View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9313-LTR4-TNT-insertion-9 (Length: 229)

Name: F9313-LTR4-TNT-insertion-9
Description: F9313-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9313-LTR4-TNT-insertion-9
F9313-LTR4-TNT-insertion-9
[»] chr3 (1 HSPs)
chr3 (11-220)||(52244152-52244361)


Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 11 - 220
Target Start/End: Original strand, 52244152 - 52244361
Alignment:
11 tgggagggctaaataatacagaatagatctgcaaaactttgtatcattcagtcactaacaaatttacaagaaatgaacaacaaaatcatagaaataggct 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52244152 tgggagggctaaataatacagaatagatctgcaaaactttgtatcattcagtcactaacaaatttacaagaaatgaacaacaaaatcatagaaataggct 52244251  T
111 gcagagcttaagcaataaccagaatgtattgataccgaatatattcagatatcataatcaggaataattgcataaaggcgaaagattaaaaaccctagct 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52244252 gcagagcttaagcaataaccagaatgtattgataccgaatatattcagatatcataatcaggaataattgcataaaggcgaaagattaaaaaccctagct 52244351  T
211 gagtcaattg 220  Q
    ||||||||||    
52244352 gagtcaattg 52244361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC