View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9312-LTR4-TNT-insertion-6 (Length: 543)

Name: F9312-LTR4-TNT-insertion-6
Description: F9312-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9312-LTR4-TNT-insertion-6
F9312-LTR4-TNT-insertion-6
[»] chr7 (1 HSPs)
chr7 (8-533)||(11061535-11062060)
[»] chr6 (2 HSPs)
chr6 (54-475)||(20186125-20186545)
chr6 (54-475)||(22149446-22149866)


Alignment Details
Target: chr7 (Bit Score: 522; Significance: 0; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 522; E-Value: 0
Query Start/End: Original strand, 8 - 533
Target Start/End: Complemental strand, 11062060 - 11061535
Alignment:
8 cgaagttgctgagaaaaagattgattctagcatctgaattgagagggaaaggaagatgaaacatggttatgaaaaacgcaaagttcccagcgaacaagct 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11062060 cgaagttgctgagaaaaagattgattctagcatctgaattgagagggaaaggaagatgaaacatggttatgaaaaacgcaaagttcccagcgaacaagct 11061961  T
108 tctcttgatcattctcagagaaactcaagtgtcaacaaaactgcaactgataaagaagcaatgttgaaaattagcaaaaagcgtcgagagcacatgaaga 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
11061960 tctcttgatcattctcagagaaactcaagtgtcaacaaaactgcaactgataaagaaacaatgttgaaaattagcaaaaagcgtcgagagcacatgaaga 11061861  T
208 tcaagtctgcaagcgcacattcccatataggggatgatgtgtcaaaggtaaatcccttacgactattcctttttcttgtgtcatctcaccattcctttta 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11061860 tcaagtctgcaagcgcacattcccatataggggatgatgtgtcaaaggtaaatcccttacgactattcctttttcttgtgtcatctcaccattcctttta 11061761  T
308 tcagcttctgtcctaattttcagggtactgaagacagtaatgctgactttgggaaacaaccgacaccttcatcaactttcagaccatcaatgacaactat 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11061760 tcagcttctgtcctaattttcagggtactgaagacagtaatgctgactttgggaaacaaccgacaccttcatcaactttcagaccatcaatgacaactat 11061661  T
408 ctctgaggatcaaatagcagtccaccctcgtcttgaaaaagataatgtcaatcatgaagaagatgatgcagaaaaagacgaagtctcgtctccgttcgaa 507  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11061660 ctctgaggatcaaatagcagtccaccctcgtcttgaaaaagataatgtcaatcatgaagaagatgatgcagaaaaagacgaagtctcgtctccgttcgaa 11061561  T
508 ggtgagaaaggtcaggtgcctcatta 533  Q
    ||||||||||||||||||||||||||    
11061560 ggtgagaaaggtcaggtgcctcatta 11061535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 54 - 475
Target Start/End: Original strand, 20186125 - 20186545
Alignment:
54 gaaaggaagatgaaacatggttatgaaaaacgcaaagttcccagcgaacaagcttctcttgatcattctcagagaaactcaagtgtcaacaaaactgcaa 153  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||  |||  |||||||||||||||||||||||||||||||||||||||||    
20186125 gaaaggaagatgaaacatggttatgaaaaacgcaaagttcccagcaaacaagactcttgtgatcattctcagagaaactcaagtgtcaacaaaactgcaa 20186224  T
154 ctgataaagaagcaatgttgaaaattagcaaaaagcgtcgagagcacatgaagatcaagtctgcaagcgcacattcccatataggggatgatgtgtcaaa 253  Q
      ||| ||||| ||||  |||| | ||| | ||| | |||||||| ||  ||||||||||||  ||||||||||||||||||||||||||||||||||||    
20186225 tcgatgaagaaacaattgtgaagagtagtagaaaacatcgagagcgcagaaagatcaagtctttaagcgcacattcccatataggggatgatgtgtcaaa 20186324  T
254 ggtaaatcccttacgactattcctttttcttgtgtcatctcaccattccttttatcagcttctgtcctaattttcagggtactgaagacagtaatgctga 353  Q
    |||||||||| | ||||||| |||||| |||| |||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |    
20186325 ggtaaatcccgtccgactatgcctttt-cttgagtcatctcaccagtccttttatcatcttctgtcctaattttcagggtactgaagacagtaatgctaa 20186423  T
354 ctttgggaaacaaccgacaccttcatcaactttcagaccatcaatgacaactatctctgaggatcaaatagcagtccaccctcgtcttgaaaaagataat 453  Q
    |||||||||||||||||| |||||||| ||||||| ||||||| |||||||||||| ||||||||||||||||||| ||||||||||| ||||| |||||    
20186424 ctttgggaaacaaccgacgccttcatccactttcaaaccatcagtgacaactatctatgaggatcaaatagcagtcgaccctcgtcttcaaaaatataat 20186523  T
454 gtcaatcatgaagaagatgatg 475  Q
    ||||||| | ||||||||||||    
20186524 gtcaatcctcaagaagatgatg 20186545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 54 - 475
Target Start/End: Complemental strand, 22149866 - 22149446
Alignment:
54 gaaaggaagatgaaacatggttatgaaaaacgcaaagttcccagcgaacaagcttctcttgatcattctcagagaaactcaagtgtcaacaaaactgcaa 153  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||  |||  |||||||||||||||||||||||||||||||||||||||||    
22149866 gaaaggaagatgaaacatggttatgaaaaacgcaaagttcccagcaaacaagactcttgtgatcattctcagagaaactcaagtgtcaacaaaactgcaa 22149767  T
154 ctgataaagaagcaatgttgaaaattagcaaaaagcgtcgagagcacatgaagatcaagtctgcaagcgcacattcccatataggggatgatgtgtcaaa 253  Q
      ||| ||||| ||||  |||| | ||| | ||| | |||||||| ||  ||||||||||||  ||||||||||||||||||||||||||||||||||||    
22149766 tcgatgaagaaacaattgtgaagagtagtagaaaacatcgagagcgcagaaagatcaagtctttaagcgcacattcccatataggggatgatgtgtcaaa 22149667  T
254 ggtaaatcccttacgactattcctttttcttgtgtcatctcaccattccttttatcagcttctgtcctaattttcagggtactgaagacagtaatgctga 353  Q
    |||||||||| | ||||||| |||||| |||| |||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |    
22149666 ggtaaatcccgtccgactatgcctttt-cttgagtcatctcaccagtccttttatcatcttctgtcctaattttcagggtactgaagacagtaatgctaa 22149568  T
354 ctttgggaaacaaccgacaccttcatcaactttcagaccatcaatgacaactatctctgaggatcaaatagcagtccaccctcgtcttgaaaaagataat 453  Q
    |||||||||||||||||| |||||||| ||||||| ||||||| |||||||||||| ||||||||||||||||||| ||||||||||| ||||| |||||    
22149567 ctttgggaaacaaccgacgccttcatccactttcaaaccatcagtgacaactatctatgaggatcaaatagcagtcgaccctcgtcttcaaaaatataat 22149468  T
454 gtcaatcatgaagaagatgatg 475  Q
    ||||||| | ||||||||||||    
22149467 gtcaatcctcaagaagatgatg 22149446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98520 times since January 2019
Visitors: 2275