View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9313-LTR4-TNT-insertion-4 (Length: 715)

Name: F9313-LTR4-TNT-insertion-4
Description: F9313-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9313-LTR4-TNT-insertion-4
F9313-LTR4-TNT-insertion-4
[»] chr2 (1 HSPs)
chr2 (11-708)||(8568204-8568901)


Alignment Details
Target: chr2 (Bit Score: 625; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 625; E-Value: 0
Query Start/End: Original strand, 11 - 708
Target Start/End: Original strand, 8568204 - 8568901
Alignment:
11 ccttaaccaactcaaaatcatcaagatccttttaattatttccccaataatttgctgctgaatccagnnnnnnntgaataggaggcagcaaagagcattc 110  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||    
8568204 ccttaaccaactcaaaatcatcaagatcctcttaattatttccccaataatttgctgctgaatccagaaaaaaatgaataggaggcagcaaagagcattc 8568303  T
111 aaagttttgttttggattatgggaatatgtttaacatgttatcttgcaggaccacctttgttttgggcactcaatgacacttttagttctgttttttctt 210  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||    
8568304 aaagttttgttttggattatgggaatatgtctaacatgttatcttgcaggaccacctttgttttgggcactcaatgacactcttagttctgtttcttctt 8568403  T
211 cttgtcctccttgtcattgtgattgttctcttcaaccccttctttccatcccagaaggtttcgttttctttctcctttaaatctctannnnnnnnnnnnc 310  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||            |    
8568404 cttgtcctccttgtcattgtgattgttctcttcaaccccttctttccatcccagaaggtttcgttttctttctcctttaaatctctattttttttttttc 8568503  T
311 attaaaaagattatgtgtttaaataagaaatgacaaataatgtgttttgtttcttaaataatgatgttttgtttagaatgagactcataggtacctcata 410  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8568504 attaaaaagattatgtgtttaaataagaaatgacaaataatgtgttttgtttcttaaataatgatgttttgtttagaatgagactcataggtacctcata 8568603  T
411 atggcgcaggtttaaataacttcacttatattaatatgtaaattcttgtttaagccttgagtttttctcgactttgttgaacccacatgactcaattcac 510  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8568604 atggcgcaggtttaaataacttcacttatattaatatgtaaattcttgtttaagccttgagtttttctcgactttgttgaacccacatgactcaattcac 8568703  T
511 gtaaactttacgagtgtaaaagaaaacatagagaattagagttcactcttactgctagtccatattggaattttagggaactcatttattgggaatgata 610  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8568704 gtaaactttacgagtgtaaaagaaaacatagagaattagagttcactcttactgctagtccatattggaattttagggaactcatttattgggaatgata 8568803  T
611 tgtaacatatgttgatacattggataataaatttcatccgggaaattttatgcaactttgttaatcatagttttaaattgcattatcaactgcaattg 708  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8568804 tgtaacatatgttgatacattggataataaatttcatccgggaaattttatgcaactttgttaatcatagttttaaattgcattatcaactgcaattg 8568901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC