View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9312-LTR4-TNT-insertion-6 (Length: 543)

Name: F9312-LTR4-TNT-insertion-6
Description: F9312-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9312-LTR4-TNT-insertion-6
[»] chr7 (1 HSPs)
chr7 (8-533)||(11061535-11062060)
[»] chr6 (2 HSPs)
chr6 (54-475)||(20186125-20186545)
chr6 (54-475)||(22149446-22149866)

Alignment Details
Target: chr7 (Bit Score: 522; Significance: 0; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 522; E-Value: 0
Query Start/End: Original strand, 8 - 533
Target Start/End: Complemental strand, 11062060 - 11061535
8 cgaagttgctgagaaaaagattgattctagcatctgaattgagagggaaaggaagatgaaacatggttatgaaaaacgcaaagttcccagcgaacaagct 107  Q
11062060 cgaagttgctgagaaaaagattgattctagcatctgaattgagagggaaaggaagatgaaacatggttatgaaaaacgcaaagttcccagcgaacaagct 11061961  T
108 tctcttgatcattctcagagaaactcaagtgtcaacaaaactgcaactgataaagaagcaatgttgaaaattagcaaaaagcgtcgagagcacatgaaga 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
11061960 tctcttgatcattctcagagaaactcaagtgtcaacaaaactgcaactgataaagaaacaatgttgaaaattagcaaaaagcgtcgagagcacatgaaga 11061861  T
208 tcaagtctgcaagcgcacattcccatataggggatgatgtgtcaaaggtaaatcccttacgactattcctttttcttgtgtcatctcaccattcctttta 307  Q
11061860 tcaagtctgcaagcgcacattcccatataggggatgatgtgtcaaaggtaaatcccttacgactattcctttttcttgtgtcatctcaccattcctttta 11061761  T
308 tcagcttctgtcctaattttcagggtactgaagacagtaatgctgactttgggaaacaaccgacaccttcatcaactttcagaccatcaatgacaactat 407  Q
11061760 tcagcttctgtcctaattttcagggtactgaagacagtaatgctgactttgggaaacaaccgacaccttcatcaactttcagaccatcaatgacaactat 11061661  T
408 ctctgaggatcaaatagcagtccaccctcgtcttgaaaaagataatgtcaatcatgaagaagatgatgcagaaaaagacgaagtctcgtctccgttcgaa 507  Q
11061660 ctctgaggatcaaatagcagtccaccctcgtcttgaaaaagataatgtcaatcatgaagaagatgatgcagaaaaagacgaagtctcgtctccgttcgaa 11061561  T
508 ggtgagaaaggtcaggtgcctcatta 533  Q
11061560 ggtgagaaaggtcaggtgcctcatta 11061535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr6

Target: chr6; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 54 - 475
Target Start/End: Original strand, 20186125 - 20186545
54 gaaaggaagatgaaacatggttatgaaaaacgcaaagttcccagcgaacaagcttctcttgatcattctcagagaaactcaagtgtcaacaaaactgcaa 153  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||  |||  |||||||||||||||||||||||||||||||||||||||||    
20186125 gaaaggaagatgaaacatggttatgaaaaacgcaaagttcccagcaaacaagactcttgtgatcattctcagagaaactcaagtgtcaacaaaactgcaa 20186224  T
154 ctgataaagaagcaatgttgaaaattagcaaaaagcgtcgagagcacatgaagatcaagtctgcaagcgcacattcccatataggggatgatgtgtcaaa 253  Q
      ||| ||||| ||||  |||| | ||| | ||| | |||||||| ||  ||||||||||||  ||||||||||||||||||||||||||||||||||||    
20186225 tcgatgaagaaacaattgtgaagagtagtagaaaacatcgagagcgcagaaagatcaagtctttaagcgcacattcccatataggggatgatgtgtcaaa 20186324  T
254 ggtaaatcccttacgactattcctttttcttgtgtcatctcaccattccttttatcagcttctgtcctaattttcagggtactgaagacagtaatgctga 353  Q
    |||||||||| | ||||||| |||||| |||| |||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |    
20186325 ggtaaatcccgtccgactatgcctttt-cttgagtcatctcaccagtccttttatcatcttctgtcctaattttcagggtactgaagacagtaatgctaa 20186423  T
354 ctttgggaaacaaccgacaccttcatcaactttcagaccatcaatgacaactatctctgaggatcaaatagcagtccaccctcgtcttgaaaaagataat 453  Q
    |||||||||||||||||| |||||||| ||||||| ||||||| |||||||||||| ||||||||||||||||||| ||||||||||| ||||| |||||    
20186424 ctttgggaaacaaccgacgccttcatccactttcaaaccatcagtgacaactatctatgaggatcaaatagcagtcgaccctcgtcttcaaaaatataat 20186523  T
454 gtcaatcatgaagaagatgatg 475  Q
    ||||||| | ||||||||||||    
20186524 gtcaatcctcaagaagatgatg 20186545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 54 - 475
Target Start/End: Complemental strand, 22149866 - 22149446
54 gaaaggaagatgaaacatggttatgaaaaacgcaaagttcccagcgaacaagcttctcttgatcattctcagagaaactcaagtgtcaacaaaactgcaa 153  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||  |||  |||||||||||||||||||||||||||||||||||||||||    
22149866 gaaaggaagatgaaacatggttatgaaaaacgcaaagttcccagcaaacaagactcttgtgatcattctcagagaaactcaagtgtcaacaaaactgcaa 22149767  T
154 ctgataaagaagcaatgttgaaaattagcaaaaagcgtcgagagcacatgaagatcaagtctgcaagcgcacattcccatataggggatgatgtgtcaaa 253  Q
      ||| ||||| ||||  |||| | ||| | ||| | |||||||| ||  ||||||||||||  ||||||||||||||||||||||||||||||||||||    
22149766 tcgatgaagaaacaattgtgaagagtagtagaaaacatcgagagcgcagaaagatcaagtctttaagcgcacattcccatataggggatgatgtgtcaaa 22149667  T
254 ggtaaatcccttacgactattcctttttcttgtgtcatctcaccattccttttatcagcttctgtcctaattttcagggtactgaagacagtaatgctga 353  Q
    |||||||||| | ||||||| |||||| |||| |||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |    
22149666 ggtaaatcccgtccgactatgcctttt-cttgagtcatctcaccagtccttttatcatcttctgtcctaattttcagggtactgaagacagtaatgctaa 22149568  T
354 ctttgggaaacaaccgacaccttcatcaactttcagaccatcaatgacaactatctctgaggatcaaatagcagtccaccctcgtcttgaaaaagataat 453  Q
    |||||||||||||||||| |||||||| ||||||| ||||||| |||||||||||| ||||||||||||||||||| ||||||||||| ||||| |||||    
22149567 ctttgggaaacaaccgacgccttcatccactttcaaaccatcagtgacaactatctatgaggatcaaatagcagtcgaccctcgtcttcaaaaatataat 22149468  T
454 gtcaatcatgaagaagatgatg 475  Q
    ||||||| | ||||||||||||    
22149467 gtcaatcctcaagaagatgatg 22149446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC