View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9313-LTR4-TNT-insertion-3 (Length: 507)

Name: F9313-LTR4-TNT-insertion-3
Description: F9313-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9313-LTR4-TNT-insertion-3
F9313-LTR4-TNT-insertion-3
[»] chr5 (1 HSPs)
chr5 (12-497)||(35289241-35289726)


Alignment Details
Target: chr5 (Bit Score: 465; Significance: 0; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 465; E-Value: 0
Query Start/End: Original strand, 12 - 497
Target Start/End: Complemental strand, 35289726 - 35289241
Alignment:
12 cctgtccacctttggccgacaaggtttggtgcaacgcatgtttttcacgctacgtgtgtttgggtctgtacaggtggccaaaaaatcgttgctgatttgg 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35289726 cctgtccacctttggccgacaaggtttggtgcaacgcatgtttttcacgctacgtgtgtttgggtctgtacaggtggccaaaaaatcgttgctgatttgg 35289627  T
112 acaaacaaagatatgtaataacagccataaaggctaaagcatgaagggaaattaattgagaaggaatataagtttatctcttcattactccttatctacc 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35289626 acaaacaaagatatgtaataacagccataaaggctaaagcatgaagggaaattaattgagaaggaatataagtttatctcttcattactccttatctacc 35289527  T
212 cctcattctttatcctcttcaccgcagcctttaaggtttggaaggattaaattacgatccaaaatttaagatatagttttcacttttcaaatgataaaaa 311  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35289526 cctcattctttatcctcttcaccgcagcctttaaggtttggaaggattaaattacgatccaaaatttaagatatagttttcacttttcaaatgataaaaa 35289427  T
312 tattcaagtgttacaataatataaaacttcattatacttttgtatatggagtttgagttatgtggattttgatccatattannnnnnncattcgacgagt 411  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||    
35289426 tattcaagtgttacaataatataaaacttcattatacttttgtatatggagtttgagttatgtggattttgatccatattatttttttcattcgacgagt 35289327  T
412 gtttcgcgtgttctatttaattttaaaatttgaaaccttcaatatatttttgaaggtttttataagatatttataccgtttgaatt 497  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35289326 gtttcgcgtgttctatttaattttaaaatttgaaaccttcaatatatttttgaaggtttttataagatatttataccgtttgaatt 35289241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC