View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9314-LTR4-TNT-insertion-7 (Length: 790)

Name: F9314-LTR4-TNT-insertion-7
Description: F9314-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9314-LTR4-TNT-insertion-7
[»] chr6 (8 HSPs)
chr6 (8-783)||(11001873-11002648)
chr6 (8-783)||(10981640-10982418)
chr6 (8-394)||(10968082-10968468)
chr6 (424-731)||(10967769-10968076)
chr6 (64-209)||(11018828-11018973)
chr6 (8-368)||(11079429-11079789)
chr6 (572-704)||(11079090-11079222)
chr6 (150-213)||(18300125-18300188)

Alignment Details
Target: chr6 (Bit Score: 768; Significance: 0; HSPs: 8)
Name: chr6

Target: chr6; HSP #1
Raw Score: 768; E-Value: 0
Query Start/End: Original strand, 8 - 783
Target Start/End: Complemental strand, 11002648 - 11001873
8 ccaaaaacccttcaggcaacaagtcatccaaactaagttcctccaagtttgactcgctccttacaatccataagaatctttgctcacttttctccaatcc 107  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11002648 ccaaaaacccttctggcaacaagtcatccaaactaagttcctccaagtttgactcgctccttacaatccataagaatctttgctcacttttctccaatcc 11002549  T
108 aatagctatctcattcaactgagccttagaaaatctccccatgcttccaaaactcaaaaacacgacgctttgactaggttgcgagtcaagccaaatcaaa 207  Q
11002548 aatagctatctcattcaactgagccttagaaaatctccccatgcttccaaaactcaaaaacacgacgctttgactaggttgcgagtcaagccaaatcaaa 11002449  T
208 cacccattttcatctcctccataagaagatgtaatcaaaggtccaatacaaaaaatggatggagttgttccatcaggaacacataccccttcattcaaac 307  Q
11002448 cacccattttcatctcctccataagaagatgtaatcaaaggtccaatacaaaaaatggatggagttgttccatcaggaacacataccccttcattcaaac 11002349  T
308 ctttaatagctttttcttcaatagcatcaaaagtgttcacaataatcccagcacattccctcattgttttcgccgaatcaagcaaaatcttgcaaccttt 407  Q
11002348 ctttaatagctttttcttcaatagcatcaaaagtgttcacaataatcccagcacattccctcattgttttcgccgaatcaagcaaaatcttgcaaccttt 11002249  T
408 actctcagaatccttagcttcatcggggtaatcgtctgtcgaaaagttctttggtaacccgggaattttaagaggcatatgaagatccttgatgggtttt 507  Q
11002248 actctcagaatccttagcttcatcggggtaatcgtctgtcgaaaagttctttggtaacccgggaattttaagaggcatatgaagatccttgatgggtttt 11002149  T
508 gtagctttttggtgaatggttggaaagtaaaggaaagtggaaagaatggtagcacctgaagtacagtaaaagtaagtaggaatttcaaggttggtggtga 607  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
11002148 gtagctttttggtgaatggttggaaagtaaaggaaagtggaaagaatggtagcacctgaagtatagtaaaagtaagtaggaatttcaaggttggtggtga 11002049  T
608 cttgtgaggcactataggtgaggaaatctaagataatacctttgaagtttgtggttttggaaatggagttgagaatgttgtgaacatgatggttgctttt 707  Q
11002048 cttgtgaggcactataggtgaggaaatctaagataatacctttgaagtttgtggttttggaaatggagttgagaatgttgtgaacatgatggttgctttt 11001949  T
708 gtgtgagacttcaagtgtaagtaagtgtgttggaagtgttgtagagaatgaaattggaggaatatagtggaaatta 783  Q
11001948 gtgtgagacttcaagtgtaagtaagtgtgttggaagtgttgtagagaatgaaattggaggaatatagtggaaatta 11001873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 8 - 783
Target Start/End: Complemental strand, 10982418 - 10981640
