View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9321-LTR4-TNT-insertion-3 (Length: 344)

Name: F9321-LTR4-TNT-insertion-3
Description: F9321-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9321-LTR4-TNT-insertion-3
F9321-LTR4-TNT-insertion-3
[»] chr1 (1 HSPs)
chr1 (9-335)||(25576278-25576604)


Alignment Details
Target: chr1 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 9 - 335
Target Start/End: Original strand, 25576278 - 25576604
Alignment:
9 atttaaccaaaccagttattgcagagaaattgtctcccagaagggtaaaatgggaagtgggctttcagcatcctagaacactgatggcggatgatattcc 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25576278 atttaaccaaaccagttattgcagagaaattgtctcccagaagggtaaaatgggaagtgggctttcagcatcctagaacactgatggcggatgatattcc 25576377  T
109 aactgaagttcagaagccaactctggaaactcatattactccccgttctggctgttcaaccatcatatctacagaggaaatgtgcatggttctgaataaa 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25576378 aactgaagttcagaagccaactctggaaactcatattactccccgttctggctgttcaaccatcatatctacagaggaaatgtgcatggttctgaataaa 25576477  T
209 agtggccttgaacttccggaaggacatgaaataaaattaacaacagatgacttcttcggtgctgctcggttgtggccttggtatattatttattaccgta 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25576478 agtggccttgaacttccggaaggacatgaaataaaattaacaacagatgacttcttcggtgctgctcggttgtggccttggtatattatttattaccgta 25576577  T
309 ggttgaagaagggcccaatttcaattg 335  Q
    |||||||||||||||||||||||||||    
25576578 ggttgaagaagggcccaatttcaattg 25576604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 217115 times since January 2019
Visitors: 2908