View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9332-LTR4-TNT-insertion-1 (Length: 280)

Name: F9332-LTR4-TNT-insertion-1
Description: F9332-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9332-LTR4-TNT-insertion-1
[»] chr5 (1 HSPs)
chr5 (9-272)||(27439626-27439889)

Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 9 - 272
Target Start/End: Original strand, 27439626 - 27439889
9 gtgatgagtggaattttggtgtggaaggttttgggagggtttatggatgaaagtatggaatctgacatagcgtgctgtgacggcttgcgcggcgggagtg 108  Q
27439626 gtgatgagtggaattttggtgtggaaggttttgggagggtttatggatgaaagtatggaatctgacatagcgtgctgtgacggcttgcgcggcgggagtg 27439725  T
109 agtgaggtttcaagtgagagacgaactgagttttagggccacgtgcgggagtgcttgtacaaatggtatcaagttcgacatattgaataagtacttattt 208  Q
27439726 agtgaggtttcaagtgagagacgaactgagttttagggccacgtgcgggagtgcttgtacaaatggtatcaagttcgacatattgaataagtacttattt 27439825  T
209 atccctctaatgaaaagtacctgtttatcattagttatattgtctcgtttgaaagatcaattgg 272  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
27439826 atccctctaatgaaaagtacttgtttatcattagttatattgtctcgtttgaaagatcaattgg 27439889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 41476 times since January 2019
Visitors: 1503