View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9314-LTR4-TNT-insertion-5 (Length: 507)

Name: F9314-LTR4-TNT-insertion-5
Description: F9314-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9314-LTR4-TNT-insertion-5
F9314-LTR4-TNT-insertion-5
[»] chr2 (1 HSPs)
chr2 (10-498)||(42837793-42838281)
[»] chr8 (5 HSPs)
chr8 (163-263)||(43913748-43913848)
chr8 (80-161)||(43913471-43913552)
chr8 (12-78)||(43913303-43913369)
chr8 (405-448)||(43914408-43914451)
chr8 (311-377)||(43914035-43914101)
[»] chr4 (1 HSPs)
chr4 (110-161)||(8635071-8635122)


Alignment Details
Target: chr2 (Bit Score: 477; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 477; E-Value: 0
Query Start/End: Original strand, 10 - 498
Target Start/End: Complemental strand, 42838281 - 42837793
Alignment:
10 aggagcacacatcattgttggaggcaaatcaggtgtagggtcttcctcatagtgaacatatttacatgtgttcatgtgccggcaagtacgaagaagagga 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
42838281 aggagcacacatcattgttggaggcaaatcaggtgtagggtcttcctcatagtgaacatatttacatgtgttcatgtgccggcaagtacgaagaaaagga 42838182  T
110 cagtctcccaaattaatgtcagtatgaagagcaatgattcgtctaaaatgaagcttattacatgctataaaggaaccagtccggcgtcgacagtcttctt 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42838181 cagtctcccaaattaatgtcagtatgaagagcaatgattcgtctaaaatgaagcttattacatgctataaaggaaccagtccggcgtcgacagtcttctt 42838082  T
210 ttgttggtaagtcacaatatggtctcatctgagaaccacctttagttttgaacttggcagctacagcagcctcccttatgcttggagtctgaataatttt 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42838081 ttgttggtaagtcacaatatggtctcatctgagaaccacctttagttttgaacttggcagctacagcagcctcccttatgcttggagtctgaataatttt 42837982  T
310 taaaagctccttagcagtttcatatttttgcatctccccaaatgatttcttattaattaaagcatcaacatcctccaaattcatactacactttgcaatt 409  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42837981 taaaagctccttagcagtttcatatttttgcatctccctaaatgatttcttattaattaaagcatcaacatcctccaaattcatactacactttgcaatt 42837882  T
410 tgttgctggttttgattcatattaccatctccgagactcagttcatcttgctgttgctgcagctgatgttgtgcagtttcaggcaattg 498  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42837881 tgttgctgattttgattcatattaccatctccgagactcagttcatcttgctgttgctgcagctgatgttgtgcagtttcaggcaattg 42837793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 61; Significance: 6e-26; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 163 - 263
Target Start/End: Original strand, 43913748 - 43913848
Alignment:
163 cttattacatgctataaaggaaccagtccggcgtcgacagtcttcttttgttggtaagtcacaatatggtctcatctgagaaccacctttagttttgaac 262  Q
    |||||||||||||| ||||||||| ||| |||| ||||| |||||||||||  |||||||||||||| || ||| |||||||||||||||||||||||||    
43913748 cttattacatgctacaaaggaaccggtctggcgccgacaatcttcttttgtcagtaagtcacaatattgtttcacctgagaaccacctttagttttgaac 43913847  T
263 t 263  Q
    |    
43913848 t 43913848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 80 - 161
Target Start/End: Original strand, 43913471 - 43913552
Alignment:
80 ttcatgtgccggcaagtacgaagaagaggacagtctcccaaattaatgtcagtatgaagagcaatgattcgtctaaaatgaa 161  Q
    ||||||||||||||||||   |||| || ||||||||||| |||||||||||| ||||||||||||||||||||||||||||    
43913471 ttcatgtgccggcaagtatctagaaaagaacagtctcccagattaatgtcagtgtgaagagcaatgattcgtctaaaatgaa 43913552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 12 - 78
Target Start/End: Original strand, 43913303 - 43913369
Alignment:
12 gagcacacatcattgttggaggcaaatcaggtgtagggtcttcctcatagtgaacatatttacatgt 78  Q
    |||||| | ||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||    
43913303 gagcacccgtcattgttggaggcaaatcaggtgtagggtcatactcatagtgaacatatttacatgt 43913369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 405 - 448
Target Start/End: Original strand, 43914408 - 43914451
Alignment:
405 caatttgttgctggttttgattcatattaccatctccgagactc 448  Q
    ||||||||||||| ||||||||||||||||||||||| ||||||    
43914408 caatttgttgctgattttgattcatattaccatctccaagactc 43914451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 311 - 377
Target Start/End: Original strand, 43914035 - 43914101
Alignment:
311 aaaagctccttagcagtttcatatttttgcatctccccaaatgatttcttattaattaaagcatcaa 377  Q
    |||||||||||| ||||||   ||||||||||||||| ||| |||||||||||||||| ||| ||||    
43914035 aaaagctccttaccagttttggatttttgcatctccctaaacgatttcttattaattatagcctcaa 43914101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 110 - 161
Target Start/End: Original strand, 8635071 - 8635122
Alignment:
110 cagtctcccaaattaatgtcagtatgaagagcaatgattcgtctaaaatgaa 161  Q
    |||||||| ||| ||| | |||||||||||| ||||||||||||||||||||    
8635071 cagtctcctaaactaaagccagtatgaagagaaatgattcgtctaaaatgaa 8635122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 93520 times since January 2019
Visitors: 2365