View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9314-LTR4-TNT-insertion-2 (Length: 301)

Name: F9314-LTR4-TNT-insertion-2
Description: F9314-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9314-LTR4-TNT-insertion-2
F9314-LTR4-TNT-insertion-2
[»] chr4 (1 HSPs)
chr4 (8-292)||(30773813-30774097)
[»] chr2 (1 HSPs)
chr2 (55-181)||(16663341-16663467)


Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 8 - 292
Target Start/End: Complemental strand, 30774097 - 30773813
Alignment:
8 tggacaaaatttgctgtgaccatgttatctaagattgtgactgttcctgacttgtaaaccaacattattatgccaaccttgtgctaaaagattgtaacca 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30774097 tggacaaaatttgctgtgaccatgttatctaagattgtgactgttcctgacttgtaaaccaacattattatgccaaccttgtgctaaaagattgtaacca 30773998  T
108 tgacttgggcgctcatgttaccatttcagttaattttgattttatttgattggtatacaagtttctttgattagagaaaagtaatgttaatttcgtctct 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30773997 tgacttgggcgctcatgttaccatttcagttaattttgattttatttgattggtatacaagtttctttgattagagaaaagtaatgttaatttcgtctct 30773898  T
208 aaaatatagttcaaaactaattatcaagttgtagttttggttgtcttggtgagaagggtttgagtgatcactgtctcaacaattg 292  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30773897 aaaatatagttcaaaactaattatcaagttgtagttttggttgtcttggtgagaagggtttgagtgatcactgtctcaacaattg 30773813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 55 - 181
Target Start/End: Original strand, 16663341 - 16663467
Alignment:
55 tgacttgtaaaccaacattattatgccaaccttgtgctaaaagattgtaaccatgacttgggcgctcatgttaccatttcagttaattttgattttattt 154  Q
    ||||||||||||||||||||  ||||||| |||||||||||||| ||||||||||| |||||| ||| ||||||| ||||||||||||||||||||||||    
16663341 tgacttgtaaaccaacattaccatgccaatcttgtgctaaaagactgtaaccatgatttgggcactcttgttaccttttcagttaattttgattttattt 16663440  T
155 gattggtatacaagtttctttgattag 181  Q
    ||||||  || |||||| | |||||||    
16663441 gattggcttaaaagtttatgtgattag 16663467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC