View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9314-LTR4-TNT-insertion-3 (Length: 621)

Name: F9314-LTR4-TNT-insertion-3
Description: F9314-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9314-LTR4-TNT-insertion-3
F9314-LTR4-TNT-insertion-3
[»] chr7 (1 HSPs)
chr7 (11-611)||(1287855-1288455)
[»] chr5 (1 HSPs)
chr5 (430-604)||(1456192-1456366)
[»] chr2 (1 HSPs)
chr2 (453-606)||(12891395-12891548)


Alignment Details
Target: chr7 (Bit Score: 597; Significance: 0; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 597; E-Value: 0
Query Start/End: Original strand, 11 - 611
Target Start/End: Original strand, 1287855 - 1288455
Alignment:
11 acatcagtagaagagcaagcattacaggcaaaacttgtagcgtagtactcgatcgtgctcaatccattttagagaatgaactcagttaagcaaacaaatc 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
1287855 acatcagtagaagagcaagcattacaggcaaaacttgtagcgtagtactcgatcgtgctcagtccattttagagaatgaactcagttaagcaaacaaatc 1287954  T
111 tctaaactcagttaagcaaattgtatgcctcttgcctgtaacaaaaaatcttcccacacttgatacatcataatactacttaatttatatatcgtttgga 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1287955 tctaaactcagttaagcaaattgtatgcctcttgcctgtaacaaaaaatcttcccacacttgatacatcataatactacttaatttatatatcgtttgga 1288054  T
211 attcattccaactaatcaatgattctgggagccagttgatgatgcaaccctattaacatcgttatggagggttatccttatacgtggtggaggagaaaat 310  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1288055 attcattccaactaatcaatgattctgggagccagttgatgatgcaaccctattaacatcgttatggagggttatccttatacgtggtggaggagaaaat 1288154  T
311 gggcagatagagaagttgagcagagattggatagaacgacggttggaacaccaagtgtgtttgtgtgaattgaaaaattattatgtcccatatccggtag 410  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1288155 gggcagatagagaagttgagcagagattggatagaacgacggttggaacaccaagtgtgtttgtgtgaattgaaaaattattatgtcccatatccggtag 1288254  T
411 attatacacacaatattagtgggcaagacttacatacggttccatacacacagttcaacctgtgcttcatgtaattttgattaaacggcatcgtttaaaa 510  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1288255 attatacacacaatattagtgggcaagacttacatacggttccatacacacagttcaacctgtgcttcatgtaattttgattaaacggcatcgtttaaaa 1288354  T
511 caattaaggaggtgttggttggcacgtgatttagccaaatttagtacggaacagcatacacagtgcgtaggtcattgtacataagtaatttcctttaatt 610  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1288355 caattaaggaggtgttggttggcacgtgatttagccaaatttagtacggaacagcatacacagtgcgtaggtcattgtacataagtaatttcctttaatt 1288454  T
611 a 611  Q
    |    
1288455 a 1288455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 155; Significance: 6e-82; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 155; E-Value: 6e-82
Query Start/End: Original strand, 430 - 604
Target Start/End: Original strand, 1456192 - 1456366
Alignment:
430 tgggcaagacttacatacggttccatacacacagttcaacctgtgcttcatgtaattttgattaaacggcatcgtttaaaacaattaaggaggtgttggt 529  Q
    ||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||    
1456192 tgggcaagacttacatacggttccatacacacaattcaacctgtgtttcatgtaattttgattaaacggcatcgtttaaaacaactaaggaggtgttggt 1456291  T
530 tggcacgtgatttagccaaatttagtacggaacagcatacacagtgcgtaggtcattgtacataagtaatttcct 604  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||    
1456292 tggcacgtgatttagccaaatttagtacgaaacagcatacacagtgcgtaggtcactgtacataagtaatttcct 1456366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 110; Significance: 4e-55; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 110; E-Value: 4e-55
Query Start/End: Original strand, 453 - 606
Target Start/End: Complemental strand, 12891548 - 12891395
Alignment:
453 catacacacagttcaacctgtgcttcatgtaattttgattaaacggcatcgtttaaaacaattaaggaggtgttggttggcacgtgatttagccaaattt 552  Q
    |||| ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||| ||||||||||||||    
12891548 catatacacagttcaatctatgcttcatgtaattttgattaaacggcatcgtttaaaacaattaaaaaggtgttggttggcacgtaatttagccaaattt 12891449  T
553 agtacggaacagcatacacagtgcgtaggtcattgtacataagtaatttccttt 606  Q
    ||||  ||||||||||||||||| |||||||| |||| ||||||||||||||||    
12891448 agtattgaacagcatacacagtgtgtaggtcactgtaaataagtaatttccttt 12891395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105567 times since January 2019
Visitors: 2328