View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9332-LTR4-TNT-insertion-2 (Length: 392)

Name: F9332-LTR4-TNT-insertion-2
Description: F9332-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9332-LTR4-TNT-insertion-2
[»] chr5 (1 HSPs)
chr5 (10-383)||(15938860-15939233)

Alignment Details
Target: chr5 (Bit Score: 374; Significance: 0; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 10 - 383
Target Start/End: Complemental strand, 15939233 - 15938860
10 gcaatgtctctagtgatatctttactatgcacatgttcaacaatgaatatcggctgaatatcgatattccataagcaaaactcatttagaatttaattta 109  Q
15939233 gcaatgtctctagtgatatctttactatgcacatgttcaacaatgaatatcggctgaatatcgatattccataagcaaaactcatttagaatttaattta 15939134  T
110 atttcaaaaaattaatataaaaatatagcatgccattgaattattgaatgatggatatatatactcatccaaatttaatagtatcactaattcactatgt 209  Q
15939133 atttcaaaaaattaatataaaaatatagcatgccattgaattattgaatgatggatatatatactcatccaaatttaatagtatcactaattcactatgt 15939034  T
210 ttgataataaataaataaattttatgagaattaaaatgatgaataattaactttgggatgcgacctaaaagtttgaagaaagctacaagaaatttggatt 309  Q
15939033 ttgataataaataaataaattttatgagaattaaaatgatgaataattaactttgggatgcgacctaaaagtttgaagaaagctacaagaaatttggatt 15938934  T
310 acgcctaactactcgccgttgtcagaaaatgggtttggtgattcaacacttcagcatgacttcttgatcaattg 383  Q
15938933 acgcctaactactcgccgttgtcagaaaatgggtttggtgattcaacacttcagcatgacttcttgatcaattg 15938860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 38037 times since January 2019
Visitors: 1598