View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9332-LTR4-TNT-insertion-1 (Length: 280)

Name: F9332-LTR4-TNT-insertion-1
Description: F9332-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9332-LTR4-TNT-insertion-1
F9332-LTR4-TNT-insertion-1
[»] chr5 (1 HSPs)
chr5 (9-272)||(27439626-27439889)


Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 9 - 272
Target Start/End: Original strand, 27439626 - 27439889
Alignment:
9 gtgatgagtggaattttggtgtggaaggttttgggagggtttatggatgaaagtatggaatctgacatagcgtgctgtgacggcttgcgcggcgggagtg 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27439626 gtgatgagtggaattttggtgtggaaggttttgggagggtttatggatgaaagtatggaatctgacatagcgtgctgtgacggcttgcgcggcgggagtg 27439725  T
109 agtgaggtttcaagtgagagacgaactgagttttagggccacgtgcgggagtgcttgtacaaatggtatcaagttcgacatattgaataagtacttattt 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27439726 agtgaggtttcaagtgagagacgaactgagttttagggccacgtgcgggagtgcttgtacaaatggtatcaagttcgacatattgaataagtacttattt 27439825  T
209 atccctctaatgaaaagtacctgtttatcattagttatattgtctcgtttgaaagatcaattgg 272  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
27439826 atccctctaatgaaaagtacttgtttatcattagttatattgtctcgtttgaaagatcaattgg 27439889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 295678 times since January 2019
Visitors: 3016