View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9321-LTR4-TNT-insertion-1 (Length: 593)

Name: F9321-LTR4-TNT-insertion-1
Description: F9321-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9321-LTR4-TNT-insertion-1
F9321-LTR4-TNT-insertion-1
[»] chr5 (2 HSPs)
chr5 (9-584)||(23963773-23964348)
chr5 (9-584)||(24000439-24001010)
[»] chr8 (2 HSPs)
chr8 (281-370)||(4773217-4773306)
chr8 (321-381)||(4887274-4887334)


Alignment Details
Target: chr5 (Bit Score: 534; Significance: 0; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 534; E-Value: 0
Query Start/End: Original strand, 9 - 584
Target Start/End: Original strand, 23963773 - 23964348
Alignment:
9 caaacaccatactccccggtcaaaaatgatatttacgatacctttgcttctttaaatctcataccttgtatataaattaatnnnnnnngatatttaaaaa 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||    
23963773 caaacaccatactccccggtcaaaaatgatatttacgatacctttgcttctttaaatctcataccttgtatataaattaataaaaaaagatatttaaaaa 23963872  T
109 tcttgcaaaataatttgagaacaattctatttttgaacnnnnnnnaaataaatgagaacttattttattttacttactcaggatcaatgtaaccatgtga 208  Q
    ||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23963873 tcttgcaaaataatttgagaacaattctatttttgaactttttttaaataaatgagaacttattttattttacttactcaggatcaatgtaaccatgtga 23963972  T
209 accagccaagcaattagttaggatatgagtgtcactgtcatttgcgaaagctctagacaatccgaagtctgaaatcttcgcacgcgtgttttcatcaagc 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23963973 accagccaagcaattagttaggatatgagtgtcactgtcatttgcgaaagctctagacaatccgaagtctgaaatcttcgcacgcgtgttttcatcaagc 23964072  T
309 aagatgttaggaggtttcaaatctctgtgaattatagctggcttgcatccattatgaagatacaccaaacctgtatttccaataaatatcagtcgcatat 408  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23964073 aagatgttaggaggtttcaaatctctgtgaattatagctggcttgcatccattatgaagatacaccaaacctgtatttccaataaatatcagtcgcatat 23964172  T
409 agttatgattaatttggccttaatttggttacatcataaagaaaacaaatataaaaggatggacatggttgaaattagttgcataccatttgctacatca 508  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23964173 agttatgattaatttggccttaatttggttacatcataaagaaaacaaatataaaaggatggacatggttgaaattagttgcataccatttgctacatca 23964272  T
509 aatgcaatttgaagtctctcactccattccaaaacgtctgggtttttatctgccaaagtttatatttatgcaattg 584  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23964273 aatgcaatttgaagtctctcactccattccaaaacgtctgggtttttatctgccaaagtttatatttatgcaattg 23964348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 9 - 584
Target Start/End: Complemental strand, 24001010 - 24000439
Alignment:
9 caaacaccatactccccggtcaaaaatgatatttacgatacctttgcttctttaaatctcataccttgtatataaatt-aatnnnnnnngatatttaaaa 107  Q
    ||||||||||||||| |||||||||| || |||||| ||| || ||||||||||||||||||||||||  |||||||| |||        | | ||||||    
24001010 caaacaccatactcctcggtcaaaaaagagatttacaatagctctgcttctttaaatctcataccttgattataaatttaataaaaaa--aaaattaaaa 24000913  T
108 atcttgcaaaataatttgagaacaattctatttttgaacnnnnnnnaaa--------taaatgagaacttattttattttacttactcaggatcaatgta 199  Q
    |||||||||||||||||||||||||| ||||||||||||       |||        |||||||||||||||||||||||||||||||||||||||||||    
24000912 atcttgcaaaataatttgagaacaatgctatttttgaacttttagtaaacattataataaatgagaacttattttattttacttactcaggatcaatgta 24000813  T
200 accatgtgaaccagccaagcaattagttaggatatgagtgtcactgtcatttgcgaaagctctagacaatccgaagtctgaaatcttcgcacgcgtgttt 299  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
24000812 accatgtgaaccagcaaagcaattagttaggatatgagtgtcactgtcatttgcgaaagctctagacaatccgaagtctgaaatctttgcacgcgtgttt 24000713  T
300 tcatcaagcaagatgttaggaggtttcaaatctctgtgaattatagctggcttgcatccattatgaagatacaccaaacctgtatttccaataaatatca 399  Q
    ||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| | |||||||||||||||||||||||||    
24000712 tcatctagcaagatgttaggaggtttcaaatctctgtggattatagctggcttgcatccattatgcagatactctaaacctgtatttccaataaatatca 24000613  T
400 gtcgcatatagttatgattaatttggccttaatttggttacatcataaagaaaacaaatataaaaggatggacatggttgaaattagttgcataccattt 499  Q
    |||||||||||||||||            |||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||    
24000612 gtcgcatatagttatga-----------ataatttggttacttcagaaagaaaacaaatataaaaggatggacatggttgaaataagttgcataccattt 24000524  T
500 gctacatcaaatgcaatttgaagtctctcactccattccaaaacgtctgggtttttatctgccaaagtttatatttatgcaattg 584  Q
    |||||||||||||||||||||||||||||| ||||||||||||| | |||||||||||||||||||||||||| |||||||||||    
24000523 gctacatcaaatgcaatttgaagtctctcattccattccaaaacatttgggtttttatctgccaaagtttatagttatgcaattg 24000439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 281 - 370
Target Start/End: Original strand, 4773217 - 4773306
Alignment:
281 aatcttcgcacgcgtgttttcatcaagcaagatgttaggaggtttcaaatctctgtgaattatagctggcttgcatccattatgaagata 370  Q
    |||||| ||| || |||||||||| || || ||||| | ||||||||||||||| || ||  ||| ||| |||||||||||||| |||||    
4773217 aatcttggcatgcatgttttcatctagtaatatgtttgaaggtttcaaatctctatgcatagtaggtggtttgcatccattatgcagata 4773306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 321 - 381
Target Start/End: Original strand, 4887274 - 4887334
Alignment:
321 ggtttcaaatctctgtgaattatagctggcttgcatccattatgaagatacaccaaacctg 381  Q
    ||||||||||||||||| || |||| ||| || ||||||||||| |||||| |||| ||||    
4887274 ggtttcaaatctctgtgcataataggtggtttacatccattatgcagatactccaatcctg 4887334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 18625 times since January 2019
Visitors: 1569