/End: Original strand, 1441349 - 1441405
Alignment:
178 aattgattctaactaaaagtgagttgagagtacagtgatttgtgtttggatagattc 234  Q
    ||||||||||  |||||||||||||||  ||| |||||||||||||| |||| ||||    
1441349 aattgattctgtctaaaagtgagttgaacgtaaagtgatttgtgtttagatacattc 1441405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 44771751 - 44771719
Alignment:
263 tgtgtaaaaatcaattctagaatcaaaagctac 295  Q
    |||||||||||||||| ||||||||||||||||    
44771751 tgtgtaaaaatcaattttagaatcaaaagctac 44771719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 239 - 324
Target Start/End: Complemental strand, 52364134 - 52364047
Alignment:
239 taaaattgagttgaactataaatgtgtgta--aaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    ||||| ||||||||||| ||||| | |||   |||||||||| |||||||||||||||   ||| ||||||||||| ||| |||||||    
52364134 taaaagtgagttgaactgtaaatttatgtttgaaaatcaattatagaatcaaaagctataaatcatagcttcaagtagaaacaattct 52364047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 314 - 346
Target Start/End: Complemental strand, 54596806 - 54596774
Alignment:
314 gaatcaattctacttgaaagcaaccaaacatgt 346  Q
    ||||||||||||||||||| |||||||||||||    
54596806 gaatcaattctacttgaaaacaaccaaacatgt 54596774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 267 - 324
Target Start/End: Original strand, 220636 - 220693
Alignment:
267 taaaaatcaattctagaatcaaaagctacttatcttagcttcaagtggaatcaattct 324  Q
    |||||||||||||||||||||||| || |  | | ||||||||||| |||||||||||    
220636 taaaaatcaattctagaatcaaaaactgcaaaacatagcttcaagtagaatcaattct 220693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0360 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0360
Description:

Target: scaffold0360; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 314 - 346
Target Start/End: Original strand, 13288 - 13320
Alignment:
314 gaatcaattctacttgaaagcaaccaaacatgt 346  Q
    ||||||||||||||| |||||||||||||||||    
13288 gaatcaattctacttcaaagcaaccaaacatgt 13320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105591 times since January 2019
Visitors: 2328