View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9318-LTR4-TNT-insertion-1 (Length: 220)

Name: F9318-LTR4-TNT-insertion-1
Description: F9318-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9318-LTR4-TNT-insertion-1
F9318-LTR4-TNT-insertion-1
[»] chr3 (2 HSPs)
chr3 (9-208)||(19336463-19336662)
chr3 (74-177)||(19427159-19427262)


Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 9 - 208
Target Start/End: Original strand, 19336463 - 19336662
Alignment:
9 caagttcattccttgactactgataaacatctgggaatcttggccactttggtgaactgcaaagatgaagtttcgtcaaattggtcaagaaatttttcca 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19336463 caagttcattccttgactactgataaacatctgggaatcttggccactttggtgaactgcaaagatgaagtttcgtcaaattggtcaagaaatttttcca 19336562  T
109 atctgctcagagctatttttcattttatcaattttggtactgttaaaatagcctcagaatgagagatactcttcttcaactggaatgaatttatgaagaa 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19336563 atctgctcagagctatttttcattttatcaattttggtactgttaaaatagcctcagaatgagagatactcttcttcaactggaatgaatttatgaagaa 19336662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 74 - 177
Target Start/End: Original strand, 19427159 - 19427262
Alignment:
74 tgaagtttcgtcaaattggtcaagaaatttttccaatctgctcagagctatttttcattttatcaattttggtactgttaaaatagcctcagaatgagag 173  Q
    ||||||||| |||||||| ||||||||||||||||  |||||||||| ||||||  ||||||||||||||||||| ||||||| ||||||| ||||||||    
19427159 tgaagtttcatcaaattgatcaagaaatttttccatgctgctcagagatattttatattttatcaattttggtacagttaaaacagcctcaaaatgagag 19427258  T
174 atac 177  Q
    ||||    
19427259 atac 19427262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 191831 times since January 2019
Visitors: 2831