View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9332-LTR4-TNT-insertion-2 (Length: 392)

Name: F9332-LTR4-TNT-insertion-2
Description: F9332-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9332-LTR4-TNT-insertion-2
F9332-LTR4-TNT-insertion-2
[»] chr5 (1 HSPs)
chr5 (10-383)||(15938860-15939233)


Alignment Details
Target: chr5 (Bit Score: 374; Significance: 0; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 10 - 383
Target Start/End: Complemental strand, 15939233 - 15938860
Alignment:
10 gcaatgtctctagtgatatctttactatgcacatgttcaacaatgaatatcggctgaatatcgatattccataagcaaaactcatttagaatttaattta 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15939233 gcaatgtctctagtgatatctttactatgcacatgttcaacaatgaatatcggctgaatatcgatattccataagcaaaactcatttagaatttaattta 15939134  T
110 atttcaaaaaattaatataaaaatatagcatgccattgaattattgaatgatggatatatatactcatccaaatttaatagtatcactaattcactatgt 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15939133 atttcaaaaaattaatataaaaatatagcatgccattgaattattgaatgatggatatatatactcatccaaatttaatagtatcactaattcactatgt 15939034  T
210 ttgataataaataaataaattttatgagaattaaaatgatgaataattaactttgggatgcgacctaaaagtttgaagaaagctacaagaaatttggatt 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15939033 ttgataataaataaataaattttatgagaattaaaatgatgaataattaactttgggatgcgacctaaaagtttgaagaaagctacaagaaatttggatt 15938934  T
310 acgcctaactactcgccgttgtcagaaaatgggtttggtgattcaacacttcagcatgacttcttgatcaattg 383  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15938933 acgcctaactactcgccgttgtcagaaaatgggtttggtgattcaacacttcagcatgacttcttgatcaattg 15938860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176089 times since January 2019
Visitors: 2680