View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9321-LTR4-TNT-insertion-6 (Length: 209)

Name: F9321-LTR4-TNT-insertion-6
Description: F9321-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9321-LTR4-TNT-insertion-6
[»] chr3 (3 HSPs)
chr3 (10-201)||(36371321-36371512)
chr3 (10-117)||(36388047-36388154)
chr3 (119-201)||(36388172-36388251)

Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 3)
Name: chr3

Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 10 - 201
Target Start/End: Original strand, 36371321 - 36371512
10 aggtgtgttcgaatgtatataaaatcaccactaacaaccattgtgaacagatacagttcattgtttgctcatgaacttgagaagagagatgaggattggc 109  Q
36371321 aggtgtgttcgaatgtatataaaatcaccactaacaaccattgtgaacagatacagttcattgtttgctcatgaacttgagaagagagatgaggattggc 36371420  T
110 catcttcaggttccaaagcaggtgcatgagtctgataggagagtttatcggaaaaccaaacaatacacaaattaaaagcaataataatatta 201  Q
36371421 catcttcaggttccaaagcaggtgcatgagtctgataggagagtttatcggaaaaccaaacaatacacaaattaaaagcaataataatatta 36371512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 10 - 117
Target Start/End: Original strand, 36388047 - 36388154
10 aggtgtgttcgaatgtatataaaatcaccactaacaaccattgtgaacagatacagttcattgtttgctcatgaacttgagaagagagatgaggattggc 109  Q
    |||||| |||||||||| |||||||||||||| || |||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |     
36388047 aggtgtcttcgaatgtaaataaaatcaccactcactaccattgtgaacagatacagttcattgtttgctcctgaacttgagaagagagataaggatttgt 36388146  T
110 catcttca 117  Q
36388147 catcttca 36388154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 201
Target Start/End: Original strand, 36388172 - 36388251
119 gttccaaagcaggtgcatgagtctgataggagagtttatcggaaaaccaaacaatacacaaattaaaagcaataataatatta 201  Q
    ||||||| ||||  ||||| ||||| || ||| |||||||||||||    ||| |||||||||||||| ||||||||||||||    
36388172 gttccaacgcagacgcatgtgtctggtacgagtgtttatcggaaaat---acagtacacaaattaaaaccaataataatatta 36388251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 111516 times since January 2019
Visitors: 1375