8 ccaaaaacccttcaggcaacaagtcatccaaactaagttcctccaagtttgactcgctccttacaatccataagaatctttgctcacttttctccaatcc 107  Q
    |||||||||||||||| | ||| || ||||||||  | ||||| || |   |||||||||| | || ||| |||||||||||||||||||| ||||||||    
10982418 ccaaaaacccttcagggagcaactcgtccaaactttgctcctctaaatccaactcgctcctaataacccacaagaatctttgctcacttttttccaatcc 10982319  T
108 aatagctatctcattcaactgagccttagaaaatctccccatgcttccaaaactcaaaaacacgacgctttgactaggttgcgagtcaagccaaatcaaa 207  Q
    ||  |||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||| |||||||||| ||||||||| | | |    
10982318 aagtgctatctcattcaactgagccttagaaaatcttcccatgcttccaaaacttaacaacacgacgctttgaataggttgcgactcaagccaacttaga 10982219  T
208 cacccattttcatctcctccataagaagatgtaatcaaaggtccaatacaaaaaatggatggagttgttccatcaggaacacataccccttcattcaaac 307  Q
    ||||||||||||||| ||||||| |||||||  |||||||||||| |||| ||||||||||||    | |||||||||| | |||  ||||||||||||     
10982218 cacccattttcatcttctccatatgaagatgcgatcaaaggtccagtacagaaaatggatgga---ataccatcaggaataaataatccttcattcaaag 10982122  T
308 ctttaatagctttttcttcaatagcatcaaaagtgttcacaataatcccagcacattccctcattgttttcgccgaatcaagcaaaatcttgcaac-ctt 406  Q
    ||||||| ||| || |||||||| |||||||||||||||| ||||||||| ||||||||||| | ||||||   ||||||||| | |||||| ||| |||    
10982121 ctttaattgctcttccttcaataccatcaaaagtgttcactataatcccatcacattccctcgtagttttcatggaatcaagc-atatcttgtaacactt 10982023  T
407 tactctc------agaatccttagcttcatcggggtaatcgtctgtcgaaaagttctttggtaacccgggaattttaagaggcatatgaagatccttgat 500  Q
    || ||||      |||||| ||   | | || |||||||| ||||| ||||   ||||||||||||| ||||||| ||||||||||||||||||||| ||    
10982022 tattctcagaaatagaatcattgaatccgtcagggtaatcatctgttgaaagactctttggtaaccctggaatttgaagaggcatatgaagatccttaat 10981923  T
501 gggttttgtagctttttggtgaatggttggaaagtaaaggaaagtggaaagaatggtagcacctgaagtacagtaaaagtaagtaggaatttcaaggttg 600  Q
     ||||||||||| ||||  | ||   ||||||| | |||||||||||  | || | |||||||||||||  | ||||||||||| || || || |  ||     
10981922 aggttttgtagcattttcataaacaattggaaaatgaaggaaagtggctacaaagatagcacctgaagtgtaataaaagtaagtcgggatctcgactttc 10981823  T
601 gtggtgacttgtgaggcactataggtgaggaaatctaagataatacctttgaagtttgtggttttggaaatggagttgagaatgttgtgaacatgatggt 700  Q
     |||| |||||||||||||||||||||| |||||||||||||| | |||||| |||||||||||||||||| || | ||||||||| | |||||| | ||    
10981822 ttggttacttgtgaggcactataggtgaagaaatctaagataacagctttgaggtttgtggttttggaaatagaatggagaatgttctcaacatggttgt 10981723  T
701 tgcttttgtgtgagacttcaagtgtaagtaagtgtgttggaagtgttgtagagaatgaaattggaggaatatagtggaaatta 783  Q
    |||| |  ||  | |||||||| ||   |||| ||  |||||||||||||| |||||||||||||||||| || |||||||||    
10981722 tgctatgttgacaaacttcaagggtgcataagagttgtggaagtgttgtagggaatgaaattggaggaatgtaatggaaatta 10981640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 8 - 394
Target Start/End: Complemental strand, 10968468 - 10968082
8 ccaaaaacccttcaggcaacaagtcatccaaactaagttcctccaagtttgactcgctccttacaatccataagaatctttgctcacttttctccaatcc 107  Q
    |||||||||||||||| | ||| || ||||||||  | ||||| ||||   |||| ||||| |||| ||| |||||||||||||||||| | ||||||||    
10968468 ccaaaaacccttcaggaagcaactcgtccaaactttgctcctctaagtccaactcactcctaacaacccacaagaatctttgctcacttatttccaatcc 10968369  T
108 aatagctatctcattcaactgagccttagaaaatctccccatgcttccaaaactcaaaaacacgacgctttgactaggttgcgagtcaagccaaatcaaa 207  Q
    ||  |||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||| |||||| || |||||| | | |    
10968368 aagtgctatctcattcaactgagccttagaaaatcttcccatgcttccaaaacttaacaacacgacgctttgactagattgcgactcgagccaacttaga 10968269  T
208 cacccattttcatctcctccataagaagatgtaatcaaaggtccaatacaaaaaatggatggagttgttccatcaggaacacataccccttcattcaaac 307  Q
    ||| ||||||||||| ||||||||||||  |||||||| |||||||||||||||||||||||||| ||||||||||||| | |||  ||||||||||||     
10968268 cactcattttcatcttctccataagaagcggtaatcaatggtccaatacaaaaaatggatggagtagttccatcaggaatatataatccttcattcaaag 10968169  T
308 ctttaatagctttttcttcaatagcatcaaaagtgttcacaataatcccagcacattccctcattgttttcgccgaatcaagcaaaa 394  Q
    ||||| |||||||| | |||||||||||||||||||||||||||| |||| |||||| |||||| ||||| ||||| ||||| ||||    
10968168 ctttattagcttttccctcaatagcatcaaaagtgttcacaataaccccatcacattgcctcatagtttttgccgattcaaggaaaa 10968082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 108; E-Value: 8e-54
Query Start/End: Original strand, 424 - 731
Target Start/End: Complemental strand, 10968076 - 10967769
424 gcttcatcggggtaatcgtctgtcgaaaagttctttggtaacccgggaattttaagaggcatatgaagatccttgatgggttttgtagctttttggtgaa 523  Q
    |||||||| |||||||| ||||| ||||  || ||||||||||| ||||||  ||||||| |||| |||||||| |||||||||||||| ||||||||||    
10968076 gcttcatcagggtaatcatctgttgaaatattttttggtaacccaggaattcgaagaggcgtatggagatccttaatgggttttgtagcattttggtgaa 10967977  T
524 tggttggaaagtaaaggaaagtggaaagaatggtagcacctgaagtacagtaaaagtaagtaggaatttcaaggttggtggtgacttgtgaggcactata 623  Q
    | |||||| ||| |||||||  ||  | ||   |||||||||||||  ||||||||||||| ||||||||||| || || |||||||  |||||| ||||    
10967976 tagttggatagtgaaggaaaagggctaaaacaatagcacctgaagtgaagtaaaagtaagtgggaatttcaagctttgtagtgactttcgaggcattata 10967877  T
624 ggtgaggaaatctaagataatacctttgaagtttgtggttttggaaatggagttgagaatgttgtgaacatgatggttgcttttgtgtgagacttcaagt 723  Q
     ||||| |||||||||||||  ||||||| ||||||||||||||||||||| | |||||| ||||||||||  |  ||||||| ||| ||||  |||||     
10967876 tgtgagaaaatctaagataactcctttgaggtttgtggttttggaaatggattggagaatattgtgaacatagttattgctttggtgagagagctcaagg 10967777  T
724 gtaagtaa 731  Q
10967776 gtaagtaa 10967769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 64 - 209
Target Start/End: Complemental strand, 11018973 - 11018828
64 ctccttacaatccataagaatctttgctcacttttctccaatccaatagctatctcattcaactgagccttagaaaatctccccatgcttccaaaactca 163  Q
