View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9314-LTR4-TNT-insertion-7 (Length: 790)

Name: F9314-LTR4-TNT-insertion-7
Description: F9314-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9314-LTR4-TNT-insertion-7
F9314-LTR4-TNT-insertion-7
[»] chr6 (8 HSPs)
chr6 (8-783)||(11001873-11002648)
chr6 (8-783)||(10981640-10982418)
chr6 (8-394)||(10968082-10968468)
chr6 (424-731)||(10967769-10968076)
chr6 (64-209)||(11018828-11018973)
chr6 (8-368)||(11079429-11079789)
chr6 (572-704)||(11079090-11079222)
chr6 (150-213)||(18300125-18300188)


Alignment Details
Target: chr6 (Bit Score: 768; Significance: 0; HSPs: 8)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 768; E-Value: 0
Query Start/End: Original strand, 8 - 783
Target Start/End: Complemental strand, 11002648 - 11001873
Alignment:
8 ccaaaaacccttcaggcaacaagtcatccaaactaagttcctccaagtttgactcgctccttacaatccataagaatctttgctcacttttctccaatcc 107  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11002648 ccaaaaacccttctggcaacaagtcatccaaactaagttcctccaagtttgactcgctccttacaatccataagaatctttgctcacttttctccaatcc 11002549  T
108 aatagctatctcattcaactgagccttagaaaatctccccatgcttccaaaactcaaaaacacgacgctttgactaggttgcgagtcaagccaaatcaaa 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11002548 aatagctatctcattcaactgagccttagaaaatctccccatgcttccaaaactcaaaaacacgacgctttgactaggttgcgagtcaagccaaatcaaa 11002449  T
208 cacccattttcatctcctccataagaagatgtaatcaaaggtccaatacaaaaaatggatggagttgttccatcaggaacacataccccttcattcaaac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11002448 cacccattttcatctcctccataagaagatgtaatcaaaggtccaatacaaaaaatggatggagttgttccatcaggaacacataccccttcattcaaac 11002349  T
308 ctttaatagctttttcttcaatagcatcaaaagtgttcacaataatcccagcacattccctcattgttttcgccgaatcaagcaaaatcttgcaaccttt 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11002348 ctttaatagctttttcttcaatagcatcaaaagtgttcacaataatcccagcacattccctcattgttttcgccgaatcaagcaaaatcttgcaaccttt 11002249  T
408 actctcagaatccttagcttcatcggggtaatcgtctgtcgaaaagttctttggtaacccgggaattttaagaggcatatgaagatccttgatgggtttt 507  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11002248 actctcagaatccttagcttcatcggggtaatcgtctgtcgaaaagttctttggtaacccgggaattttaagaggcatatgaagatccttgatgggtttt 11002149  T
508 gtagctttttggtgaatggttggaaagtaaaggaaagtggaaagaatggtagcacctgaagtacagtaaaagtaagtaggaatttcaaggttggtggtga 607  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
11002148 gtagctttttggtgaatggttggaaagtaaaggaaagtggaaagaatggtagcacctgaagtatagtaaaagtaagtaggaatttcaaggttggtggtga 11002049  T
608 cttgtgaggcactataggtgaggaaatctaagataatacctttgaagtttgtggttttggaaatggagttgagaatgttgtgaacatgatggttgctttt 707  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11002048 cttgtgaggcactataggtgaggaaatctaagataatacctttgaagtttgtggttttggaaatggagttgagaatgttgtgaacatgatggttgctttt 11001949  T
708 gtgtgagacttcaagtgtaagtaagtgtgttggaagtgttgtagagaatgaaattggaggaatatagtggaaatta 783  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11001948 gtgtgagacttcaagtgtaagtaagtgtgttggaagtgttgtagagaatgaaattggaggaatatagtggaaatta 11001873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 8 - 783
Target Start/End: Complemental strand, 10982418 - 10981640
Alignment:
8 ccaaaaacccttcaggcaacaagtcatccaaactaagttcctccaagtttgactcgctccttacaatccataagaatctttgctcacttttctccaatcc 107  Q
    |||||||||||||||| | ||| || ||||||||  | ||||| || |   |||||||||| | || ||| |||||||||||||||||||| ||||||||    
10982418 ccaaaaacccttcagggagcaactcgtccaaactttgctcctctaaatccaactcgctcctaataacccacaagaatctttgctcacttttttccaatcc 10982319  T
108 aatagctatctcattcaactgagccttagaaaatctccccatgcttccaaaactcaaaaacacgacgctttgactaggttgcgagtcaagccaaatcaaa 207  Q
    ||  |||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||| |||||||||| ||||||||| | | |    
10982318 aagtgctatctcattcaactgagccttagaaaatcttcccatgcttccaaaacttaacaacacgacgctttgaataggttgcgactcaagccaacttaga 10982219  T
208 cacccattttcatctcctccataagaagatgtaatcaaaggtccaatacaaaaaatggatggagttgttccatcaggaacacataccccttcattcaaac 307  Q
    ||||||||||||||| ||||||| |||||||  |||||||||||| |||| ||||||||||||    | |||||||||| | |||  ||||||||||||     
10982218 cacccattttcatcttctccatatgaagatgcgatcaaaggtccagtacagaaaatggatgga---ataccatcaggaataaataatccttcattcaaag 10982122  T
308 ctttaatagctttttcttcaatagcatcaaaagtgttcacaataatcccagcacattccctcattgttttcgccgaatcaagcaaaatcttgcaac-ctt 406  Q
    ||||||| ||| || |||||||| |||||||||||||||| ||||||||| ||||||||||| | ||||||   ||||||||| | |||||| ||| |||    
10982121 ctttaattgctcttccttcaataccatcaaaagtgttcactataatcccatcacattccctcgtagttttcatggaatcaagc-atatcttgtaacactt 10982023  T
407 tactctc------agaatccttagcttcatcggggtaatcgtctgtcgaaaagttctttggtaacccgggaattttaagaggcatatgaagatccttgat 500  Q
    || ||||      |||||| ||   | | || |||||||| ||||| ||||   ||||||||||||| ||||||| ||||||||||||||||||||| ||    
10982022 tattctcagaaatagaatcattgaatccgtcagggtaatcatctgttgaaagactctttggtaaccctggaatttgaagaggcatatgaagatccttaat 10981923  T
501 gggttttgtagctttttggtgaatggttggaaagtaaaggaaagtggaaagaatggtagcacctgaagtacagtaaaagtaagtaggaatttcaaggttg 600  Q
     ||||||||||| ||||  | ||   ||||||| | |||||||||||  | || | |||||||||||||  | ||||||||||| || || || |  ||     
10981922 aggttttgtagcattttcataaacaattggaaaatgaaggaaagtggctacaaagatagcacctgaagtgtaataaaagtaagtcgggatctcgactttc 10981823  T
601 gtggtgacttgtgaggcactataggtgaggaaatctaagataatacctttgaagtttgtggttttggaaatggagttgagaatgttgtgaacatgatggt 700  Q
     |||| |||||||||||||||||||||| |||||||||||||| | |||||| |||||||||||||||||| || | ||||||||| | |||||| | ||    
10981822 ttggttacttgtgaggcactataggtgaagaaatctaagataacagctttgaggtttgtggttttggaaatagaatggagaatgttctcaacatggttgt 10981723  T
701 tgcttttgtgtgagacttcaagtgtaagtaagtgtgttggaagtgttgtagagaatgaaattggaggaatatagtggaaatta 783  Q
    |||| |  ||  | |||||||| ||   |||| ||  |||||||||||||| |||||||||||||||||| || |||||||||    
10981722 tgctatgttgacaaacttcaagggtgcataagagttgtggaagtgttgtagggaatgaaattggaggaatgtaatggaaatta 10981640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 8 - 394
Target Start/End: Complemental strand, 10968468 - 10968082
Alignment:
8 ccaaaaacccttcaggcaacaagtcatccaaactaagttcctccaagtttgactcgctccttacaatccataagaatctttgctcacttttctccaatcc 107  Q
    |||||||||||||||| | ||| || ||||||||  | ||||| ||||   |||| ||||| |||| ||| |||||||||||||||||| | ||||||||    
10968468 ccaaaaacccttcaggaagcaactcgtccaaactttgctcctctaagtccaactcactcctaacaacccacaagaatctttgctcacttatttccaatcc 10968369  T
108 aatagctatctcattcaactgagccttagaaaatctccccatgcttccaaaactcaaaaacacgacgctttgactaggttgcgagtcaagccaaatcaaa 207  Q
    ||  |||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||| |||||| || |||||| | | |    
10968368 aagtgctatctcattcaactgagccttagaaaatcttcccatgcttccaaaacttaacaacacgacgctttgactagattgcgactcgagccaacttaga 10968269  T
208 cacccattttcatctcctccataagaagatgtaatcaaaggtccaatacaaaaaatggatggagttgttccatcaggaacacataccccttcattcaaac 307  Q
    ||| ||||||||||| ||||||||||||  |||||||| |||||||||||||||||||||||||| ||||||||||||| | |||  ||||||||||||     
10968268 cactcattttcatcttctccataagaagcggtaatcaatggtccaatacaaaaaatggatggagtagttccatcaggaatatataatccttcattcaaag 10968169  T
308 ctttaatagctttttcttcaatagcatcaaaagtgttcacaataatcccagcacattccctcattgttttcgccgaatcaagcaaaa 394  Q
    ||||| |||||||| | |||||||||||||||||||||||||||| |||| |||||| |||||| ||||| ||||| ||||| ||||    
10968168 ctttattagcttttccctcaatagcatcaaaagtgttcacaataaccccatcacattgcctcatagtttttgccgattcaaggaaaa 10968082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 108; E-Value: 8e-54
Query Start/End: Original strand, 424 - 731
Target Start/End: Complemental strand, 10968076 - 10967769
Alignment:
424 gcttcatcggggtaatcgtctgtcgaaaagttctttggtaacccgggaattttaagaggcatatgaagatccttgatgggttttgtagctttttggtgaa 523  Q
    |||||||| |||||||| ||||| ||||  || ||||||||||| ||||||  ||||||| |||| |||||||| |||||||||||||| ||||||||||    
10968076 gcttcatcagggtaatcatctgttgaaatattttttggtaacccaggaattcgaagaggcgtatggagatccttaatgggttttgtagcattttggtgaa 10967977  T
524 tggttggaaagtaaaggaaagtggaaagaatggtagcacctgaagtacagtaaaagtaagtaggaatttcaaggttggtggtgacttgtgaggcactata 623  Q
    | |||||| ||| |||||||  ||  | ||   |||||||||||||  ||||||||||||| ||||||||||| || || |||||||  |||||| ||||    
10967976 tagttggatagtgaaggaaaagggctaaaacaatagcacctgaagtgaagtaaaagtaagtgggaatttcaagctttgtagtgactttcgaggcattata 10967877  T
624 ggtgaggaaatctaagataatacctttgaagtttgtggttttggaaatggagttgagaatgttgtgaacatgatggttgcttttgtgtgagacttcaagt 723  Q
     ||||| |||||||||||||  ||||||| ||||||||||||||||||||| | |||||| ||||||||||  |  ||||||| ||| ||||  |||||     
10967876 tgtgagaaaatctaagataactcctttgaggtttgtggttttggaaatggattggagaatattgtgaacatagttattgctttggtgagagagctcaagg 10967777  T
724 gtaagtaa 731  Q
    ||||||||    
10967776 gtaagtaa 10967769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 64 - 209
Target Start/End: Complemental strand, 11018973 - 11018828
Alignment:
