View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9321-LTR4-TNT-insertion-2 (Length: 405)

Name: F9321-LTR4-TNT-insertion-2
Description: F9321-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9321-LTR4-TNT-insertion-2
[»] chr2 (1 HSPs)
chr2 (8-397)||(10980907-10981296)
[»] chr6 (2 HSPs)
chr6 (104-196)||(22617663-22617755)
chr6 (190-270)||(22617782-22617862)
[»] chr8 (1 HSPs)
chr8 (356-397)||(42933488-42933529)

Alignment Details
Target: chr2 (Bit Score: 386; Significance: 0; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 386; E-Value: 0
Query Start/End: Original strand, 8 - 397
Target Start/End: Original strand, 10980907 - 10981296
8 gtgtggatccatcaaattcagcgacatcaacaactgaaaccacattctcagctgctctctttcccaaggagtttggagtgttcgaagtcacaactggagc 107  Q
10980907 gtgtggatccatcaaattcagcgacatcaacaactgaaaccacattctcagctgctctctttcccaaggagtttggagtgttcgaagtcacaactggagc 10981006  T
108 aactgcatctacctttgaagcagacaccaattttggttcttttgtgctcgatgcttcacacccacctacatcaatgtcatccaaagacttgctaatcggt 207  Q
10981007 aactgcatctacctttgaagcagacaccaattttggttcttttgtgctcgatgcttcacacccacctacatcaatgtcatccaaagacttgctaatcggt 10981106  T
208 gttacatctgaatcggctacaccaactttgtccttgttatcggaatcaactccttcaatagttagaacaaactttgaatgatataaatggttagaacaaa 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
10981107 gttacatctgaatcggctacaccaactttgtccttgttatcggaatcaactccttcaatagttagaacaaactttgaaagatataaatggttagaacaaa 10981206  T
308 ctgatttgaataaactatagttaacacaaataactatagtagttgcaaagaatacaatcaaacaaagaattcaaattagtagttgcaatt 397  Q
10981207 ctgatttgaataaactatagttaacacaaataactatagtagttgcaaagaatacaatcaaacaaagaattcaaattagtagttgcaatt 10981296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 73; Significance: 3e-33; HSPs: 2)
Name: chr6

Target: chr6; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 104 - 196
Target Start/End: Original strand, 22617663 - 22617755
104 gagcaactgcatctacctttgaagcagacaccaattttggttcttttgtgctcgatgcttcacacccacctacatcaatgtcatccaaagact 196  Q
    ||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||    
22617663 gagcaactgcagctacctttgaagcagacaccatttttggttcttttgtgctcgatgcttcacatccacccacatcaatgtcatccaacgact 22617755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 190 - 270
Target Start/End: Original strand, 22617782 - 22617862
190 aaagacttgctaatcggtgttacatctgaatcggctacaccaactttgtccttgttatcggaatcaactccttcaatagtt 270  Q
    |||||||||||||||  ||||||||||||| | |||| | ||||||  ||||| |||| ||||||||||||||||||||||    
22617782 aaagacttgctaatcattgttacatctgaagcagctagagcaacttcttccttattattggaatcaactccttcaatagtt 22617862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 356 - 397
Target Start/End: Complemental strand, 42933529 - 42933488
356 agaatacaatcaaacaaagaattcaaattagtagttgcaatt 397  Q
    ||||||||||| |||||||||||| |||||| ||||||||||    
42933529 agaatacaatcgaacaaagaattctaattagcagttgcaatt 42933488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 199103 times since January 2019
Visitors: 2774