View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9313-LTR4-TNT-insertion-5 (Length: 513)

Name: F9313-LTR4-TNT-insertion-5
Description: F9313-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9313-LTR4-TNT-insertion-5
F9313-LTR4-TNT-insertion-5
[»] chr3 (1 HSPs)
chr3 (10-504)||(49514371-49514865)
[»] chr4 (1 HSPs)
chr4 (23-391)||(27745961-27746335)


Alignment Details
Target: chr3 (Bit Score: 487; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 487; E-Value: 0
Query Start/End: Original strand, 10 - 504
Target Start/End: Original strand, 49514371 - 49514865
Alignment:
10 aaaacatttgtaaatgcttagttatgctgtatgataataattggttgattttaactccttccaatactcaggtacctacgaactacgtagtcaaagattt 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49514371 aaaacatttgtaaatgcttagttatgctgtatgataataattggttgattttaactccttccaatactcaggtacctacgaactacgtagtcaaagattt 49514470  T
110 cggtcctcgagcacttcagcacagtaaagttgattttgattgggaggatgatgatccctttcgcaaaaggaccttgagtcgaaaatttactgatgagcag 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49514471 cggtcctcgagcacttcagcacagtaaagttgattttgattgggaggatgatgatccctttcgcaaaaggaccttgagtcgaaaatttactgatgagcag 49514570  T
210 gtcagcactgccctagcctatggtaaacatctgatggataacataaaaaatggggtaaaatatagtattgtaattcactatgttaattgtggaaatccaa 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
49514571 gtcagcactgccctagcctatggtaaacatctgatggataacataaaaaatggggtaaaatatagtattgtaattcactatattaattgtggaaatccaa 49514670  T
310 gcttgcatcaccatgatatcaggtcttggtttcttaagacaataggaaatgcagaaacaaggaaatacatggtctgggaaatttgagagtcctctcccga 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49514671 gcttgcatcaccatgatatcaggtcttggtttcttaagacaataggaaatgcagaaacaaggaaatacatggtctgggaaatttgagagtcctctcccga 49514770  T
410 aagtctcaactgtttctagcctaactccgtagtttccactcaccagatacccccaacaactgaatcacacaccaactagcctctgatactaattg 504  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
49514771 aagtctcaactgtttctagcctaactccgtagtttccactcaccagatacccccaacaactgaatcacacaccaactagcctctgataccaattg 49514865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 23 - 391
Target Start/End: Original strand, 27745961 - 27746335
Alignment:
23 atgcttagttatgctgtatgataataattggttgattttaactccttccaatactcaggtacctacgaactacgtagtcaaagatttcggtcctcgagca 122  Q
    ||||||| ||||||| ||||||||||||||||  ||||| ||||||  |||| ||||||||||| | |||||||||||||||||||||||||||||||||    
27745961 atgcttatttatgctctatgataataattggtatattttgactcctatcaatgctcaggtacctgcaaactacgtagtcaaagatttcggtcctcgagca 27746060  T
123 cttcagcacagtaaagttgattttgattgggaggatgatgatccctttcgcaaaaggaccttgagtcgaaaatttactgatgagcaggtcagcactgccc 222  Q
    ||||||||||||||||||||||||  |||||| |||||||| ||| ||||||||||||||||||| || |||||||||||||||||||| ||||||||||    
27746061 cttcagcacagtaaagttgattttacttgggatgatgatgacccccttcgcaaaaggaccttgagacggaaatttactgatgagcaggttagcactgccc 27746160  T
223 tagcctatggta---aacatctgatggataacataaaaaatggggtaaaatatagtattgtaattcactatgttaattgtggaaatccaagcttgcatca 319  Q
    ||| ||||||||   ||||||| ||||||| |  ||||||||| || ||| ||||||||||||||| |  | ||||||||||||||||| ||||| ||||    
27746161 tagtctatggtaaacaacatctaatggataccggaaaaaatggagttaaacatagtattgtaattcgcagtattaattgtggaaatccaggcttgtatca 27746260  T
320 c---catgatatcaggtcttggtttcttaagacaataggaaatgcagaaacaaggaaatacatggtctgggaaat 391  Q
    |    |||||||||||||||||||||| |||||||||||||||| |||||||| |||| ||| |||  |||||||    
27746261 ctatgatgatatcaggtcttggtttctgaagacaataggaaatgtagaaacaatgaaaaacacggtaagggaaat 27746335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC