View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9321-LTR4-TNT-insertion-6 (Length: 209)

Name: F9321-LTR4-TNT-insertion-6
Description: F9321-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9321-LTR4-TNT-insertion-6
F9321-LTR4-TNT-insertion-6
[»] chr3 (3 HSPs)
chr3 (10-201)||(36371321-36371512)
chr3 (10-117)||(36388047-36388154)
chr3 (119-201)||(36388172-36388251)


Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 10 - 201
Target Start/End: Original strand, 36371321 - 36371512
Alignment:
10 aggtgtgttcgaatgtatataaaatcaccactaacaaccattgtgaacagatacagttcattgtttgctcatgaacttgagaagagagatgaggattggc 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36371321 aggtgtgttcgaatgtatataaaatcaccactaacaaccattgtgaacagatacagttcattgtttgctcatgaacttgagaagagagatgaggattggc 36371420  T
110 catcttcaggttccaaagcaggtgcatgagtctgataggagagtttatcggaaaaccaaacaatacacaaattaaaagcaataataatatta 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36371421 catcttcaggttccaaagcaggtgcatgagtctgataggagagtttatcggaaaaccaaacaatacacaaattaaaagcaataataatatta 36371512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 10 - 117
Target Start/End: Original strand, 36388047 - 36388154
Alignment:
10 aggtgtgttcgaatgtatataaaatcaccactaacaaccattgtgaacagatacagttcattgtttgctcatgaacttgagaagagagatgaggattggc 109  Q
    |||||| |||||||||| |||||||||||||| || |||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |     
36388047 aggtgtcttcgaatgtaaataaaatcaccactcactaccattgtgaacagatacagttcattgtttgctcctgaacttgagaagagagataaggatttgt 36388146  T
110 catcttca 117  Q
    ||||||||    
36388147 catcttca 36388154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 201
Target Start/End: Original strand, 36388172 - 36388251
Alignment:
119 gttccaaagcaggtgcatgagtctgataggagagtttatcggaaaaccaaacaatacacaaattaaaagcaataataatatta 201  Q
    ||||||| ||||  ||||| ||||| || ||| |||||||||||||    ||| |||||||||||||| ||||||||||||||    
36388172 gttccaacgcagacgcatgtgtctggtacgagtgtttatcggaaaat---acagtacacaaattaaaaccaataataatatta 36388251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 216741 times since January 2019
Visitors: 2908