View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9314-LTR4-TNT-insertion-8 (Length: 236)

Name: F9314-LTR4-TNT-insertion-8
Description: F9314-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9314-LTR4-TNT-insertion-8
F9314-LTR4-TNT-insertion-8
[»] chr1 (3 HSPs)
chr1 (9-226)||(40689940-40690157)
chr1 (16-104)||(34714363-34714448)
chr1 (28-79)||(34710689-34710740)


Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 9 - 226
Target Start/End: Complemental strand, 40690157 - 40689940
Alignment:
9 ggaagcaaaggcaaacttagattctctatgatcatcttcaggtgcaggaaggttgagatccaaatccaaagacaaaacattccttttctttctaggatga 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40690157 ggaagcaaaggcaaacttagattctctatgatcatcttcaggtgcaggaaggttgagatccaaatccaaagacaaaacattccttttctttctaggatga 40690058  T
109 tcttcatcaggttccaaagccattgttgtcaaagagagtgtggtgttggctgcagaagttcccaccggtgcacggtggcgcctcatatggccacctagtg 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40690057 tcttcatcaggttccaaagccattgttgtcaaagagagtgtggtgttggctgcagaagttcccaccggtgcacggtggcgcctcatatggccacctagtg 40689958  T
209 cttgaccagatgtgaatt 226  Q
    ||||||||||||||||||    
40689957 cttgaccagatgtgaatt 40689940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 16 - 104
Target Start/End: Complemental strand, 34714448 - 34714363
Alignment:
16 aaggcaaacttagattctctatgatcatcttcaggtgcaggaaggttgagatccaaatccaaagacaaaacattccttttctttctagg 104  Q
    |||||||||||  | ||||| ||||| |||| || |||||||||||||||||||||||||||||   | |||||| |||||||||||||    
34714448 aaggcaaacttgaactctctttgatcttcttaagctgcaggaaggttgagatccaaatccaaag---agacattcattttctttctagg 34714363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 79
Target Start/End: Complemental strand, 34710740 - 34710689
Alignment:
28 gattctctatgatcatcttcaggtgcaggaaggttgagatccaaatccaaag 79  Q
    |||||||| ||||| |||| || |||||||||||||||||||||||||||||    
34710740 gattctctttgatcttcttaagctgcaggaaggttgagatccaaatccaaag 34710689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98634 times since January 2019
Visitors: 2275