View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9313-LTR4-TNT-insertion-11 (Length: 536)

Name: F9313-LTR4-TNT-insertion-11
Description: F9313-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9313-LTR4-TNT-insertion-11
F9313-LTR4-TNT-insertion-11
[»] chr3 (2 HSPs)
chr3 (7-528)||(24456294-24456815)
chr3 (7-528)||(24473705-24474228)


Alignment Details
Target: chr3 (Bit Score: 522; Significance: 0; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 522; E-Value: 0
Query Start/End: Original strand, 7 - 528
Target Start/End: Complemental strand, 24456815 - 24456294
Alignment:
7 atcgtggtcaatacagcaagaatacggatctctctgagacagttgctgaagcaacatctatattgtcttatgtggaaccctcactggtccttccatttgt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24456815 atcgtggtcaatacagcaagaatacggatctctctgagacagttgctgaagcaacatctatattgtcttatgtggaaccctcactggtccttccatttgt 24456716  T
107 ggcatctaggtttcaaatggcccttgagacggttagttgtgttgattgaatatttttcatggtagaatttcagaaatcatatgtagtcagtggaattaca 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24456715 ggcatctaggtttcaaatggcccttgagacggttagttgtgttgattgaatatttttcatggtagaatttcagaaatcatatgtagtcagtggaattaca 24456616  T
207 aagaataatattttcttcttggtaatatgtccactgagggatactctttaaaagtatactgtattgtgttaatttgtctttctgaccatattcattttgc 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24456615 aagaataatattttcttcttggtaatatgtccactgagggatactctttaaaagtatactgtattgtgttaatttgtctttctgaccatattcattttgc 24456516  T
307 ctggccagatgactgccacccaccagttgaaaattgcagttatgtctggcatttgttgggcgctcactattttatacatctgtatcggcttcctccatga 406  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24456515 ctggccagatgactgccacccaccagttgaaaattgcagttatgtctggcatttgttgggcgctcactattttatacatctgtatcggcttcctccatga 24456416  T
407 aacaagttgatcttggcggtggtgatgaagcattcattgatcttgtgggggtttcattatctaatgcattacttggcatggatgctaatgaccctccgaa 506  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24456415 aacaagttgatcttggcggtggtgatgaagcattcattgatcttgtgggggtttcattatctaatgcattacttggcatggatgctaatgaccctccgaa 24456316  T
507 aactttagctaccatgcaatta 528  Q
    ||||||||||||||||||||||    
24456315 aactttagctaccatgcaatta 24456294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 485; E-Value: 0
Query Start/End: Original strand, 7 - 528
Target Start/End: Complemental strand, 24474228 - 24473705
Alignment:
7 atcgtggtcaatacagcaagaatacggatctctctgagacagttgctgaagcaacatctatattgtcttatgtggaaccctcactggtccttccatttgt 106  Q
    |||||||||||||||||||||||  | ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
24474228 atcgtggtcaatacagcaagaatgagcatctctctgagacagttgctgcagcaacatctatattgtcttatgtggaaccctcactggtccttccatttgt 24474129  T
107 ggcatctaggtttcaaatggcccttgagacggttagttgtgttgattgaatatttttcatggtagaatttcagaaatcatatgtagtcagtggaattaca 206  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| ||||||    
24474128 ggcatctaggtttcaaatggcccttgagacggttagttgtgttgtttgaatatttttcatggtagaatttcagaaatcatatgtggtcagtggcattaca 24474029  T
207 aagaataatattttcttcttggtaatatgtccactgagggatactctttaaaagtatactgtattgtgttaatttgtctttctgaccatattcattttgc 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24474028 aagaataatattttcttcttggtaatatgtccactgagggatactctttaaaagtatactgtattgtgttaatttgtctttctgaccatattcattttgc 24473929  T
307 ctggccagatgactgccacccaccagttgaaaattgcagttatgtc--tggcatttgttgggcgctcactattttatacatctgtatcggcttcctccat 404  Q
    ||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||    
24473928 ctggccagatgactgccacccaccagttgaaaattgcagttatgtctgtggcatttgttgggcgctcactattttatacatctgtatcggcttcctccat 24473829  T
405 gaaacaagttgatcttggcggtggtgatgaagcattcattgatcttgtgggggtttcattatctaatgcattacttggcatggatgctaatgaccctccg 504  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24473828 gaaacaagttgatcttggcggtggtgatgaagcattcattgatcttgtgggggtttcattatctaatgcattacttggcatggatgctaatgaccctccg 24473729  T
505 aaaactttagctaccatgcaatta 528  Q
    ||||||||||||||||||||||||    
24473728 aaaactttagctaccatgcaatta 24473705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC