View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9313-LTR4-TNT-insertion-10 (Length: 226)

Name: F9313-LTR4-TNT-insertion-10
Description: F9313-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9313-LTR4-TNT-insertion-10
F9313-LTR4-TNT-insertion-10
[»] chr3 (1 HSPs)
chr3 (8-218)||(27761354-27761564)


Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 8 - 218
Target Start/End: Original strand, 27761354 - 27761564
Alignment:
8 gaatccaatcctataaaatgaagtagttttaaattcttttgaaggagaattttgctatgaattgttattctgcacttggggcatctgattcacaccaaag 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27761354 gaatccaatcctataaaatgaagtagttttaaattcttttgaaggagaattttgctatgaattgttattctgcacttggggcatctgattcacaccaaag 27761453  T
108 aatattcaatacaaaatcatgactcattttttcaataatnnnnnnnntggttcaaataaataaaatattataacaaattacatattgacttttcttttat 207  Q
    |||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||    
27761454 aatattcaatacaaaatcatgactcattttttcaataataaaaaaaatggttcaaataaataaaatattataacaaattacatattgacttttcttttat 27761553  T
208 tttagtgatta 218  Q
    |||||||||||    
27761554 tttagtgatta 27761564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC