View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9318-LTR4-TNT-insertion-1 (Length: 220)

Name: F9318-LTR4-TNT-insertion-1
Description: F9318-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9318-LTR4-TNT-insertion-1
[»] chr3 (2 HSPs)
chr3 (9-208)||(19336463-19336662)
chr3 (74-177)||(19427159-19427262)

Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr3

Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 9 - 208
Target Start/End: Original strand, 19336463 - 19336662
9 caagttcattccttgactactgataaacatctgggaatcttggccactttggtgaactgcaaagatgaagtttcgtcaaattggtcaagaaatttttcca 108  Q
19336463 caagttcattccttgactactgataaacatctgggaatcttggccactttggtgaactgcaaagatgaagtttcgtcaaattggtcaagaaatttttcca 19336562  T
109 atctgctcagagctatttttcattttatcaattttggtactgttaaaatagcctcagaatgagagatactcttcttcaactggaatgaatttatgaagaa 208  Q
19336563 atctgctcagagctatttttcattttatcaattttggtactgttaaaatagcctcagaatgagagatactcttcttcaactggaatgaatttatgaagaa 19336662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 74 - 177
Target Start/End: Original strand, 19427159 - 19427262
74 tgaagtttcgtcaaattggtcaagaaatttttccaatctgctcagagctatttttcattttatcaattttggtactgttaaaatagcctcagaatgagag 173  Q
    ||||||||| |||||||| ||||||||||||||||  |||||||||| ||||||  ||||||||||||||||||| ||||||| ||||||| ||||||||    
19427159 tgaagtttcatcaaattgatcaagaaatttttccatgctgctcagagatattttatattttatcaattttggtacagttaaaacagcctcaaaatgagag 19427258  T
174 atac 177  Q
19427259 atac 19427262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 115702 times since January 2019
Visitors: 1394