64 ctccttacaatccataagaatctttgctcacttttctccaatccaatagctatctcattcaactgagccttagaaaatctccccatgcttccaaaactca 163  Q
    ||||| |||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |||||||||||||| ||||    
11018973 ctcctaacaacccacaagaatctttgctcacttttctccaatccaatagctatctcattcaattgagccctagaaaatcttcccatgcttccaaagctca 11018874  T
164 aaaacacgacgctttgactaggttgcgagtcaagccaaatcaaaca 209  Q
    | ||||||||||||||||| ||||||||||| |||||| |||||||    
11018873 acaacacgacgctttgacttggttgcgagtcgagccaactcaaaca 11018828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 8 - 368
Target Start/End: Complemental strand, 11079789 - 11079429
Alignment:
8 ccaaaaacccttcaggcaacaagtcatccaaactaagttcctccaagtttgactcgctccttacaatccataagaatctttgctcacttttctccaatcc 107  Q
    ||||||||||||| |||||||| ||||||||||| ||||||||| | |     |||||||| |||||||| ||||||||||| |||||||| ||||| ||    
11079789 ccaaaaacccttctggcaacaactcatccaaacttagttcctccgactccatatcgctcctaacaatccacaagaatctttgttcacttttttccaaacc 11079690  T
108 aatagctatctcattcaactgagccttagaaaatctccccatgcttccaaaactcaaaaacacgacgctttgactaggttgcgagtcaagccaaatcaaa 207  Q
    ||||||||||| ||| |  |||||||||||||||||||| | ||||||||| ||||| || |||||||||||||  || || || || |||||| |||||    
11079689 aatagctatctgattaatttgagccttagaaaatctccctaagcttccaaagctcaacaaaacgacgctttgacctggctgtgaatcgagccaactcaaa 11079590  T
208 cacccattttcatctcctccataagaagatgtaatcaaaggtccaatacaaaaaatggatggagttgttccatcaggaacacataccccttcattcaaac 307  Q
    |||||| ||| |||| || || | || | ||  |  |  ||||| || |||||||   | ||||| ||||||||||||||||| |  || |   | |||     
11079589 cacccacttttatcttcttcacacgaggttgacactacgggtccgatgcaaaaaagcaacggagtggttccatcaggaacacacaatccatttcttaaag 11079490  T
308 ctttaatagctttttcttcaatagcatcaaaagtgttcacaataatcccagcacattccct 368  Q
    ||||||||||||| | |||||||||||| |||||||| || ||||||||| ||| ||||||    
11079489 ctttaatagctttcttttcaatagcatcgaaagtgtttacgataatcccatcactttccct 11079429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 572 - 704
Target Start/End: Complemental strand, 11079222 - 11079090
Alignment:
572 agtaaaagtaagtaggaatttcaaggttggtggtgacttgtgaggcactataggtgaggaaatctaagataatacctttgaagtttgtggttttggaaat 671  Q
    ||||||||||||| ||||||||||| ||| |||| |||||||| ||||||||| | |||||||| || ||||   |||| | ||||| |||||| | |||    
11079222 agtaaaagtaagttggaatttcaagattgttggtaacttgtgaagcactatagttaaggaaatccaacataactgctttaaggtttgaggtttttgcaat 11079123  T
672 ggagttgagaatgttgtgaacatgatggttgct 704  Q
    ||| |  ||||| |  |||||||| ||||||||    
11079122 ggattgaagaatatgatgaacatggtggttgct 11079090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 150 - 213
Target Start/End: Original strand, 18300125 - 18300188
Alignment:
150 gcttccaaaactcaaaaacacgacgctttgactaggttgcgagtcaagccaaatcaaacaccca 213  Q
    ||||||||| ||||||||||| || ||||||||||||||| |||  |||||| |||||||||||    
18300125 gcttccaaagctcaaaaacacaacactttgactaggttgcaagttgagccaactcaaacaccca 18300188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 78137 times since January 2019
Visitors: 2276