View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9321-LTR4-TNT-insertion-1 (Length: 593)

Name: F9321-LTR4-TNT-insertion-1
Description: F9321-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9321-LTR4-TNT-insertion-1
[»] chr5 (2 HSPs)
chr5 (9-584)||(23963773-23964348)
chr5 (9-584)||(24000439-24001010)
[»] chr8 (2 HSPs)
chr8 (281-370)||(4773217-4773306)
chr8 (321-381)||(4887274-4887334)

Alignment Details
Target: chr5 (Bit Score: 534; Significance: 0; HSPs: 2)
Name: chr5

Target: chr5; HSP #1
Raw Score: 534; E-Value: 0
Query Start/End: Original strand, 9 - 584
Target Start/End: Original strand, 23963773 - 23964348
9 caaacaccatactccccggtcaaaaatgatatttacgatacctttgcttctttaaatctcataccttgtatataaattaatnnnnnnngatatttaaaaa 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||    
23963773 caaacaccatactccccggtcaaaaatgatatttacgatacctttgcttctttaaatctcataccttgtatataaattaataaaaaaagatatttaaaaa 23963872  T
109 tcttgcaaaataatttgagaacaattctatttttgaacnnnnnnnaaataaatgagaacttattttattttacttactcaggatcaatgtaaccatgtga 208  Q
    ||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23963873 tcttgcaaaataatttgagaacaattctatttttgaactttttttaaataaatgagaacttattttattttacttactcaggatcaatgtaaccatgtga 23963972  T
209 accagccaagcaattagttaggatatgagtgtcactgtcatttgcgaaagctctagacaatccgaagtctgaaatcttcgcacgcgtgttttcatcaagc 308  Q
23963973 accagccaagcaattagttaggatatgagtgtcactgtcatttgcgaaagctctagacaatccgaagtctgaaatcttcgcacgcgtgttttcatcaagc 23964072  T
309 aagatgttaggaggtttcaaatctctgtgaattatagctggcttgcatccattatgaagatacaccaaacctgtatttccaataaatatcagtcgcatat 408  Q
23964073 aagatgttaggaggtttcaaatctctgtgaattatagctggcttgcatccattatgaagatacaccaaacctgtatttccaataaatatcagtcgcatat 23964172  T
409 agttatgattaatttggccttaatttggttacatcataaagaaaacaaatataaaaggatggacatggttgaaattagttgcataccatttgctacatca 508  Q
23964173 agttatgattaatttggccttaatttggttacatcataaagaaaacaaatataaaaggatggacatggttgaaattagttgcataccatttgctacatca 23964272  T
509 aatgcaatttgaagtctctcactccattccaaaacgtctgggtttttatctgccaaagtttatatttatgcaattg 584  Q
23964273 aatgcaatttgaagtctctcactccattccaaaacgtctgggtttttatctgccaaagtttatatttatgcaattg 23964348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 9 - 584
Target Start/End: Complemental strand, 24001010 - 24000439
9 caaacaccatactccccggtcaaaaatgatatttacgatacctttgcttctttaaatctcataccttgtatataaatt-aatnnnnnnngatatttaaaa 107  Q
    ||||||||||||||| |||||||||| || |||||| ||| || ||||||||||||||||||||||||  |||||||| |||        | | ||||||    
24001010 caaacaccatactcctcggtcaaaaaagagatttacaatagctctgcttctttaaatctcataccttgattataaatttaataaaaaa--aaaattaaaa 24000913  T
108 atcttgcaaaataatttgagaacaattctatttttgaacnnnnnnnaaa--------taaatgagaacttattttattttacttactcaggatcaatgta 199  Q
    |||||||||||||||||||||||||| ||||||||||||       |||        |||||||||||||||||||||||||||||||||||||||||||    
24000912 atcttgcaaaataatttgagaacaatgctatttttgaacttttagtaaacattataataaatgagaacttattttattttacttactcaggatcaatgta 24000813  T
200 accatgtgaaccagccaagcaattagttaggatatgagtgtcactgtcatttgcgaaagctctagacaatccgaagtctgaaatcttcgcacgcgtgttt 299  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
24000812 accatgtgaaccagcaaagcaattagttaggatatgagtgtcactgtcatttgcgaaagctctagacaatccgaagtctgaaatctttgcacgcgtgttt 24000713  T
300 tcatcaagcaagatgttaggaggtttcaaatctctgtgaattatagctggcttgcatccattatgaagatacaccaaacctgtatttccaataaatatca 399  Q
    ||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| | |||||||||||||||||||||||||    
24000712 tcatctagcaagatgttaggaggtttcaaatctctgtggattatagctggcttgcatccattatgcagatactctaaacctgtatttccaataaatatca 24000613  T
400 gtcgcatatagttatgattaatttggccttaatttggttacatcataaagaaaacaaatataaaaggatggacatggttgaaattagttgcataccattt 499  Q
    |||||||||||||||||            |||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||    
24000612 gtcgcatatagttatga-----------ataatttggttacttcagaaagaaaacaaatataaaaggatggacatggttgaaataagttgcataccattt 24000524  T
500 gctacatcaaatgcaatttgaagtctctcactccattccaaaacgtctgggtttttatctgccaaagtttatatttatgcaattg 584  Q
    |||||||||||||||||||||||||||||| ||||||||||||| | |||||||||||||||||||||||||| |||||||||||    
24000523 gctacatcaaatgcaatttgaagtctctcattccattccaaaacatttgggtttttatctgccaaagtttatagttatgcaattg 24000439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: chr8

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 281 - 370
Target Start/End: Original strand, 4773217 - 4773306
281 aatcttcgcacgcgtgttttcatcaagcaagatgttaggaggtttcaaatctctgtgaattatagctggcttgcatccattatgaagata 370  Q
    |||||| ||| || |||||||||| || || ||||| | ||||||||||||||| || ||  ||| ||| |||||||||||||| |||||    
4773217 aatcttggcatgcatgttttcatctagtaatatgtttgaaggtttcaaatctctatgcatagtaggtggtttgcatccattatgcagata 4773306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 321 - 381
Target Start/End: Original strand, 4887274 - 4887334
321 ggtttcaaatctctgtgaattatagctggcttgcatccattatgaagatacaccaaacctg 381  Q
    ||||||||||||||||| || |||| ||| || ||||||||||| |||||| |||| ||||    
4887274 ggtttcaaatctctgtgcataataggtggtttacatccattatgcagatactccaatcctg 4887334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 175541 times since January 2019
Visitors: 2677