View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9314-LTR4-TNT-insertion-11 (Length: 768)

Name: F9314-LTR4-TNT-insertion-11
Description: F9314-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9314-LTR4-TNT-insertion-11
F9314-LTR4-TNT-insertion-11
[»] chr2 (3 HSPs)
chr2 (8-768)||(20583801-20584561)
chr2 (469-575)||(20574950-20575057)
chr2 (496-531)||(20577816-20577851)


Alignment Details
Target: chr2 (Bit Score: 710; Significance: 0; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 710; E-Value: 0
Query Start/End: Original strand, 8 - 768
Target Start/End: Original strand, 20583801 - 20584561
Alignment:
8 atgaaaacattgtgtacgtaacattgaatataccaaaattcacgaccatcagccatgaaaacaaatgtaaaaagggaaatgctaaccgatgctaaagggt 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20583801 atgaaaacattgtgtacgtaacattgaatataccaaaattcacgaccatcagccatgaaaacaaatgtaaaaagggaaatgctaaccgatgctaaagggt 20583900  T
108 tattatgctaaagggttggaaacaacgtgtgactggttgttgatatagctgatcccggattaaatctcacattgaaagaaaagctacgattttgcccgca 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20583901 tattatgctaaagggttggaaacaacgtgtgactggttgttgatatagctgatcccggattaaatctcacattgaaagaaaagctacgattttgcccgca 20584000  T
208 agaatagctataatctcaactgataaaaatgccggaattgctagaccagacgcggtgaccaaggtccgtaccctgactcctctatttatgtgagagtttt 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20584001 agaatagctataatctcaactgataaaaatgccggaattgctagaccagacgcggtgaccaaggtccgtaccctgactcctctatttatgtgagagtttt 20584100  T
308 caatacctattgtaatttcgtctatccacnnnnnnnnnnnnnnnnnctacgattgaagttgaacaacctaatttcattcatatgcagaaactgtaataaa 407  Q
    |||||||||||||||||||||||||||||                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20584101 caatacctattgtaatttcgtctatccacaaaaattaaaataaaaactacgattgaagttgaacaacctaatttcattcatatgcagaaactgtaataaa 20584200  T
408 ggcttttccatcttgcacagaggcattaccacccttcacagctcattgattccaaagcaatcagatagtcatagcaatgacatgatggaaaaccagtttg 507  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20584201 ggcttttccatcttgcacagaggcattaccacccttcacagctcattgattccaaagcaatcagatagtcatagcaatgacatgatggaaaaccagtttg 20584300  T
508 cagtcattgattcaaaaatgcaaatggtatgctatcagttataacattagtcaaatgcaaactaaacgtccgaaagcaattgtaaaaggaaaacaaaatg 607  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20584301 cagtcattgattcaaaaatgcaaatggtatgctatcagttataacattagtcaaatgcaaactaaacgtccgaaagcaattgtaaaaggaaaacaaaatg 20584400  T
608 caaactaaacgtccaatccaccctaccattatccacggtgtagaagaccaacttgttacttataagcagaacaacatgattttcaagaatgagcactggt 707  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20584401 caaactaaacgtccaatccaccctaccattatccacggtgtagaagaccaacttgttacttataagcagaacaacatgattttcaagaatgagcactggt 20584500  T
708 ttaatacaagaaagtgtgtgttgtgcatgattctgtaactgctctagagtttcttacacgc 768  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20584501 ttaatacaagaaagtgtgtgttgtgcatgattctgtaactgctctagagtttcttacacgc 20584561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 469 - 575
Target Start/End: Original strand, 20574950 - 20575057
Alignment:
469 cagatagtcatagcaatgacatgatggaaaaccagtttgcagtcattgattcaaaa-atgcaaatggtatgctatcagttataacattagtcaaatgcaa 567  Q
    ||||||||| | |||||||||||||  ||||| ||||||||| |||  ||| |||| |||||||||||| || |||| | ||| ||||||  ||||| ||    
20574950 cagatagtctttgcaatgacatgataaaaaactagtttgcagccataaattgaaaaaatgcaaatggtacgcaatcaataatagcattagcgaaatgaaa 20575049  T
568 actaaacg 575  Q
    ||||||||    
20575050 actaaacg 20575057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 496 - 531
Target Start/End: Original strand, 20577816 - 20577851
Alignment:
496 aaaaccagtttgcagtcattgattcaaaaatgcaaa 531  Q
    ||||| ||||||||||||||||||||||||||||||    
20577816 aaaactagtttgcagtcattgattcaaaaatgcaaa 20577851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC