View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9314-LTR4-TNT-insertion-1 (Length: 441)

Name: F9314-LTR4-TNT-insertion-1
Description: F9314-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9314-LTR4-TNT-insertion-1
F9314-LTR4-TNT-insertion-1
[»] chr8 (12 HSPs)
chr8 (9-431)||(6097561-6097983)
chr8 (24-191)||(6179771-6179938)
chr8 (13-161)||(6047170-6047318)
chr8 (38-191)||(6188545-6188698)
chr8 (24-191)||(6145511-6145678)
chr8 (51-174)||(6197012-6197135)
chr8 (66-99)||(7087005-7087038)
chr8 (67-99)||(11125535-11125567)
chr8 (59-103)||(12178790-12178834)
chr8 (59-103)||(12190485-12190529)
chr8 (59-103)||(12423218-12423262)
chr8 (59-103)||(12434913-12434957)
[»] chr5 (1 HSPs)
chr5 (56-153)||(37450195-37450292)
[»] chr2 (3 HSPs)
chr2 (62-108)||(16334755-16334801)
chr2 (62-108)||(16124850-16124896)
chr2 (62-108)||(16127003-16127049)
[»] chr3 (13 HSPs)
chr3 (59-99)||(23353876-23353916)
chr3 (59-99)||(23406725-23406765)
chr3 (59-99)||(23441856-23441896)
chr3 (59-99)||(23449246-23449286)
chr3 (59-99)||(23456010-23456050)
chr3 (59-99)||(23465379-23465419)
chr3 (59-99)||(23474388-23474428)
chr3 (62-99)||(21088551-21088588)
chr3 (59-108)||(36025434-36025483)
chr3 (59-99)||(21087363-21087403)
chr3 (59-99)||(23388365-23388405)
chr3 (59-99)||(23480736-23480776)
chr3 (59-99)||(23501009-23501049)
[»] scaffold0570 (1 HSPs)
scaffold0570 (59-90)||(9747-9778)
[»] scaffold0201 (1 HSPs)
scaffold0201 (59-90)||(13562-13593)
[»] chr4 (1 HSPs)
chr4 (69-108)||(12894720-12894759)
[»] scaffold0955 (1 HSPs)
scaffold0955 (56-128)||(3128-3200)
[»] scaffold0022 (1 HSPs)
scaffold0022 (59-99)||(167637-167677)


Alignment Details
Target: chr8 (Bit Score: 419; Significance: 0; HSPs: 12)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 419; E-Value: 0
Query Start/End: Original strand, 9 - 431
Target Start/End: Complemental strand, 6097983 - 6097561
Alignment:
9 gtccagcacttgttcaagcaatccaagaatcacgtatgtctctcgtggttttctcagaaaactatgcttcctcaaaatggtgtttggatgaactcctcaa 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6097983 gtccagcacttgttcaagcaatccaagaatcacgtatgtctctcgtggttttctcagaaaactatgcttcctcaaaatggtgtttggatgaactcctcaa 6097884  T
109 aatactcgaatgtggaaaatttcatgatcaagtggttatacctgtgttctatagaattgatccatcagatgtacgtcatcagacgggaagttacaaggaa 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6097883 aatactcgaatgtggaaaatttcatgatcaagtggttatacctgtgttctatagaattgatccatcagatgtacgtcatcagacgggaagttacaaggaa 6097784  T
209 ccatttgcaaattaccagatagatcgcaagagcaatgaagacaaagtgtctcaatggaaagctgctctcactgagatcgccaatatctccggatgggact 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6097783 ccatttgcaaattaccagatagatcgcaagagcaatgaagacaaagtgtctcaatggaaagctgctctcactgagatcgccaatatctccggatgggact 6097684  T
309 ccagaatctacgggtaattaattactttcctttcactacccttaaataattataggtaatttgtttaacagccgatgagaattagtcacacgagcggggc 408  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6097683 ccagaatctacgggtaattaattactttcctttcactacccttaaataattataggtaatttgtttaacagccgatgagaattagtcacacgagcggggc 6097584  T
409 tcgaattcggattctctcgaatt 431  Q
    ||||| |||||||||||||||||    
6097583 tcgaactcggattctctcgaatt 6097561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 24 - 191
Target Start/End: Complemental strand, 6179938 - 6179771
Alignment:
24 aagcaatccaagaatcacgtatgtctctcgtggttttctcagaaaactatgcttcctcaaaatggtgtttggatgaactcctcaaaatactcgaatgtgg 123  Q
    ||||||||||||| |||| ||||||||| || ||||||||||||||||||||  ||||||| ||||| ||||||||||||||| | |||||  ||||  |    
6179938 aagcaatccaagattcacatatgtctcttgtagttttctcagaaaactatgcaacctcaaagtggtgcttggatgaactcctccatatactacaatgcag 6179839  T
124 aaaatttcatgatcaagtggttatacctgtgttctatagaattgatccatcagatgtacgtcatcaga 191  Q
    ||||  ||||| ||| || || ||||||||||||||||  || ||||| ||| |||| ||||||||||    
6179838 aaaacatcatggtcaggtagtaatacctgtgttctataacatagatccttcacatgttcgtcatcaga 6179771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 13 - 161
Target Start/End: Complemental strand, 6047318 - 6047170
Alignment:
13 agcacttgttcaagcaatccaagaatcacgtatgtctctcgtggttttctcagaaaactatgcttcctcaaaatggtgtttggatgaactcctcaaaata 112  Q
    |||||||| | ||||||||||||| ||||| || ||||| || || |||||  |||| |||||  ||||||| ||||| ||| |||||||||||||||||    
6047318 agcacttgctgaagcaatccaagactcacgcatatctcttgttgtattctccaaaaattatgcaacctcaaagtggtgcttgaatgaactcctcaaaata 6047219  T
113 ctcgaatgtggaaaatttcatgatcaagtggttatacctgtgttctata 161  Q
    || |||||   |||| |||||| |||||| |||||||||||||||||||    
6047218 cttgaatgcaaaaaacttcatggtcaagttgttatacctgtgttctata 6047170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 38 - 191
Target Start/End: Complemental strand, 6188698 - 6188545
Alignment:
38 tcacgtatgtctctcgtggttttctcagaaaactatgcttcctcaaaatggtgtttggatgaactcctcaaaatactcgaatgtggaaaatttcatgatc 137  Q
    |||| ||||||||| || ||||||||| || |||||||  | ||||| ||||| |||||||||||| || | |||||  ||||  ||||| || |||  |    
6188698 tcacatatgtctcttgtagttttctcaaaagactatgcaacttcaaagtggtgcttggatgaactcgtccacatacttcaatgcagaaaacttaatggac 6188599  T
138 aagtggttatacctgtgttctatagaattgatccatcagatgtacgtcatcaga 191  Q
    | || |||||||||||||||||||  || ||||||||| |||||||||||||||    
6188598 atgtagttatacctgtgttctataacatagatccatcacatgtacgtcatcaga 6188545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 24 - 191
Target Start/End: Complemental strand, 6145678 - 6145511
Alignment:
24 aagcaatccaagaatcacgtatgtctctcgtggttttctcagaaaactatgcttcctcaaaatggtgtttggatgaactcctcaaaatactcgaatgtgg 123  Q
    |||||||| |||| || | ||||||| | || ||||||||| || |||||||  | ||||| ||||||||||||||||||||  |||||||| | ||  |    
6145678 aagcaatcaaagactcgcatatgtctattgtagttttctcaaaagactatgcaacttcaaagtggtgtttggatgaactcctgcaaatactccattgcag 6145579  T
124 aaaatttcatgatcaagtggttatacctgtgttctatagaattgatccatcagatgtacgtcatcaga 191  Q
    | || ||  ||  || || |||||||||||||||||||  || ||||||||| |||| ||||||||||    
6145578 agaactttttgggcaggttgttatacctgtgttctataacatagatccatcacatgttcgtcatcaga 6145511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 51 - 174
Target Start/End: Complemental strand, 6197135 - 6197012
Alignment:
51 tcgtggttttctcagaaaactatgcttcctcaaaatggtgtttggatgaactcctcaaaatactcgaatgtggaaaatttcatgatcaagtggttatacc 150  Q
    |||| |||||||| ||||| | |||| |||||| |||||||||||| |||||  ||||| |||| |||||  ||||| |  | | |||||| ||||||||    
6197135 tcgttgttttctctgaaaattttgctacctcaacatggtgtttggaagaactggtcaaagtactggaatgcagaaaagtcaaaggtcaagttgttatacc 6197036  T
151 tgtgttctatagaattgatccatc 174  Q
    ||| ||||||| ||  ||||||||    
6197035 tgttttctataaaacagatccatc 6197012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 66 - 99
Target Start/End: Complemental strand, 7087038 - 7087005
Alignment:
66 aaaactatgcttcctcaaaatggtgtttggatga 99  Q
    ||||||||||||| ||||||||||||||||||||    
7087038 aaaactatgcttcttcaaaatggtgtttggatga 7087005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 67 - 99
Target Start/End: Complemental strand, 11125567 - 11125535
Alignment:
67 aaactatgcttcctcaaaatggtgtttggatga 99  Q
    ||||||||||||||||| |||||||||||||||    
11125567 aaactatgcttcctcaacatggtgtttggatga 11125535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 59 - 103
Target Start/End: Complemental strand, 12178834 - 12178790
Alignment:
59 ttctcagaaaactatgcttcctcaaaatggtgtttggatgaactc 103  Q
    ||||||||||||||||| || |||| |||||||||| ||||||||    
12178834 ttctcagaaaactatgcatcttcaacatggtgtttgaatgaactc 12178790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 59 - 103
Target Start/End: Complemental strand, 12190529 - 12190485
Alignment:
59 ttctcagaaaactatgcttcctcaaaatggtgtttggatgaactc 103  Q
    ||||||||||||||||| || |||| |||||||||| ||||||||    
12190529 ttctcagaaaactatgcatcttcaacatggtgtttgaatgaactc 12190485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 59 - 103
Target Start/End: Complemental strand, 12423262 - 12423218
Alignment:
59 ttctcagaaaactatgcttcctcaaaatggtgtttggatgaactc 103  Q
    ||||||||||||||||| || |||| |||||||||| ||||||||    
12423262 ttctcagaaaactatgcatcttcaacatggtgtttgaatgaactc 12423218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 59 - 103
Target Start/End: Complemental strand, 12434957 - 12434913
Alignment:
59 ttctcagaaaactatgcttcctcaaaatggtgtttggatgaactc 103  Q
    ||||||||||||||||| || |||| |||||||||| ||||||||    
12434957 ttctcagaaaactatgcatcttcaacatggtgtttgaatgaactc 12434913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 56 - 153
Target Start/End: Original strand, 37450195 - 37450292
Alignment:
56 gttttctcagaaaactatgcttcctcaaaatggtgtttggatgaactcctcaaaatactcgaatgtggaaaatttcatgatcaagtggttatacctgt 153  Q
    |||||||| ||||| | |||| | ||||||||||||||||| |||||| ||||| | ||||||||| |||||  ||||| |||| | |||||||||||    
37450195 gttttctctgaaaattttgctacatcaaaatggtgtttggaagaactcgtcaaagtgctcgaatgtagaaaagatcatggtcaaattgttatacctgt 37450292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.0000000002; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 62 - 108
Target Start/End: Original strand, 16334755 - 16334801
Alignment:
62 tcagaaaactatgcttcctcaaaatggtgtttggatgaactcctcaa 108  Q
    ||||||||||||||||| ||||||||||||||| |||||||| ||||    
16334755 tcagaaaactatgcttcttcaaaatggtgtttgaatgaactcgtcaa 16334801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 62 - 108
Target Start/End: Complemental strand, 16124896 - 16124850
Alignment:
62 tcagaaaactatgcttcctcaaaatggtgtttggatgaactcctcaa 108  Q
    |||||| |||||||||| ||||||||||||||| |||||||| ||||    
16124896 tcagaagactatgcttcttcaaaatggtgtttgaatgaactcgtcaa 16124850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 62 - 108
Target Start/End: Complemental strand, 16127049 - 16127003
Alignment:
62 tcagaaaactatgcttcctcaaaatggtgtttggatgaactcctcaa 108  Q
    |||||| |||||||||| ||||||||||||||| |||||||| ||||    
16127049 tcagaagactatgcttcttcaaaatggtgtttgaatgaactcgtcaa 16127003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000003; HSPs: 13)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 59 - 99
Target Start/End: Complemental strand, 23353916 - 23353876
Alignment:
59 ttctcagaaaactatgcttcctcaaaatggtgtttggatga 99  Q
    |||||||||||||||||||||||||||||||| ||| ||||    
23353916 ttctcagaaaactatgcttcctcaaaatggtgcttgaatga 23353876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 59 - 99
Target Start/End: Complemental strand, 23406765 - 23406725
Alignment:
59 ttctcagaaaactatgcttcctcaaaatggtgtttggatga 99  Q
    |||||||||||||||||||||||||||||||| ||| ||||    
23406765 ttctcagaaaactatgcttcctcaaaatggtgcttgaatga 23406725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 59 - 99
Target Start/End: Complemental strand, 23441896 - 23441856
Alignment:
59 ttctcagaaaactatgcttcctcaaaatggtgtttggatga 99  Q
    |||||||||||||||||||||||||||||||| ||| ||||    
23441896 ttctcagaaaactatgcttcctcaaaatggtgcttgaatga 23441856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 59 - 99
Target Start/End: Complemental strand, 23449286 - 23449246
Alignment:
59 ttctcagaaaactatgcttcctcaaaatggtgtttggatga 99  Q
    |||||||||||||||||||||||||||||||| ||| ||||    
23449286 ttctcagaaaactatgcttcctcaaaatggtgcttgaatga 23449246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 59 - 99
Target Start/End: Complemental strand, 23456050 - 23456010
Alignment:
59 ttctcagaaaactatgcttcctcaaaatggtgtttggatga 99  Q
    |||||||||||||| ||||||||||||||||||||| ||||    
23456050 ttctcagaaaactacgcttcctcaaaatggtgtttgaatga 23456010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 59 - 99
Target Start/End: Complemental strand, 23465419 - 23465379
Alignment:
59 ttctcagaaaactatgcttcctcaaaatggtgtttggatga 99  Q
    |||||||||||||||||||||||||||||||| ||| ||||    
23465419 ttctcagaaaactatgcttcctcaaaatggtgcttgaatga 23465379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 59 - 99
Target Start/End: Complemental strand, 23474428 - 23474388
Alignment:
59 ttctcagaaaactatgcttcctcaaaatggtgtttggatga 99  Q
    |||||||||||||||||||||||||||||||| ||| ||||    
23474428 ttctcagaaaactatgcttcctcaaaatggtgcttgaatga 23474388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 62 - 99
Target Start/End: Complemental strand, 21088588 - 21088551
Alignment:
62 tcagaaaactatgcttcctcaaaatggtgtttggatga 99  Q
    ||||||||||||||||||||||||||||| ||| ||||    
21088588 tcagaaaactatgcttcctcaaaatggtgcttgaatga 21088551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 59 - 108
Target Start/End: Complemental strand, 36025483 - 36025434
Alignment:
59 ttctcagaaaactatgcttcctcaaaatggtgtttggatgaactcctcaa 108  Q
    |||||| || |||||||||||||||||||||| ||| |||||||| ||||    
36025483 ttctcaaaagactatgcttcctcaaaatggtgcttgaatgaactcgtcaa 36025434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 59 - 99
Target Start/End: Complemental strand, 21087403 - 21087363
Alignment:
59 ttctcagaaaactatgcttcctcaaaatggtgtttggatga 99  Q
    |||||||||||||| ||||||||||||||||| ||| ||||    
21087403 ttctcagaaaactacgcttcctcaaaatggtgcttgaatga 21087363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 59 - 99
Target Start/End: Complemental strand, 23388405 - 23388365
Alignment:
59 ttctcagaaaactatgcttcctcaaaatggtgtttggatga 99  Q
    ||||||||||| |||||||||||||||||||| ||| ||||    
23388405 ttctcagaaaattatgcttcctcaaaatggtgcttgaatga 23388365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 59 - 99
Target Start/End: Complemental strand, 23480776 - 23480736
Alignment:
59 ttctcagaaaactatgcttcctcaaaatggtgtttggatga 99  Q
    |||||||||||||||||||| ||||||||||| ||| ||||    
23480776 ttctcagaaaactatgcttcttcaaaatggtgcttgaatga 23480736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 59 - 99
Target Start/End: Complemental strand, 23501049 - 23501009
Alignment:
59 ttctcagaaaactatgcttcctcaaaatggtgtttggatga 99  Q
    |||||||||||||||||||| ||||||||||| ||| ||||    
23501049 ttctcagaaaactatgcttcgtcaaaatggtgcttgaatga 23501009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0570 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0570
Description:

Target: scaffold0570; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 59 - 90
Target Start/End: Original strand, 9747 - 9778
Alignment:
59 ttctcagaaaactatgcttcctcaaaatggtg 90  Q
    ||||||||||||||||||||||||||||||||    
9747 ttctcagaaaactatgcttcctcaaaatggtg 9778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0201 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0201
Description:

Target: scaffold0201; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 59 - 90
Target Start/End: Complemental strand, 13593 - 13562
Alignment:
59 ttctcagaaaactatgcttcctcaaaatggtg 90  Q
    ||||||||||||||||||||||||||||||||    
13593 ttctcagaaaactatgcttcctcaaaatggtg 13562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 69 - 108
Target Start/End: Original strand, 12894720 - 12894759
Alignment:
69 actatgcttcctcaaaatggtgtttggatgaactcctcaa 108  Q
    |||||||||||||||||||||||||| |||||||| ||||    
12894720 actatgcttcctcaaaatggtgtttgaatgaactcgtcaa 12894759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0955 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0955
Description:

Target: scaffold0955; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 56 - 128
Target Start/End: Original strand, 3128 - 3200
Alignment:
56 gttttctcagaaaactatgcttcctcaaaatggtgtttggatgaactcctcaaaatactcgaatgtggaaaat 128  Q
    ||||| ||| ||||||||||  | ||||||||||||||||||||| |  | ||||||||||| ||| ||||||    
3128 gttttttcaaaaaactatgcaacttcaaaatggtgtttggatgaagttgtgaaaatactcgagtgtagaaaat 3200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0022 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0022
Description:

Target: scaffold0022; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 59 - 99
Target Start/End: Original strand, 167637 - 167677
Alignment:
59 ttctcagaaaactatgcttcctcaaaatggtgtttggatga 99  Q
    |||||||||||||||||||||||| ||||||| ||| ||||    
167637 ttctcagaaaactatgcttcctcataatggtgcttgaatga 167677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105361 times since January 2019
Visitors: 2325