View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9321-LTR4-TNT-insertion-2 (Length: 405)

Name: F9321-LTR4-TNT-insertion-2
Description: F9321-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9321-LTR4-TNT-insertion-2
F9321-LTR4-TNT-insertion-2
[»] chr2 (1 HSPs)
chr2 (8-397)||(10980907-10981296)
[»] chr6 (2 HSPs)
chr6 (104-196)||(22617663-22617755)
chr6 (190-270)||(22617782-22617862)
[»] chr8 (1 HSPs)
chr8 (356-397)||(42933488-42933529)


Alignment Details
Target: chr2 (Bit Score: 386; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 386; E-Value: 0
Query Start/End: Original strand, 8 - 397
Target Start/End: Original strand, 10980907 - 10981296
Alignment:
8 gtgtggatccatcaaattcagcgacatcaacaactgaaaccacattctcagctgctctctttcccaaggagtttggagtgttcgaagtcacaactggagc 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10980907 gtgtggatccatcaaattcagcgacatcaacaactgaaaccacattctcagctgctctctttcccaaggagtttggagtgttcgaagtcacaactggagc 10981006  T
108 aactgcatctacctttgaagcagacaccaattttggttcttttgtgctcgatgcttcacacccacctacatcaatgtcatccaaagacttgctaatcggt 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10981007 aactgcatctacctttgaagcagacaccaattttggttcttttgtgctcgatgcttcacacccacctacatcaatgtcatccaaagacttgctaatcggt 10981106  T
208 gttacatctgaatcggctacaccaactttgtccttgttatcggaatcaactccttcaatagttagaacaaactttgaatgatataaatggttagaacaaa 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
10981107 gttacatctgaatcggctacaccaactttgtccttgttatcggaatcaactccttcaatagttagaacaaactttgaaagatataaatggttagaacaaa 10981206  T
308 ctgatttgaataaactatagttaacacaaataactatagtagttgcaaagaatacaatcaaacaaagaattcaaattagtagttgcaatt 397  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10981207 ctgatttgaataaactatagttaacacaaataactatagtagttgcaaagaatacaatcaaacaaagaattcaaattagtagttgcaatt 10981296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 73; Significance: 3e-33; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 104 - 196
Target Start/End: Original strand, 22617663 - 22617755
Alignment:
104 gagcaactgcatctacctttgaagcagacaccaattttggttcttttgtgctcgatgcttcacacccacctacatcaatgtcatccaaagact 196  Q
    ||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||    
22617663 gagcaactgcagctacctttgaagcagacaccatttttggttcttttgtgctcgatgcttcacatccacccacatcaatgtcatccaacgact 22617755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 190 - 270
Target Start/End: Original strand, 22617782 - 22617862
Alignment:
190 aaagacttgctaatcggtgttacatctgaatcggctacaccaactttgtccttgttatcggaatcaactccttcaatagtt 270  Q
    |||||||||||||||  ||||||||||||| | |||| | ||||||  ||||| |||| ||||||||||||||||||||||    
22617782 aaagacttgctaatcattgttacatctgaagcagctagagcaacttcttccttattattggaatcaactccttcaatagtt 22617862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 356 - 397
Target Start/End: Complemental strand, 42933529 - 42933488
Alignment:
356 agaatacaatcaaacaaagaattcaaattagtagttgcaatt 397  Q
    ||||||||||| |||||||||||| |||||| ||||||||||    
42933529 agaatacaatcgaacaaagaattctaattagcagttgcaatt 42933488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 18522 times since January 2019
Visitors: 1569