    ||||| |||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |||||||||||||| ||||    
11018973 ctcctaacaacccacaagaatctttgctcacttttctccaatccaatagctatctcattcaattgagccctagaaaatcttcccatgcttccaaagctca 11018874  T
164 aaaacacgacgctttgactaggttgcgagtcaagccaaatcaaaca 209  Q
    | ||||||||||||||||| ||||||||||| |||||| |||||||    
11018873 acaacacgacgctttgacttggttgcgagtcgagccaactcaaaca 11018828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 8 - 368
Target Start/End: Complemental strand, 11079789 - 11079429
8 ccaaaaacccttcaggcaacaagtcatccaaactaagttcctccaagtttgactcgctccttacaatccataagaatctttgctcacttttctccaatcc 107  Q
    ||||||||||||| |||||||| ||||||||||| ||||||||| | |     |||||||| |||||||| ||||||||||| |||||||| ||||| ||    
11079789 ccaaaaacccttctggcaacaactcatccaaacttagttcctccgactccatatcgctcctaacaatccacaagaatctttgttcacttttttccaaacc 11079690  T
108 aatagctatctcattcaactgagccttagaaaatctccccatgcttccaaaactcaaaaacacgacgctttgactaggttgcgagtcaagccaaatcaaa 207  Q
    ||||||||||| ||| |  |||||||||||||||||||| | ||||||||| ||||| || |||||||||||||  || || || || |||||| |||||    
11079689 aatagctatctgattaatttgagccttagaaaatctccctaagcttccaaagctcaacaaaacgacgctttgacctggctgtgaatcgagccaactcaaa 11079590  T
208 cacccattttcatctcctccataagaagatgtaatcaaaggtccaatacaaaaaatggatggagttgttccatcaggaacacataccccttcattcaaac 307  Q
    |||||| ||| |||| || || | || | ||  |  |  ||||| || |||||||   | ||||| ||||||||||||||||| |  || |   | |||     
11079589 cacccacttttatcttcttcacacgaggttgacactacgggtccgatgcaaaaaagcaacggagtggttccatcaggaacacacaatccatttcttaaag 11079490  T
308 ctttaatagctttttcttcaatagcatcaaaagtgttcacaataatcccagcacattccct 368  Q
    ||||||||||||| | |||||||||||| |||||||| || ||||||||| ||| ||||||    
11079489 ctttaatagctttcttttcaatagcatcgaaagtgtttacgataatcccatcactttccct 11079429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 572 - 704
Target Start/End: Complemental strand, 11079222 - 11079090
572 agtaaaagtaagtaggaatttcaaggttggtggtgacttgtgaggcactataggtgaggaaatctaagataatacctttgaagtttgtggttttggaaat 671  Q
    ||||||||||||| ||||||||||| ||| |||| |||||||| ||||||||| | |||||||| || ||||   |||| | ||||| |||||| | |||    
11079222 agtaaaagtaagttggaatttcaagattgttggtaacttgtgaagcactatagttaaggaaatccaacataactgctttaaggtttgaggtttttgcaat 11079123  T
672 ggagttgagaatgttgtgaacatgatggttgct 704  Q
    ||| |  ||||| |  |||||||| ||||||||    
11079122 ggattgaagaatatgatgaacatggtggttgct 11079090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 150 - 213
Target Start/End: Original strand, 18300125 - 18300188
150 gcttccaaaactcaaaaacacgacgctttgactaggttgcgagtcaagccaaatcaaacaccca 213  Q
    ||||||||| ||||||||||| || ||||||||||||||| |||  |||||| |||||||||||    
18300125 gcttccaaagctcaaaaacacaacactttgactaggttgcaagttgagccaactcaaacaccca 18300188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC