View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9314-LTR4-TNT-insertion-2 (Length: 301)

Name: F9314-LTR4-TNT-insertion-2
Description: F9314-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9314-LTR4-TNT-insertion-2
[»] chr4 (1 HSPs)
chr4 (8-292)||(30773813-30774097)
[»] chr2 (1 HSPs)
chr2 (55-181)||(16663341-16663467)

Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 8 - 292
Target Start/End: Complemental strand, 30774097 - 30773813
8 tggacaaaatttgctgtgaccatgttatctaagattgtgactgttcctgacttgtaaaccaacattattatgccaaccttgtgctaaaagattgtaacca 107  Q
30774097 tggacaaaatttgctgtgaccatgttatctaagattgtgactgttcctgacttgtaaaccaacattattatgccaaccttgtgctaaaagattgtaacca 30773998  T
108 tgacttgggcgctcatgttaccatttcagttaattttgattttatttgattggtatacaagtttctttgattagagaaaagtaatgttaatttcgtctct 207  Q
30773997 tgacttgggcgctcatgttaccatttcagttaattttgattttatttgattggtatacaagtttctttgattagagaaaagtaatgttaatttcgtctct 30773898  T
208 aaaatatagttcaaaactaattatcaagttgtagttttggttgtcttggtgagaagggtttgagtgatcactgtctcaacaattg 292  Q
30773897 aaaatatagttcaaaactaattatcaagttgtagttttggttgtcttggtgagaagggtttgagtgatcactgtctcaacaattg 30773813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 55 - 181
Target Start/End: Original strand, 16663341 - 16663467
55 tgacttgtaaaccaacattattatgccaaccttgtgctaaaagattgtaaccatgacttgggcgctcatgttaccatttcagttaattttgattttattt 154  Q
    ||||||||||||||||||||  ||||||| |||||||||||||| ||||||||||| |||||| ||| ||||||| ||||||||||||||||||||||||    
16663341 tgacttgtaaaccaacattaccatgccaatcttgtgctaaaagactgtaaccatgatttgggcactcttgttaccttttcagttaattttgattttattt 16663440  T
155 gattggtatacaagtttctttgattag 181  Q
    ||||||  || |||||| | |||||||    
16663441 gattggcttaaaagtttatgtgattag 16663467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 98572 times since January 2019
Visitors: 2275