View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9313-LTR4-TNT-insertion-12 (Length: 429)

Name: F9313-LTR4-TNT-insertion-12
Description: F9313-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9313-LTR4-TNT-insertion-12
F9313-LTR4-TNT-insertion-12
[»] chr5 (1 HSPs)
chr5 (10-419)||(39224365-39224774)


Alignment Details
Target: chr5 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 10 - 419
Target Start/End: Complemental strand, 39224774 - 39224365
Alignment:
10 tggctaggtgttaattttcctaactagctagtttgtgttatttgagaattttgaagattttgtttaactatttattagctagagttggacctgttcnnnn 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        
39224774 tggctaggtgttaattttcctaactagctagtttgtgttatttgagaattttgaagattttgtttaactatttattagctagagttggacctgttcaaaa 39224675  T
110 nnntaaaactatagttggtagaggggattcaattactgttaacacactgcaatacaatttaggattgagattgaagttgaattatgaatgcataccttgg 209  Q
       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39224674 aaataaaactatagttggtagaggggattcaattactgttaacacactgcaatacaatttaggattgagattgaagttgaattatgaatgcataccttgg 39224575  T
210 cttggcttccctttactacttgtctagaatttccacaaaaaattgtttagtttctttcttttatcaattagaaatattaaagacaaaaagcaaaaggaaa 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
39224574 cttggcttccctttactacttgtctagaatttccacaaaaaattgtttagtttttttcttttatcaattagaaatattaaagacaaaaagcaaaaggaaa 39224475  T
310 taccccttcatgccatttttctcaacacacatgnnnnnnnnnnnnttgtgtgtctcccctttgttttgtatttttctcaacaccnnnnnnnnggaatttt 409  Q
    |||||||||||||||||||||||||||||||||            |||||||||||||||||||||||||||||||||||||||        ||||||||    
39224474 taccccttcatgccatttttctcaacacacatgctctctctctctttgtgtgtctcccctttgttttgtatttttctcaacaccttttttttggaatttt 39224375  T
410 tattcgaatt 419  Q
    ||||||||||    
39224374 tattcgaatt 39224365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC