View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9313-LTR4-TNT-insertion-6 (Length: 349)

Name: F9313-LTR4-TNT-insertion-6
Description: F9313-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9313-LTR4-TNT-insertion-6
F9313-LTR4-TNT-insertion-6
[»] chr5 (2 HSPs)
chr5 (9-339)||(2691792-2692122)
chr5 (67-166)||(2678159-2678258)


Alignment Details
Target: chr5 (Bit Score: 331; Significance: 0; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 9 - 339
Target Start/End: Original strand, 2691792 - 2692122
Alignment:
9 ctgcaacatcatattttgaaggcagtgactatgagaatgtaaactgcaacacaatttgttttatctcatgtttgataggctaaaactgttgcagaggaaa 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2691792 ctgcaacatcatattttgaaggcagtgactatgagaatgtaaactgcaacacaatttgttttatctcatgtttgataggctaaaactgttgcagaggaaa 2691891  T
109 tgagaattggatttatgggattaggttttcagcctaaatggagactaggagacatacctaaagtacctaaggtaataaatatttatgtggtatttactta 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2691892 tgagaattggatttatgggattaggttttcagcctaaatggagactaggagacatacctaaagtacctaaggtaataaatatttatgtggtatttactta 2691991  T
209 ttctatcaatatttgaatgcatatatatatagttagatggactcattgtttccttaaaagtatacttgagtgaatgtttcttaaaattcttattactgga 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2691992 ttctatcaatatttgaatgcatatatatatagttagatggactcattgtttccttaaaagtatacttgagtgaatgtttcttaaaattcttattactgga 2692091  T
309 atggttgctgatatttggtttcacttgatta 339  Q
    |||||||||||||||||||||||||||||||    
2692092 atggttgctgatatttggtttcacttgatta 2692122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 67 - 166
Target Start/End: Original strand, 2678159 - 2678258
Alignment:
67 ttttatctcatgtttgataggctaaaactgttgcagaggaaatgagaattggatttatgggattaggttttcagcctaaatggagactaggagacatacc 166  Q
    |||||| ||||||||||||||| ||||||||||||||||||||| ||||||||||| | ||||||||||||| ||||||||||||||  | |||||||||    
2678159 ttttatttcatgtttgataggccaaaactgttgcagaggaaatgggaattggatttttaggattaggttttctgcctaaatggagacaggaagacatacc 2678258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC