View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9332-LTR4-TNT-insertion-3 (Length: 614)

Name: F9332-LTR4-TNT-insertion-3
Description: F9332-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9332-LTR4-TNT-insertion-3
F9332-LTR4-TNT-insertion-3
[»] chr6 (45 HSPs)
chr6 (10-606)||(1818648-1819243)
chr6 (10-409)||(10445913-10446311)
chr6 (307-550)||(13285739-13285967)
chr6 (185-375)||(18459176-18459366)
chr6 (219-447)||(35057448-35057676)
chr6 (178-448)||(25921864-25922133)
chr6 (263-368)||(7217243-7217347)
chr6 (278-453)||(19825401-19825576)
chr6 (178-372)||(25601325-25601515)
chr6 (263-368)||(31734655-31734760)
chr6 (268-432)||(34140390-34140554)
chr6 (228-371)||(23431443-23431586)
chr6 (263-378)||(31166188-31166303)
chr6 (217-330)||(24506153-24506265)
chr6 (268-432)||(34153006-34153170)
chr6 (262-368)||(15998835-15998942)
chr6 (263-372)||(32259793-32259902)
chr6 (228-340)||(18982325-18982439)
chr6 (126-253)||(15891684-15891810)
chr6 (126-253)||(15900769-15900895)
chr6 (306-447)||(29045261-29045402)
chr6 (263-368)||(18455072-18455177)
chr6 (272-368)||(22557204-22557300)
chr6 (48-162)||(14993540-14993654)
chr6 (488-550)||(14993677-14993739)
chr6 (126-202)||(28288670-28288747)
chr6 (149-253)||(15173568-15173671)
chr6 (228-377)||(18982483-18982634)
chr6 (126-202)||(12942941-12943018)
chr6 (262-328)||(20410552-20410616)
chr6 (271-368)||(21683074-21683171)
chr6 (272-328)||(23658044-23658101)
chr6 (170-255)||(29045119-29045204)
chr6 (401-473)||(31166343-31166413)
chr6 (401-454)||(18454978-18455031)
chr6 (185-251)||(18585549-18585615)
chr6 (126-202)||(23956674-23956751)
chr6 (126-194)||(23415717-23415785)
chr6 (315-377)||(31629851-31629913)
chr6 (126-202)||(13765158-13765235)
chr6 (475-520)||(15285837-15285882)
chr6 (343-372)||(23501700-23501729)
chr6 (417-453)||(23658188-23658224)
chr6 (170-202)||(27557519-27557551)
chr6 (337-377)||(28948597-28948637)
[»] chr5 (37 HSPs)
chr5 (10-548)||(21503835-21504365)
chr5 (78-462)||(20313037-20313422)
chr5 (400-550)||(26758524-26758674)
chr5 (209-368)||(1626917-1627076)
chr5 (266-447)||(16063701-16063883)
chr5 (262-372)||(18744820-18744931)
chr5 (260-368)||(26749976-26750084)
chr5 (278-371)||(14025803-14025897)
chr5 (263-454)||(8503803-8503992)
chr5 (209-290)||(21398724-21398805)
chr5 (263-368)||(26762350-26762455)
chr5 (262-408)||(23199168-23199313)
chr5 (210-320)||(24068125-24068234)
chr5 (147-253)||(17011560-17011665)
chr5 (209-290)||(22111871-22111951)
chr5 (266-372)||(6551285-6551392)
chr5 (310-381)||(21404080-21404151)
chr5 (263-364)||(8833209-8833310)
chr5 (149-253)||(265872-265975)
chr5 (247-453)||(32607229-32607438)
chr5 (147-363)||(21398800-21399018)
chr5 (402-453)||(21398546-21398597)
chr5 (337-447)||(31622139-31622249)
chr5 (167-253)||(29448692-29448777)
chr5 (126-202)||(9776917-9776994)
chr5 (126-202)||(37804236-37804313)
chr5 (262-328)||(660736-660801)
chr5 (401-473)||(21404186-21404256)
chr5 (126-202)||(33472727-33472804)
chr5 (168-251)||(30138199-30138282)
chr5 (185-251)||(31456721-31456787)
chr5 (126-202)||(27868738-27868815)
chr5 (262-318)||(1627118-1627174)
chr5 (482-548)||(28710200-28710268)
chr5 (185-251)||(17875927-17875993)
chr5 (401-454)||(21299942-21299995)
chr5 (337-377)||(20566568-20566608)
[»] chr1 (55 HSPs)
chr1 (10-550)||(34392461-34393010)
chr1 (20-432)||(21187968-21188380)
chr1 (263-432)||(39061268-39061437)
chr1 (288-447)||(21243678-21243837)
chr1 (128-453)||(8306417-8306743)
chr1 (209-474)||(45499434-45499701)
chr1 (262-464)||(28476625-28476840)
chr1 (306-447)||(17901714-17901856)
chr1 (263-368)||(38887086-38887191)
chr1 (210-320)||(40390046-40390155)
chr1 (263-368)||(14792562-14792667)
chr1 (356-464)||(35895140-35895248)
chr1 (258-328)||(24719550-24719620)
chr1 (272-368)||(18121559-18121656)
chr1 (306-447)||(6834166-6834307)
chr1 (126-253)||(29763747-29763873)
chr1 (273-367)||(41225454-41225549)
chr1 (273-367)||(41226707-41226802)
chr1 (126-253)||(46197860-46197986)
chr1 (228-368)||(44892362-44892502)
chr1 (263-378)||(20708048-20708163)
chr1 (126-253)||(50001287-50001413)
chr1 (262-328)||(12710813-12710879)
chr1 (247-290)||(20588566-20588609)
chr1 (247-290)||(20593104-20593147)
chr1 (381-447)||(22823156-22823222)
chr1 (263-368)||(24007224-24007330)
chr1 (126-202)||(297167-297244)
chr1 (170-367)||(22145666-22145866)
chr1 (293-372)||(50544849-50544929)
chr1 (278-368)||(8275988-8276079)
chr1 (128-255)||(21239155-21239282)
chr1 (278-371)||(38056668-38056762)
chr1 (328-372)||(11808186-11808230)
chr1 (128-251)||(7052129-7052252)
chr1 (402-464)||(12710966-12711029)
chr1 (128-251)||(24723576-24723699)
chr1 (401-446)||(14237577-14237622)
chr1 (401-446)||(46560163-46560208)
chr1 (147-255)||(17901914-17902022)
chr1 (409-453)||(20846338-20846382)
chr1 (409-453)||(28193561-28193605)
chr1 (402-453)||(38056589-38056641)
chr1 (470-548)||(21496788-21496863)
chr1 (337-368)||(42697806-42697837)
chr1 (337-368)||(45755542-45755573)
chr1 (402-440)||(22350810-22350848)
chr1 (128-202)||(23194676-23194750)
chr1 (185-251)||(44822246-44822312)
chr1 (216-286)||(22350570-22350641)
chr1 (315-372)||(22350716-22350773)
chr1 (263-323)||(22823218-22823276)
chr1 (402-439)||(51083255-51083292)
chr1 (345-377)||(7320584-7320616)
chr1 (325-377)||(7703132-7703184)
[»] chr8 (48 HSPs)
chr8 (10-548)||(22610081-22610622)
chr8 (10-550)||(23883864-23884386)
chr8 (129-465)||(20879287-20879622)
chr8 (263-601)||(20516798-20517140)
chr8 (128-281)||(36732570-36732723)
chr8 (216-550)||(21678659-21678995)
chr8 (228-408)||(21579167-21579345)
chr8 (228-377)||(22474669-22474818)
chr8 (306-447)||(22483928-22484068)
chr8 (263-453)||(22208216-22208405)
chr8 (461-550)||(21676313-21676402)
chr8 (272-408)||(29762829-29762964)
chr8 (209-446)||(36305898-36306140)
chr8 (210-320)||(22966706-22966815)
chr8 (272-409)||(12037124-12037260)
chr8 (349-447)||(22345198-22345296)
chr8 (349-447)||(22356858-22356956)
chr8 (185-370)||(21676590-21676773)
chr8 (262-368)||(4380616-4380723)
chr8 (126-253)||(16198647-16198773)
chr8 (156-255)||(22483621-22483720)
chr8 (147-254)||(25657628-25657734)
chr8 (210-318)||(21697509-21697616)
chr8 (263-368)||(41680132-41680237)
chr8 (262-372)||(18816290-18816401)
chr8 (263-368)||(17978415-17978520)
chr8 (262-367)||(21514637-21514743)
chr8 (167-250)||(23478934-23479016)
chr8 (279-377)||(36405122-36405221)
chr8 (167-253)||(19880675-19880760)
chr8 (167-253)||(26454558-26454643)
chr8 (247-290)||(18834356-18834399)
chr8 (247-290)||(21399647-21399690)
chr8 (247-290)||(21794140-21794183)
chr8 (266-368)||(36732411-36732514)
chr8 (216-378)||(22708313-22708476)
chr8 (263-368)||(12577826-12577932)
chr8 (401-453)||(17611210-17611262)
chr8 (281-373)||(21676494-21676585)
chr8 (126-202)||(8413912-8413989)
chr8 (272-367)||(22258306-22258403)
chr8 (401-432)||(21676420-21676451)
chr8 (126-202)||(19882759-19882836)
chr8 (126-194)||(14397082-14397149)
chr8 (315-371)||(15202302-15202358)
chr8 (402-453)||(18834521-18834573)
chr8 (315-367)||(20463195-20463247)
chr8 (409-453)||(39834655-39834699)
[»] chr7 (70 HSPs)
chr7 (10-550)||(36300458-36300997)
chr7 (10-432)||(8930700-8931124)
chr7 (306-606)||(38299738-38300039)
chr7 (62-447)||(18570392-18570778)
chr7 (10-255)||(38295298-38295542)
chr7 (130-381)||(42565819-42566069)
chr7 (84-286)||(33556187-33556379)
chr7 (209-447)||(15700656-15700892)
chr7 (84-381)||(33060208-33060504)
chr7 (125-447)||(37539258-37539580)
chr7 (209-447)||(13744430-13744667)
chr7 (126-447)||(13315002-13315322)
chr7 (217-406)||(14160819-14161006)
chr7 (455-550)||(33555919-33556014)
chr7 (211-432)||(25943163-25943385)
chr7 (263-372)||(14318020-14318129)
chr7 (263-408)||(15119268-15119411)
chr7 (258-377)||(47095394-47095514)
chr7 (262-368)||(4690662-4690769)
chr7 (263-353)||(9743093-9743183)
chr7 (262-372)||(15575644-15575755)
chr7 (126-253)||(16550117-16550243)
chr7 (126-253)||(16615419-16615545)
chr7 (266-372)||(20252177-20252284)
chr7 (262-368)||(43745602-43745709)
chr7 (355-447)||(16463109-16463201)
chr7 (266-453)||(19195562-19195763)
chr7 (262-328)||(16186859-16186925)
chr7 (167-253)||(29052297-29052382)
chr7 (167-253)||(32160315-32160400)
chr7 (126-202)||(11303999-11304076)
chr7 (126-202)||(16108022-16108099)
chr7 (126-202)||(23664286-23664363)
chr7 (337-451)||(12127080-12127193)
chr7 (262-372)||(18874660-18874770)
chr7 (266-372)||(708424-708531)
chr7 (128-251)||(12754781-12754904)
chr7 (126-202)||(29797362-29797439)
chr7 (126-202)||(29801181-29801258)
chr7 (234-408)||(43276705-43276877)
chr7 (167-251)||(14274075-14274159)
chr7 (247-290)||(58489-58532)
chr7 (247-290)||(15720709-15720752)
chr7 (337-446)||(44374865-44374973)
chr7 (337-446)||(44383730-44383838)
chr7 (128-251)||(47975007-47975130)
chr7 (128-202)||(4325910-4325984)
chr7 (128-201)||(19195005-19195078)
chr7 (216-369)||(21661156-21661310)
chr7 (263-368)||(8513752-8513858)
chr7 (209-255)||(16250340-16250385)
chr7 (412-453)||(20620358-20620399)
chr7 (401-473)||(33060539-33060609)
chr7 (558-595)||(42565661-42565698)
chr7 (126-194)||(1856572-1856640)
chr7 (337-408)||(11067490-11067559)
chr7 (386-437)||(14156323-14156375)
chr7 (262-318)||(48212779-48212835)
chr7 (401-432)||(42565747-42565778)
chr7 (343-377)||(8135228-8135262)
chr7 (280-368)||(8488093-8488183)
chr7 (475-548)||(11799930-11800001)
chr7 (126-195)||(14188464-14188534)
chr7 (401-446)||(14318165-14318210)
chr7 (337-371)||(36704567-36704601)
chr7 (343-372)||(15624046-15624075)
chr7 (306-370)||(16250219-16250284)
chr7 (479-548)||(21508720-21508789)
chr7 (126-194)||(13917744-13917812)
chr7 (337-408)||(32433550-32433619)
[»] chr3 (61 HSPs)
chr3 (10-550)||(3526991-3527512)
chr3 (266-550)||(21845466-21845753)
chr3 (10-532)||(12917134-12917669)
chr3 (136-546)||(25201957-25202366)
chr3 (50-546)||(48043298-48043796)
chr3 (10-447)||(45803252-45803693)
chr3 (216-432)||(3160561-3160777)
chr3 (185-375)||(48631202-48631391)
chr3 (215-550)||(12150761-12151099)
chr3 (84-464)||(29907404-29907787)
chr3 (84-464)||(29948570-29948953)
chr3 (84-464)||(29997724-29998107)
chr3 (229-447)||(22841200-22841423)
chr3 (215-358)||(12155034-12155179)
chr3 (147-371)||(50350812-50351037)
chr3 (263-371)||(53646055-53646163)
chr3 (126-253)||(16979723-16979849)
chr3 (262-372)||(17208470-17208581)
chr3 (258-372)||(14520388-14520503)
chr3 (278-445)||(14641471-14641638)
chr3 (404-463)||(24548866-24548925)
chr3 (263-360)||(54330314-54330411)
chr3 (29-108)||(3160878-3160958)
chr3 (126-253)||(22652584-22652710)
chr3 (126-202)||(3803625-3803702)
chr3 (435-532)||(12154861-12154957)
chr3 (126-202)||(12305874-12305951)
chr3 (263-378)||(6003133-6003248)
chr3 (247-290)||(17684914-17684957)
chr3 (247-290)||(54875553-54875596)
chr3 (249-290)||(14442107-14442148)
chr3 (126-202)||(29544197-29544274)
chr3 (126-202)||(54521574-54521651)
chr3 (409-453)||(10380031-10380075)
chr3 (247-290)||(6156641-6156684)
chr3 (247-290)||(6159335-6159378)
chr3 (263-368)||(14152398-14152504)
chr3 (247-290)||(17669777-17669820)
chr3 (228-372)||(5215559-5215704)
chr3 (279-371)||(15566706-15566800)
chr3 (475-548)||(3262115-3262188)
chr3 (126-202)||(13437050-13437127)
chr3 (401-453)||(10558978-10559030)
chr3 (247-290)||(2841585-2841628)
chr3 (401-454)||(6159506-6159559)
chr3 (126-202)||(42339-42416)
chr3 (129-194)||(5224138-5224203)
chr3 (409-446)||(6468261-6468298)
chr3 (402-463)||(24547298-24547358)
chr3 (239-287)||(13522360-13522408)
chr3 (126-194)||(26054606-26054674)
chr3 (404-463)||(48631435-48631494)
chr3 (401-454)||(15566845-15566898)
chr3 (209-251)||(24177885-24177927)
chr3 (128-202)||(43549819-43549893)
chr3 (401-441)||(6820282-6820323)
chr3 (185-254)||(13522462-13522530)
chr3 (402-446)||(17518779-17518823)
chr3 (402-446)||(17533641-17533685)
chr3 (337-408)||(17541456-17541525)
chr3 (258-290)||(50755333-50755365)
[»] scaffold1939 (1 HSPs)
scaffold1939 (189-606)||(1-416)
[»] scaffold0031 (1 HSPs)
scaffold0031 (12-447)||(127263-127699)
[»] chr4 (47 HSPs)
chr4 (158-546)||(9622330-9622703)
chr4 (215-550)||(13165033-13165381)
chr4 (125-381)||(14477442-14477697)
chr4 (141-430)||(18462849-18463139)
chr4 (349-550)||(10273417-10273602)
chr4 (262-464)||(25513797-25514012)
chr4 (247-447)||(55583126-55583332)
chr4 (228-377)||(12623229-12623378)
chr4 (262-372)||(14631081-14631192)
chr4 (263-377)||(19565908-19566022)
chr4 (10-114)||(9622205-9622308)
chr4 (228-371)||(33243290-33243433)
chr4 (263-368)||(2424386-2424492)
chr4 (210-320)||(20150721-20150830)
chr4 (147-290)||(16296703-16296846)
chr4 (263-408)||(40230254-40230397)
chr4 (263-372)||(44023598-44023707)
chr4 (257-361)||(45314089-45314194)
chr4 (257-368)||(26921508-26921620)
chr4 (126-253)||(10694360-10694486)
chr4 (209-372)||(15239811-15239974)
chr4 (263-368)||(46741147-46741252)
chr4 (126-253)||(10908126-10908252)
chr4 (126-253)||(15008779-15008905)
chr4 (126-253)||(40620343-40620469)
chr4 (275-372)||(16296897-16296995)
chr4 (262-328)||(26446153-26446219)
chr4 (228-414)||(33186815-33187000)
chr4 (126-202)||(36038622-36038699)
chr4 (126-202)||(49547107-49547184)
chr4 (407-458)||(44928049-44928100)
chr4 (278-371)||(9638972-9639066)
chr4 (126-202)||(15534933-15535010)
chr4 (558-606)||(14477813-14477861)
chr4 (128-287)||(35660701-35660861)
chr4 (126-195)||(33849554-33849624)
chr4 (409-453)||(15191285-15191329)
chr4 (128-251)||(14549463-14549586)
chr4 (126-202)||(28386055-28386132)
chr4 (263-408)||(12424251-12424397)
chr4 (401-432)||(14477732-14477763)
chr4 (315-377)||(3515797-3515859)
chr4 (210-248)||(3838026-3838064)
chr4 (401-454)||(33243192-33243245)
chr4 (266-320)||(35660906-35660960)
chr4 (401-446)||(14186145-14186190)
chr4 (337-408)||(19022366-19022435)
[»] scaffold0139 (1 HSPs)
scaffold0139 (263-606)||(39900-40268)
[»] chr2 (41 HSPs)
chr2 (12-375)||(19646927-19647293)
chr2 (306-551)||(36734268-36734511)
chr2 (239-550)||(28344822-28345115)
chr2 (29-380)||(20005958-20006311)
chr2 (125-473)||(45535736-45536096)
chr2 (178-372)||(28652547-28652740)
chr2 (10-473)||(45528236-45528702)
chr2 (263-363)||(25584267-25584367)
chr2 (10-149)||(23800012-23800150)
chr2 (128-290)||(149583-149745)
chr2 (262-372)||(21335261-21335372)
chr2 (262-464)||(21369239-21369454)
chr2 (126-253)||(25184000-25184126)
chr2 (156-367)||(12626427-12626643)
chr2 (228-464)||(14179619-14179867)
chr2 (268-372)||(21315471-21315576)
chr2 (349-465)||(23801530-23801652)
chr2 (263-366)||(23968624-23968727)
chr2 (209-290)||(25584190-25584272)
chr2 (126-253)||(18358082-18358208)
chr2 (126-253)||(21915435-21915561)
chr2 (147-464)||(14183357-14183686)
chr2 (337-453)||(17307508-17307623)
chr2 (209-290)||(34491322-34491403)
chr2 (126-202)||(10684096-10684173)
chr2 (126-202)||(20261971-20262048)
chr2 (126-202)||(23338563-23338640)
chr2 (126-253)||(21081084-21081210)
chr2 (262-368)||(23610572-23610679)
chr2 (315-377)||(18388180-18388242)
chr2 (278-363)||(24717981-24718067)
chr2 (167-251)||(1383768-1383852)
chr2 (402-446)||(27852763-27852807)
chr2 (401-446)||(22695319-22695364)
chr2 (401-432)||(19647334-19647365)
chr2 (401-459)||(20005866-20005922)
chr2 (401-454)||(149399-149452)
chr2 (126-192)||(31345932-31345998)
chr2 (398-453)||(6576689-6576745)
chr2 (481-517)||(15266803-15266839)
chr2 (481-517)||(17811275-17811311)
[»] scaffold0035 (2 HSPs)
scaffold0035 (126-462)||(43692-44028)
scaffold0035 (126-462)||(39000-39336)
[»] scaffold0092 (1 HSPs)
scaffold0092 (75-427)||(38381-38734)
[»] scaffold0337 (1 HSPs)
scaffold0337 (217-427)||(3107-3317)
[»] scaffold0217 (2 HSPs)
scaffold0217 (101-375)||(28500-28773)
scaffold0217 (558-606)||(28895-28943)
[»] scaffold0086 (2 HSPs)
scaffold0086 (355-548)||(34998-35198)
scaffold0086 (147-201)||(35652-35706)
[»] scaffold0058 (2 HSPs)
scaffold0058 (16-432)||(59590-60006)
scaffold0058 (128-202)||(39976-40050)
[»] scaffold0021 (2 HSPs)
scaffold0021 (185-432)||(16977-17223)
scaffold0021 (185-432)||(26508-26754)
[»] scaffold0205 (2 HSPs)
scaffold0205 (38-465)||(5517-5945)
scaffold0205 (548-601)||(5439-5492)
[»] scaffold0394 (1 HSPs)
scaffold0394 (185-550)||(7327-7695)
[»] scaffold0004 (4 HSPs)
scaffold0004 (212-449)||(72982-73221)
scaffold0004 (209-431)||(75829-76054)
scaffold0004 (209-280)||(110217-110288)
scaffold0004 (306-439)||(66000-66134)
[»] scaffold0017 (4 HSPs)
scaffold0017 (266-431)||(23564-23730)
scaffold0017 (257-328)||(26668-26739)
scaffold0017 (431-462)||(26843-26874)
scaffold0017 (10-90)||(23380-23459)
[»] scaffold0165 (2 HSPs)
scaffold0165 (216-423)||(31831-32038)
scaffold0165 (306-367)||(32039-32100)
[»] scaffold0061 (2 HSPs)
scaffold0061 (126-427)||(14526-14828)
scaffold0061 (126-427)||(23584-23886)
[»] scaffold0048 (2 HSPs)
scaffold0048 (349-550)||(68560-68744)
scaffold0048 (217-368)||(56878-57026)
[»] scaffold1800 (2 HSPs)
scaffold1800 (216-372)||(509-664)
scaffold1800 (401-453)||(708-757)
[»] scaffold0369 (1 HSPs)
scaffold0369 (262-447)||(15537-15721)
[»] scaffold0125 (3 HSPs)
scaffold0125 (178-408)||(28415-28642)
scaffold0125 (337-373)||(7220-7256)
scaffold0125 (398-453)||(33612-33668)
[»] scaffold0878 (1 HSPs)
scaffold0878 (262-447)||(3343-3528)
[»] scaffold0148 (1 HSPs)
scaffold0148 (79-464)||(8604-8994)
[»] scaffold0247 (1 HSPs)
scaffold0247 (209-367)||(970-1128)
[»] scaffold0461 (1 HSPs)
scaffold0461 (208-290)||(12378-12460)
[»] scaffold0059 (1 HSPs)
scaffold0059 (241-377)||(49656-49791)
[»] scaffold1102 (2 HSPs)
scaffold1102 (267-381)||(1937-2051)
scaffold1102 (401-473)||(1832-1902)
[»] scaffold0630 (1 HSPs)
scaffold0630 (263-372)||(9011-9120)
[»] scaffold0505 (1 HSPs)
scaffold0505 (208-454)||(4829-5075)
[»] scaffold0011 (1 HSPs)
scaffold0011 (228-377)||(33367-33516)
[»] scaffold0063 (1 HSPs)
scaffold0063 (228-372)||(62631-62775)
[»] scaffold1186 (1 HSPs)
scaffold1186 (262-372)||(1966-2077)
[»] scaffold0005 (1 HSPs)
scaffold0005 (262-372)||(186191-186302)
[»] scaffold0213 (2 HSPs)
scaffold0213 (263-464)||(19154-19368)
scaffold0213 (270-315)||(19115-19160)
[»] scaffold0371 (2 HSPs)
scaffold0371 (228-368)||(10445-10585)
scaffold0371 (293-368)||(3853-3927)
[»] scaffold0439 (3 HSPs)
scaffold0439 (263-368)||(4369-4474)
scaffold0439 (177-254)||(12103-12179)
scaffold0439 (242-290)||(12236-12284)
[»] scaffold0385 (1 HSPs)
scaffold0385 (263-368)||(293-398)
[»] scaffold0020 (1 HSPs)
scaffold0020 (263-368)||(174169-174274)
[»] scaffold0174 (2 HSPs)
scaffold0174 (210-464)||(19750-20004)
scaffold0174 (307-464)||(5445-5602)
[»] scaffold0120 (1 HSPs)
scaffold0120 (210-320)||(29207-29316)
[»] scaffold0730 (1 HSPs)
scaffold0730 (70-446)||(6426-6802)
[»] scaffold0138 (2 HSPs)
scaffold0138 (126-253)||(20908-21034)
scaffold0138 (167-253)||(33964-34049)
[»] scaffold0034 (1 HSPs)
scaffold0034 (126-253)||(29331-29457)
[»] scaffold0401 (1 HSPs)
scaffold0401 (263-368)||(8769-8874)
[»] scaffold0203 (1 HSPs)
scaffold0203 (262-371)||(17936-18046)
[»] scaffold0039 (1 HSPs)
scaffold0039 (263-368)||(9927-10032)
[»] scaffold0007 (4 HSPs)
scaffold0007 (228-377)||(16409-16561)
scaffold0007 (228-338)||(18887-18999)
scaffold0007 (228-340)||(16602-16715)
scaffold0007 (228-377)||(18691-18844)
[»] scaffold0676 (3 HSPs)
scaffold0676 (128-287)||(2627-2786)
scaffold0676 (266-371)||(2831-2937)
scaffold0676 (401-454)||(2982-3035)
[»] scaffold0555 (2 HSPs)
scaffold0555 (156-251)||(8913-9008)
scaffold0555 (261-290)||(8825-8854)
[»] scaffold0083 (1 HSPs)
scaffold0083 (126-253)||(1748-1874)
[»] scaffold0046 (1 HSPs)
scaffold0046 (147-250)||(21895-21997)
[»] scaffold0436 (1 HSPs)
scaffold0436 (167-253)||(8812-8897)
[»] scaffold0379 (2 HSPs)
scaffold0379 (209-290)||(10841-10921)
scaffold0379 (402-464)||(11046-11108)
[»] scaffold0261 (1 HSPs)
scaffold0261 (268-368)||(6419-6519)
[»] scaffold0113 (1 HSPs)
scaffold0113 (128-253)||(35305-35430)
[»] scaffold0162 (1 HSPs)
scaffold0162 (262-318)||(23932-23988)
[»] scaffold0231 (2 HSPs)
scaffold0231 (262-372)||(17516-17627)
scaffold0231 (409-446)||(23710-23747)
[»] scaffold0056 (1 HSPs)
scaffold0056 (262-368)||(18221-18328)
[»] scaffold0026 (1 HSPs)
scaffold0026 (128-251)||(21935-22058)
[»] scaffold0516 (3 HSPs)
scaffold0516 (262-368)||(5304-5411)
scaffold0516 (402-463)||(5101-5162)
scaffold0516 (402-431)||(5230-5259)
[»] scaffold0462 (3 HSPs)
scaffold0462 (126-253)||(11034-11160)
scaffold0462 (263-312)||(1264-1313)
scaffold0462 (263-312)||(6770-6819)
[»] scaffold0057 (1 HSPs)
scaffold0057 (126-253)||(69968-70094)
[»] scaffold1256 (2 HSPs)
scaffold1256 (402-463)||(2093-2154)
scaffold1256 (281-368)||(2199-2287)
[»] scaffold0853 (1 HSPs)
scaffold0853 (262-367)||(2454-2562)
[»] scaffold0098 (1 HSPs)
scaffold0098 (247-290)||(40037-40080)
[»] scaffold0515 (1 HSPs)
scaffold0515 (126-253)||(4847-4966)
[»] scaffold0453 (1 HSPs)
scaffold0453 (126-194)||(7182-7251)
[»] scaffold0306 (1 HSPs)
scaffold0306 (126-253)||(4847-4966)
[»] scaffold0108 (1 HSPs)
scaffold0108 (228-377)||(6329-6480)
[»] scaffold0032 (1 HSPs)
scaffold0032 (275-371)||(61844-61940)
[»] scaffold0116 (1 HSPs)
scaffold0116 (406-458)||(46003-46055)
[»] scaffold0111 (2 HSPs)
scaffold0111 (398-453)||(5470-5526)
scaffold0111 (401-446)||(12439-12484)
[»] scaffold1434 (1 HSPs)
scaffold1434 (312-378)||(1348-1414)
[»] scaffold0422 (1 HSPs)
scaffold0422 (129-202)||(3778-3852)
[»] scaffold0230 (1 HSPs)
scaffold0230 (185-251)||(6910-6976)
[»] scaffold0220 (2 HSPs)
scaffold0220 (278-371)||(13911-14005)
scaffold0220 (402-453)||(14032-14084)
[»] scaffold0546 (1 HSPs)
scaffold0546 (401-446)||(8018-8063)
[»] scaffold0488 (1 HSPs)
scaffold0488 (404-453)||(12581-12630)
[»] scaffold0109 (1 HSPs)
scaffold0109 (401-446)||(5244-5289)
[»] scaffold0001 (3 HSPs)
scaffold0001 (126-202)||(169251-169328)
scaffold0001 (126-202)||(176604-176681)
scaffold0001 (337-408)||(77709-77778)
[»] scaffold0200 (1 HSPs)
scaffold0200 (126-194)||(18406-18474)
[»] scaffold0145 (1 HSPs)
scaffold0145 (277-320)||(8085-8129)
[»] scaffold0121 (1 HSPs)
scaffold0121 (228-315)||(20112-20199)
[»] scaffold0431 (1 HSPs)
scaffold0431 (263-408)||(5578-5724)
[»] scaffold0019 (1 HSPs)
scaffold0019 (480-535)||(183105-183160)
[»] scaffold1276 (1 HSPs)
scaffold1276 (128-202)||(954-1028)
[»] scaffold0594 (2 HSPs)
scaffold0594 (177-255)||(2102-2180)
scaffold0594 (306-374)||(2237-2306)
[»] scaffold0151 (1 HSPs)
scaffold0151 (128-202)||(9909-9983)
[»] scaffold0094 (1 HSPs)
scaffold0094 (475-541)||(48410-48476)
[»] scaffold0716 (1 HSPs)
scaffold0716 (412-453)||(5590-5631)
[»] scaffold0088 (1 HSPs)
scaffold0088 (475-520)||(35381-35426)
[»] scaffold0285 (1 HSPs)
scaffold0285 (337-377)||(19775-19815)
[»] scaffold0146 (1 HSPs)
scaffold0146 (402-446)||(23067-23111)


Alignment Details
Target: chr6 (Bit Score: 581; Significance: 0; HSPs: 45)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 581; E-Value: 0
Query Start/End: Original strand, 10 - 606
Target Start/End: Original strand, 1818648 - 1819243
Alignment:
10 gcgagtagaacactcaccngttgcgagttgatatcgaagtcactcgcaaggcgaacaagatcacccgccgtggtgagcgatgacaaacagttctacggga 109  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
1818648 gcgagtagaacactcacc-gttgcgagttgatatcgaagtcactcgcaaggcgaacaagatcactcgccgtggtgagcgatgacaaacagttctacggga 1818746  T
110 agaaatctattttttcccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattc 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1818747 agaaatctattttttcccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattc 1818846  T
210 cttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaactattaacaactacaagcttaa 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1818847 cttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaactattaacaactacaagcttaa 1818946  T
310 accctttttcagaactatatactcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctcttctct 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1818947 accctttttcagaactatatactcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctcttctct 1819046  T
410 tctctgacttctcactttctccccttttctcccaaaaacagtttctacgtattctgactttctaatttgttgtaaccctaattctctaatggtctcatct 509  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1819047 tctctgacttctcactttctccccttttctcccaaaaacagtttctacgtattctgactttctaatttgttgtaaccctaattctctaatggtctcatct 1819146  T
510 atttataatcactatctgagtttgtttttcacttaatctctttgattataaacctacataatcttccttattccaattctacccttatgcctaatta 606  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
1819147 atttataatcactatctgagtttgtttttcacttaatctctttgattataaacctacataatcttccttattccaattctacccttatgcctcatta 1819243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 10 - 409
Target Start/End: Original strand, 10445913 - 10446311
Alignment:
10 gcgagtagaacactcaccngttgcgagttgatatcgaagtcactcgcaaggcgaacaagatcacccgccgtggtgagcgatgacaaacagttctacggga 109  Q
    ||||||| ||||||| || |||||||||||| |||||||||||||||     |||  ||||||| ||| |||| |||| |||||| | |||| |||||||    
10445913 gcgagtaaaacactcgcc-gttgcgagttgacatcgaagtcactcgc-----gaaagagatcactcgctgtggcgagctatgacagatagttttacggga 10446006  T
110 agaaatctattttttcccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattc 209  Q
    |||||  | ||||   ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
10446007 agaaacatgttttcagccaaaaacccaattttcaaccacccaaatcccaaattcaaaaggaaactcaacctatgtttattctataatctgaacctcattc 10446106  T
210 cttacgttaattcaatgaattacctac---tctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaacta--ttaacaactacaag 304  Q
    |||||||||||||||||  ||||||||   ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||    |||||| ||| |    
10446107 cttacgttaattcaatgctttacctactgatctttcaacaatcaattttgcaaattaaccctaatttctataacatcgaaactaacaaaacaacaacatg 10446206  T
305 cttaaaccctttttcagaactata-tactcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctc 403  Q
     |||||||| |||| ||||  |||  || ||| |||| |||| | ||||| ||||||||||||||||| | ||| ||||||||||| | |||||||||||    
10446207 -ttaaacccctttttagaatcatacaacccattattagagaaagctagtcccacccttaccttagattagatgatttcagactctacatgcttgctcctc 10446305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 307 - 550
Target Start/End: Original strand, 13285739 - 13285967
Alignment:
307 taaaccctttttcagaactat-atactcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctctt 405  Q
    ||||||| ||||||||| ||| | ||||||||||| |||||||||||| ||||||||||||||||| | ||  ||||||||||| |||||||||||||||    
13285739 taaaccccttttcagaattatgaaactcatgattatagaaggttagtcccacccttaccttagattagatggtttcagactctacaagcttgctcctctt 13285838  T
406 ctc-ttctctgacttctcactttctccccttttctcccaaaaacagtttctacgtattctgactttctaatttgttgtaaccctaattctctaatggtct 504  Q
    ||| |||||||||||||||||||||||| ||||||||| ||| |||                 |||||||||||||||||||||||||||||||||||||    
13285839 ctctttctctgacttctcactttctccctttttctcccgaaagcag-----------------tttctaatttgttgtaaccctaattctctaatggtct 13285921  T
505 catctatttataatcactatctgagtttgtttttcacttaatctct 550  Q
    ||||||||||||||||| | |||||||||||| | |||||||||||    
13285922 catctatttataatcaccaactgagtttgtttctaacttaatctct 13285967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 185 - 375
Target Start/End: Original strand, 18459176 - 18459366
Alignment:
185 ttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatca 284  Q
    ||||||||||| ||||||  || |  ||| ||||||||| || ||| ||||| |||||||||||||| ||| ||||| || ||||| |||||||||||||    
18459176 ttattctacaacctgaacaacagtttttatgttaattcattggatttcctacactttcaacaatcaaattt-caattaaaacctaacttctataacatca 18459274  T
285 aaactattaacaactacaagcttaaacccttttt-cagaactatatactcatgattaaagaaggttagtctcacccttaccttagattggtt 375  Q
    ||||| |||| ||||| ||  ||||||||||||| |||||  |||||||||||||||||| ||||||||| |||||||||||||||||||||    
18459275 aaactgttaaaaactataaaattaaacccttttttcagaatcatatactcatgattaaagtaggttagtcccacccttaccttagattggtt 18459366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 219 - 447
Target Start/End: Original strand, 35057448 - 35057676
Alignment:
219 attcaatgaattacctactctttcaacaatcaattttgcaatttaac-cctaatttctataacatcaaaactattaacaactacaagcttaaaccctttt 317  Q
    ||||| || ||||||||| |||||||||||||| || | |||| ||  |||||||||  |||||||| || | | |||||| ||||   ||||||| |||    
35057448 attcattggattacctacactttcaacaatcaaatt-gaaattcaaaacctaatttcattaacatcataatt-tcaacaacaacaatggtaaaccccttt 35057545  T
318 tcagaactat-atactcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctcttctcttctctga 416  Q
    |||||| ||| | ||| ||||||| ||||| |||||| |||| ||||||||||||| |||||||  ||||||| ||| ||||||||||||||||||||||    
35057546 tcagaattatgaaacttatgattatagaagattagtcccaccattaccttagattgattgaatttggactctacaagtttgctcctcttctcttctctga 35057645  T
417 cttctcactttctccccttttctcccaaaaa 447  Q
    |||||||||||||||| ||||||||||||||    
35057646 cttctcactttctccctttttctcccaaaaa 35057676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 178 - 448
Target Start/End: Original strand, 25921864 - 25922133
Alignment:
178 cctatgtttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaacaatcaattttgcaattt-aaccctaatttcta 276  Q
    |||||| ||||||||||| ||||||  || || |||| ||||||||    ||||  ||||||||| ||||||||||||  | ||| || ||| | |||||    
25921864 cctatgattattctacaacctgaacaccaatcattaccttaattcatcagattatttactctttctacaatcaatttt--agtttcaaaccttaattcta 25921961  T
277 taacatcaaaac-tattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcacccttaccttagattggtt 375  Q
     ||||||||||| |||||||||||||||| ||||||||||||| || | || ||||| ||||||||| |||||||||| ||||||||||||||||| | |    
25921962 caacatcaaaacctattaacaactacaaggttaaacccttttttaggattacatacttatgattaaataaggttagtcccacccttaccttagattagat 25922061  T
376 gaattcagactctataagcttgctcctcttctc-ttctctgacttctcactttctccccttttctcccaaaaac 448  Q
    ||  || | |||||  || |||||||||||||| |||||||||||||||||||   || |||||||||||||||    
25922062 ga--tcggtctctacgagattgctcctcttctctttctctgacttctcacttttctccattttctcccaaaaac 25922133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 263 - 368
Target Start/End: Complemental strand, 7217347 - 7217243
Alignment:
263 aaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcaccctta 362  Q
    |||||||||| ||| ||||||||| ||||||||||||||||| |||||||||||||||| | || ||||| |||||||||||||||||||||||||||||    
7217347 aaccctaatt-ctacaacatcaaacctattaacaactacaaggttaaaccctttttcaggattacatacttatgattaaagaaggttagtctcaccctta 7217249  T
363 ccttag 368  Q
    ||||||    
7217248 ccttag 7217243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 278 - 453
Target Start/End: Complemental strand, 19825576 - 19825401
Alignment:
278 aacatcaaaactattaacaactacaagcttaaaccctttttcagaactatata-ctcatgattaaagaaggttagtctcacccttaccttagattggttg 376  Q
    |||||||||||||  |||||||||||| ||||| |||||||||||| |||  | | ||| |||| |||| | ||||||||||||||||||||||| | ||    
19825576 aacatcaaaactaacaacaactacaaggttaaaacctttttcagaattatgcaacccattattagagaaagctagtctcacccttaccttagattagatg 19825477  T
377 aattcagactctataagcttgctcctcttctctt-ctctgacttctcactttctccccttttctcccaaaaacagttt 453  Q
    |  || | |||||  || |||||||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||    
19825476 a--tcggtctctacgagattgctcctcttctctttctctgacttctcactttctccctttttctcccaaaagcagttt 19825401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 178 - 372
Target Start/End: Complemental strand, 25601515 - 25601325
Alignment:
178 cctatgtttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctat 277  Q
    |||||| ||||| |||||  ||||| ||| |  |||| |||||||  || |||||||||||||| |||||| || ||  |||| ||||||||||||||||    
25601515 cctatgattattatacaacatgaacatcaattattaccttaattctttggattacctactcttttaacaattaaatt--caatctaaccctaatttctat 25601418  T
278 aacatcaaaactattaacaactacaa-gcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcacccttaccttagattg 372  Q
    ||||| |||||||   |||||||||| | |||||||||||||||||| || || || |||||||| ||||||||||||| ||||||||||||||||    
25601417 aacatgaaaacta---acaactacaaaggttaaaccctttttcagaattacattcttatgattaatgaaggttagtctctcccttaccttagattg 25601325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 263 - 368
Target Start/End: Original strand, 31734655 - 31734760
Alignment:
263 aaccctaatttctataacatcaaaac-tattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcaccctt 361  Q
    ||||||||||| || ||||||||||| ||||||||||| |||| |||||||||||||||||| || ||||| |||||||||||||||||||| |||||||    
31734655 aaccctaattt-tacaacatcaaaacctattaacaactgcaaggttaaaccctttttcagaattacatacttatgattaaagaaggttagtcccaccctt 31734753  T
362 accttag 368  Q
    |||||||    
31734754 accttag 31734760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 268 - 432
Target Start/End: Complemental strand, 34140554 - 34140390
Alignment:
268 taatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcacccttacctta 367  Q
    ||||| |||||||||||||||||  |||||||||||| |||||||   ||||| || |||| || ||| |||| ||||| | |||| |||||||||||||    
34140554 taattcctataacatcaaaactaacaacaactacaagattaaaccagatttcaaaattataaacccattattagagaagct-agtcccacccttacctta 34140456  T
368 gattggttgaattcagactctataagcttgctcctcttct-cttctctgacttctcactttctccc 432  Q
    |||| | ||| | || |||||| ||||||||||||||||| ||||||| |||||||||||||||||    
34140455 gattagatgattacaaactctacaagcttgctcctcttctccttctctaacttctcactttctccc 34140390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 228 - 371
Target Start/End: Complemental strand, 23431586 - 23431443
Alignment:
228 attacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaac-tattaacaactacaagcttaaaccctttttcagaacta 326  Q
    |||| |||||||||| ||||||||||||    |  |||||||||| ||| ||||||||||| ||||| |||||||||| |||||||||||||||| | ||    
23431586 attatctactctttctacaatcaattttagtttcaaaccctaatt-ctacaacatcaaaacctattagcaactacaaggttaaaccctttttcaggatta 23431488  T
327 tatactcatgattaaagaaggttagtctcacccttaccttagatt 371  Q
     ||||| |||||||||||||||||||| ||| |||||||||||||    
23431487 catacttatgattaaagaaggttagtcccacgcttaccttagatt 23431443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 263 - 378
Target Start/End: Original strand, 31166188 - 31166303
Alignment:
263 aaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcaccctta 362  Q
    ||||| || |||| |||||||| || ||| |||||| | ||  |||||||||||||||||| |||| ||||||||||||||| |||||||||||||||||    
31166188 aaccccaacttctttaacatcacaattatcaacaacaataaaattaaaccctttttcagaattatagactcatgattaaagatggttagtctcaccctta 31166287  T
363 ccttagattggttgaa 378  Q
    ||||||||||| ||||    
31166288 ccttagattggatgaa 31166303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 217 - 330
Target Start/End: Complemental strand, 24506265 - 24506153
Alignment:
217 taattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaactattaacaactacaagcttaaacccttt 316  Q
    ||||||| || ||||||||| ||||||||||| || ||  |||||||| ||||| |||||||||||||||||||| |||||||||||  |||||||||||    
24506265 taattcattggattacctacactttcaacaattaaatta-caatttaaacctaacttctataacatcaaaactatcaacaactacaaaattaaacccttt 24506167  T
317 ttcagaactatata 330  Q
    ||||||| ||||||    
24506166 ttcagaattatata 24506153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 268 - 432
Target Start/End: Complemental strand, 34153170 - 34153006
Alignment:
268 taatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcacccttacctta 367  Q
    ||||| |||||||||||||||||  |||||||||||| ||||| |   ||||| || |||| || ||| |||| ||||| | |||| |||||||||||||    
34153170 taattcctataacatcaaaactaacaacaactacaagattaaaacagatttcaaaattataaacccattattagagaagct-agtcccacccttacctta 34153072  T
368 gattggttgaattcagactctataagcttgctcctcttct-cttctctgacttctcactttctccc 432  Q
    |||| | ||| | || |||||| ||||||||||||||||| ||||||| |||||||||||||||||    
34153071 gattagatgattacaaactctacaagcttgctcctcttctccttctctaacttctcactttctccc 34153006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 262 - 368
Target Start/End: Original strand, 15998835 - 15998942
Alignment:
262 taaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactata-tactcatgattaaagaaggttagtctcaccct 360  Q
    |||||||||||||||||||||||||||||  |||||||||||| |||||| ||||||||||| ||||  ||| |  |||| |||| ||||||||||||||    
15998835 taaccctaatttctataacatcaaaactaacaacaactacaaggttaaactctttttcagaattatacaacttagaattagagaaagttagtctcaccct 15998934  T
361 taccttag 368  Q
    ||||||||    
15998935 taccttag 15998942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 263 - 372
Target Start/End: Original strand, 32259793 - 32259902
Alignment:
263 aaccctaatttctataacatcaaaact-attaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcaccctt 361  Q
    |||||||||| ||| |||||||||||| ||||| ||||||||| |||||| ||||||||| | || ||||| |||||||||||||||||||| |||||||    
32259793 aaccctaatt-ctacaacatcaaaacttattaaaaactacaaggttaaactctttttcaggattacatacttatgattaaagaaggttagtcacaccctt 32259891  T
362 accttagattg 372  Q
    |||| ||||||    
32259892 acctaagattg 32259902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 228 - 340
Target Start/End: Original strand, 18982325 - 18982439
Alignment:
228 attacctactctttcaacaatcaattttgcaatttaa---ccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaac 324  Q
    ||||||||| |||||||||||||| || |||||||||   |||||| ||||| | |||||||||||| |||||||||||  |||||||||||||||||||    
18982325 attacctacgctttcaacaatcaaatt-gcaatttaaaaaccctaacttctacagcatcaaaactatcaacaactacaaaattaaaccctttttcagaac 18982423  T
325 tatatactcatgatta 340  Q
     ||||||| |||||||    
18982424 catatacttatgatta 18982439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 126 - 253
Target Start/End: Complemental strand, 15891810 - 15891684
Alignment:
126 ccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaat 225  Q
    |||||| ||| | ||||| | |||||||| |||||||  | ||||||||||||||||||||||| ||||  |||||| ||| | |||| ||||||||| |    
15891810 ccaaaagccccaatttcatcaacccaaatcccaaatttgataggaaactcaacctatgtttattttacagcctgaacttcaattcttatgttaattcatt 15891711  T
226 gaattacctactctttcaacaatcaatt 253  Q
    |||||||||||||||| |||||||||||    
15891710 gaattacctactcttt-aacaatcaatt 15891684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 126 - 253
Target Start/End: Complemental strand, 15900895 - 15900769
Alignment:
126 ccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaat 225  Q
    |||||| ||| | ||||| | |||||||| |||||||  | ||||||||||||||||||||||| ||||  |||||| ||| | |||| ||||||||| |    
15900895 ccaaaagccccaatttcatcaacccaaatcccaaatttgataggaaactcaacctatgtttattttacagcctgaacttcaattcttatgttaattcatt 15900796  T
226 gaattacctactctttcaacaatcaatt 253  Q
    |||||||||||||||| |||||||||||    
15900795 gaattacctactcttt-aacaatcaatt 15900769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 306 - 447
Target Start/End: Original strand, 29045261 - 29045402
Alignment:
306 ttaaaccctttttcagaactatata-ctcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctct 404  Q
    ||||||||||||||| || |||| | | ||| |||| |||| | ||||||||||||||||||||| | | ||| | |  |||||| ||||||||||||||    
29045261 ttaaaccctttttcaaaattatacaacccattattagagaaagctagtctcacccttaccttagaatagatgattccgaactcta-aagcttgctcctct 29045359  T
405 tctct-tctctgacttctcactttctccccttttctcccaaaaa 447  Q
    ||||| |||||||||||||||||||| |||||||||||||||||    
29045360 tctctctctctgacttctcactttct-cccttttctcccaaaaa 29045402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 263 - 368
Target Start/End: Complemental strand, 18455177 - 18455072
Alignment:
263 aaccctaatttctataacatcaaaac-tattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcaccctt 361  Q
    |||||||||| ||| || |||||||| |||||||||||||||| ||||| |||||||||| | || ||||| ||||||||||||||||| || |||||||    
18455177 aaccctaatt-ctacaatatcaaaacctattaacaactacaaggttaaaacctttttcaggattacatacttatgattaaagaaggttactcccaccctt 18455079  T
362 accttag 368  Q
    |||||||    
18455078 accttag 18455072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 272 - 368
Target Start/End: Original strand, 22557204 - 22557300
Alignment:
272 ttctataacatcaaaac-tattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcacccttaccttag 368  Q
    ||||| ||||||||||| |||||||||||||||| |||||||||||||||| | || ||||| |||| |||||||||||| || ||||||||||||||    
22557204 ttctacaacatcaaaacctattaacaactacaaggttaaaccctttttcaggattacatacttatga-taaagaaggttactcccacccttaccttag 22557300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 48 - 162
Target Start/End: Original strand, 14993540 - 14993654
Alignment:
48 gtcactcgcaaggcgaacaagatcacccgccgtggtgagcgatgacaaacagttctacgggaagaaatctattttttcccaaaaacccaattttcaacca 147  Q
    ||||||||| |||||||||||| ||| ||||||||  |||||||| | |||  |||||||||||||| || ||||  ||||||||||| | ||||||| |    
14993540 gtcactcgcgaggcgaacaagaacactcgccgtggcaagcgatgatagacaaatctacgggaagaaacctgttttcacccaaaaaccccaatttcaacta 14993639  T
148 cccaaattccaaatt 162  Q
    ||||||| |||||||    
14993640 cccaaatcccaaatt 14993654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 488 - 550
Target Start/End: Original strand, 14993677 - 14993739
Alignment:
488 taattctctaatggtctcatctatttataatcactatctgagtttgtttttcacttaatctct 550  Q
    |||||||||||||| ||||||||||||||||||||| |||||||||||| | |||||||||||    
14993677 taattctctaatggcctcatctatttataatcactaactgagtttgtttcttacttaatctct 14993739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 126 - 202
Target Start/End: Complemental strand, 28288747 - 28288670
Alignment:
126 ccaaaaacccaatttt-caaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaac 202  Q
    |||||||||||||||| || |||||||||  |||||||  | ||||||||||||||||||||||||||||||||||||    
28288747 ccaaaaacccaatttttcatccacccaaaccccaaatttgataggaaactcaacctatgtttattctacaatctgaac 28288670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 149 - 253
Target Start/End: Complemental strand, 15173671 - 15173568
Alignment:
149 ccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaacaat 248  Q
    |||||| |||||||  | |||||||||||||||||||||| |||||  |||||| ||| | |||| ||||||||| ||||||||||| ||||| ||||||    
15173671 ccaaatcccaaatttgataggaaactcaacctatgtttatcctacaggctgaacttcaattcttatgttaattcattgaattacctattcttt-aacaat 15173573  T
249 caatt 253  Q
    |||||    
15173572 caatt 15173568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 228 - 377
Target Start/End: Original strand, 18982483 - 18982634
Alignment:
228 attacctactctttcaacaa-tcaattttgcaatt-taaccctaatttctataa-catcaaaactattaacaactacaagcttaaaccctttttcagaac 324  Q
    |||||||||||||||| ||| ||||||||  |||| |||||||||||||| ||| ||||||| |||  |||||||||||| ||||||||||||||||||     
18982483 attacctactctttcaccaaatcaatttt--aattctaaccctaatttctctaatcatcaaacctagcaacaactacaaggttaaaccctttttcagaat 18982580  T
325 tata-tactcatgattaaagaaggttagtctcacccttaccttagattggttga 377  Q
    ||||  || ||| |||| | || |||| || |||| ||||||||||||| ||||    
18982581 tatacaacccattattagataaagttaatcccaccgttaccttagattgattga 18982634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 126 - 202
Target Start/End: Original strand, 12942941 - 12943018
Alignment:
126 ccaaaaacccaatttt-caaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaac 202  Q
    |||||||||||||||| || |||||||||  |||||||  | |||||||||||||||| |||||||||||||||||||    
12942941 ccaaaaacccaatttttcatccacccaaaccccaaatttgataggaaactcaacctatatttattctacaatctgaac 12943018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 262 - 328
Target Start/End: Complemental strand, 20410616 - 20410552
Alignment:
262 taaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactata 328  Q
    ||||||||||||||||  ||||||||||| ||||||||||||| ||||| |||||||||||| ||||    
20410616 taaccctaatttctat--catcaaaactaataacaactacaaggttaaatcctttttcagaattata 20410552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 271 - 368
Target Start/End: Complemental strand, 21683171 - 21683074
Alignment:
271 tttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactata-tactcatgattaaagaaggttagtctcacccttaccttag 368  Q
    ||||||||||||||||||||  |||||||||||| |||||||||||||| ||| ||||  || ||| |||| |||| | ||||| ||||||||||||||    
21683171 tttctataacatcaaaactac-aacaactacaaggttaaaccctttttctgaattatacaacccattattagagaaagctagtcccacccttaccttag 21683074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 272 - 328
Target Start/End: Original strand, 23658044 - 23658101
Alignment:
272 ttctataacatcaaaac-tattaacaactacaagcttaaaccctttttcagaactata 328  Q
    ||||| ||||||||||| |||||||||||||||| |||||||||||||||||| ||||    
23658044 ttctacaacatcaaaacctattaacaactacaaggttaaaccctttttcagaattata 23658101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 170 - 255
Target Start/End: Original strand, 29045119 - 29045204
Alignment:
170 aaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaacaatcaatttt 255  Q
    |||||| ||||||| ||||||||||| |||||| ||| |  |||| ||| ||||  | ||||||||||||||||||||||||||||    
29045119 aaactctacctatgattattctacaacctgaacatcaattattaccttagttcatcggattacctactctttcaacaatcaatttt 29045204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 401 - 473
Target Start/End: Original strand, 31166343 - 31166413
Alignment:
401 ctcttctcttctctgacttctcactttctccccttttctcccaaaaacagtttctacgtattctgactttcta 473  Q
    |||||||||| ||||||||||||||||||  | ||||||||||||||| |||| ||||| |||||||| ||||    
31166343 ctcttctcttatctgacttctcactttct--ctttttctcccaaaaactgtttttacgtgttctgactctcta 31166413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 401 - 454
Target Start/End: Complemental strand, 18455031 - 18454978
Alignment:
401 ctcttctcttctct-gacttctcactttctccccttttctcccaaaaacagtttc 454  Q
    |||||||||||||| |||||||||||||||||| ||||||||||||| |||||||    
18455031 ctcttctcttctcttgacttctcactttctccc-ttttctcccaaaagcagtttc 18454978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 185 - 251
Target Start/End: Original strand, 18585549 - 18585615
Alignment:
185 ttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaacaatcaa 251  Q
    ||||||||||| |||||| ||| | |||| ||||||||| |||||||| ||| ||||||||||||||    
18585549 ttattctacaacctgaacatcaattcttatgttaattcattgaattacatacactttcaacaatcaa 18585615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 126 - 202
Target Start/End: Original strand, 23956674 - 23956751
Alignment:
126 ccaaaaacccaatttt-caaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaac 202  Q
    |||||||||||||||| || |||||||||  |||||||  | |||||||| |||||||| ||||||||||| ||||||    
23956674 ccaaaaacccaatttttcatccacccaaaccccaaatttgataggaaacttaacctatgattattctacaacctgaac 23956751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 126 - 194
Target Start/End: Original strand, 23415717 - 23415785
Alignment:
126 ccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctaca 194  Q
    |||||| ||| | ||||| | |||||||| |||||||  | ||||||||||||||||||||||||||||    
23415717 ccaaaagccccaatttcatcaacccaaatcccaaatttgataggaaactcaacctatgtttattctaca 23415785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 315 - 377
Target Start/End: Complemental strand, 31629913 - 31629851
Alignment:
315 ttttcagaactatatactcatgattaaagaaggttagtctcacccttaccttagattggttga 377  Q
    |||||||||  ||| ||||| |||||  ||| |||||||||||||||||||||||||| ||||    
31629913 ttttcagaatcatagactcaagattattgaatgttagtctcacccttaccttagattgattga 31629851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 126 - 202
Target Start/End: Original strand, 13765158 - 13765235
Alignment:
126 ccaaaaacccaatttt-caaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaac 202  Q
    ||||||||| |||||| || |||||||||  |||||||  | |||||||| |||||||| ||||||||||| ||||||    
13765158 ccaaaaacctaatttttcatccacccaaaccccaaatttgataggaaacttaacctatgattattctacaacctgaac 13765235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 475 - 520
Target Start/End: Complemental strand, 15285882 - 15285837
Alignment:
475 tttgttgtaaccctaattctctaatggtctcatctatttataatca 520  Q
    ||||||||||||||| ||  |||||| |||||||||||||||||||    
15285882 tttgttgtaaccctattttcctaatgttctcatctatttataatca 15285837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 343 - 372
Target Start/End: Original strand, 23501700 - 23501729
Alignment:
343 gaaggttagtctcacccttaccttagattg 372  Q
    ||||||||||||||||||||||||||||||    
23501700 gaaggttagtctcacccttaccttagattg 23501729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 417 - 453
Target Start/End: Original strand, 23658188 - 23658224
Alignment:
417 cttctcactttctccccttttctcccaaaaacagttt 453  Q
    |||||||||||||||| ||||||||||||| ||||||    
23658188 cttctcactttctccctttttctcccaaaagcagttt 23658224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 170 - 202
Target Start/End: Original strand, 27557519 - 27557551
Alignment:
170 aaactcaacctatgtttattctacaatctgaac 202  Q
    |||||||||||||||||||||||||| ||||||    
27557519 aaactcaacctatgtttattctacaacctgaac 27557551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 337 - 377
Target Start/End: Original strand, 28948597 - 28948637
Alignment:
337 attaaagaaggttagtctcacccttaccttagattggttga 377  Q
    |||| |||| |||||||||||||||||||||||||| ||||    
28948597 attagagaaagttagtctcacccttaccttagattgattga 28948637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 320; Significance: 1e-180; HSPs: 37)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 10 - 548
Target Start/End: Original strand, 21503835 - 21504365
Alignment:
10 gcgagtagaacactcaccngttgcgagttgatatcgaagtcactcgcaaggcgaacaagatcacccgccgtggtgagcgatgacaaacagttctacggga 109  Q
    ||||||||||||||| || |||||||||||| ||||||||||||||| |||||||||||||||| | ||||||  |||||||||| ||||||||||| ||    
21503835 gcgagtagaacactcgcc-gttgcgagttgacatcgaagtcactcgcgaggcgaacaagatcactcaccgtggctagcgatgacagacagttctacgaga 21503933  T
110 agaaatctattttttcccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattc 209  Q
    | ||| |||||||   ||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| ||||||||||| |||||| ||| |     
21503934 aaaaacctattttcagccaaaaacccaattttcaaccacccaaatcccaaattcaataggaaactcaacctatgattattctacaacctgaacatcagtt 21504033  T
210 cttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaactattaacaactacaagcttaa 309  Q
    |||| ||||||||| || || |||||||||||||||||| |||||   ||||||||||||||||||||||||||||||||| |||||||||||| |||||    
21504034 cttatgttaattcattggatcacctactctttcaacaatgaatttgcaaatttaaccctaatttctataacatcaaaactactaacaactacaaacttaa 21504133  T
310 accctttttcagaactatatactcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctcttctct 409  Q
    ||||||||||||||| ||||||| |||||||||||||||||||| |||| |||||||||||||||||||||| ||||||| |||||||||||||||||||    
21504134 accctttttcagaaccatatacttatgattaaagaaggttagtcccacctttaccttagattggttgaattcggactctacaagcttgctcctcttctct 21504233  T
410 tctctgacttctcactttctccccttttctcccaaaaacagtttctacgtattctgactttctaatttgttgtaaccctaattctctaatggtctcatct 509  Q
    ||||| ||||||||||||||||||||||||||| ||| |||||||||||| |||      |||| |||||||||||||||||||||||| ||||||||||    
21504234 tctcttacttctcactttctccccttttctccc-aaagcagtttctacgtgttc------tctattttgttgtaaccctaattctctaacggtctcatct 21504326  T
510 atttataatcactatctgagtttgtttttcacttaatct 548  Q
    |||||||||||| | |||||||||||| |||||||||||    
21504327 atttataatcaccaactgagtttgtttctcacttaatct 21504365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 122; E-Value: 3e-62
Query Start/End: Original strand, 78 - 462
Target Start/End: Original strand, 20313037 - 20313422
Alignment:
78 cgtggtgagcgatgacaaacagttctacgggaagaaatctattttttc--ccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactc 175  Q
    ||||||||||||||||| |||| |||||||||||||| | | ||||||  ||||||||||||||||||||||||||||| |||||||||| |||||||||    
20313037 cgtggtgagcgatgacagacagctctacgggaagaaacc-agtttttcagccaaaaacccaattttcaaccacccaaatcccaaattcaataggaaactc 20313135  T
176 aacctatgtttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttct 275  Q
    || |||||||||||||| ||  ||||| ||| |   |||  ||||||| ||||||  ||||| ||| | |||||||||    |||  ||  |||||||||    
20313136 aatctatgtttattctataacttgaacatcaatttgtacactaattcattgaattctctacttttttagcaatcaattcca-aatcaaaatctaatttct 20313234  T
276 ataa-catcaaaa-ctattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcacccttaccttagattgg 373  Q
     ||| |||||||| | |  |||||| || |  ||||||||| |||||||| |||| || ||  |||| ||||| | |||| |||||||||||||||||||    
20313235 ctaatcatcaaaatcaaacaacaacaaccatgttaaaccctatttcagaattataaacccactattagagaagct-agtcccacccttaccttagattgg 20313333  T
374 ttgaattcagactctataagcttgctcctcttctcttctctgacttctcactttctccccttttctcccaaaaacagtttctacgtatt 462  Q
    |||||||  ||||||| || |||||||||||||||||||||||||| |||||||||||| ||||||||||||| |||||||||||||||    
20313334 ttgaattaggactctacaaacttgctcctcttctcttctctgacttatcactttctccctttttctcccaaaagcagtttctacgtatt 20313422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 400 - 550
Target Start/End: Complemental strand, 26758674 - 26758524
Alignment:
400 cctcttctcttctctgacttctcactttctccccttttctcccaaaaacagtttctacgtattctgactttctaatttgttgtaaccctaattctctaat 499  Q
    ||||||||||| || |||||||||||||||||| ||||||| ||||| ||||||||||||||||||||| |||| ||||||| |||||||||||||||||    
26758674 cctcttctcttatccgacttctcactttctccctttttctcgcaaaagcagtttctacgtattctgactctctattttgttgcaaccctaattctctaat 26758575  T
500 ggtctcatctatttataatcactatctgagtttgtttttcacttaatctct 550  Q
    |||||||||||||||||||||||| |||||||||||| |||||||||||||    
26758574 ggtctcatctatttataatcactaactgagtttgtttctcacttaatctct 26758524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 209 - 368
Target Start/End: Complemental strand, 1627076 - 1626917
Alignment:
209 ccttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaac-tattaacaactacaagctt 307  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||| | ||| ||||||| || ||||||||||| |||||||||||||||| ||    
1627076 ccttacgttaattcaatggtttacctactctttcaacaatcaattttgcaaataaactctaattt-tacaacatcaaaacctattaacaactacaaggtt 1626978  T
308 aaaccctttttcagaactatatactcatgattaaagaaggttagtctcacccttaccttag 368  Q
    |||||||||||||| | || ||||| |||||||||||||||||||| ||||||||||||||    
1626977 aaaccctttttcaggattacatacttatgattaaagaaggttagtcacacccttaccttag 1626917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 96; E-Value: 9e-47
Query Start/End: Original strand, 266 - 447
Target Start/End: Original strand, 16063701 - 16063883
Alignment:
266 cctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactatata-ctcatgattaaagaaggttagtctcacccttacc 364  Q
    ||||||| |||||||||||||||||  |||||||||||| ||||||||||||| |||| |||| | | ||| |||| |||| | ||||| ||||||||||    
16063701 cctaattcctataacatcaaaactaacaacaactacaaggttaaacccttttttagaattatacaacccattattagagaaaggtagtcccacccttacc 16063800  T
365 ttagattggttgaattcagactctataagcttgctcctcttctc-ttctctgacttctcactttctccccttttctcccaaaaa 447  Q
    ||||||||||||||| ||||||||| |||||||||||||||||| |||||| |||||||||||||| |||||||||||||||||    
16063801 ttagattggttgaatacagactctacaagcttgctcctcttctctttctctaacttctcactttct-cccttttctcccaaaaa 16063883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 68; E-Value: 5e-30
Query Start/End: Original strand, 262 - 372
Target Start/End: Original strand, 18744820 - 18744931
Alignment:
262 taaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactata-tactcatgattaaagaaggttagtctcaccct 360  Q
    ||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||  || ||| |||| |||| ||||||| ||||||    
18744820 taaccctaatttctataacatcaaaactaataacaactacaaggttaaaccctttttcagaattatacaacccattattagagaaagttagtcccaccct 18744919  T
361 taccttagattg 372  Q
    ||||||||||||    
18744920 taccttagattg 18744931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 260 - 368
Target Start/End: Original strand, 26749976 - 26750084
Alignment:
260 tttaaccctaatttctataacatcaaaact-attaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcacc 358  Q
    ||||||||||||| ||| |||||||||||| ||||||||||||||| |||||||| ||||||| | |||||||| ||||||||| |||||||||||||||    
26749976 tttaaccctaatt-ctacaacatcaaaacttattaacaactacaaggttaaaccccttttcaggattatatacttatgattaaaaaaggttagtctcacc 26750074  T
359 cttaccttag 368  Q
    ||||||||||    
26750075 cttaccttag 26750084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 278 - 371
Target Start/End: Complemental strand, 14025897 - 14025803
Alignment:
278 aacatcaaaa-ctattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcacccttaccttagatt 371  Q
    |||||||||| ||||||||||||||||| |||||||||||||||| | || ||||| |||||||||||||||||||| |||||||||||||||||    
14025897 aacatcaaaatctattaacaactacaaggttaaaccctttttcaggattacatacttatgattaaagaaggttagtcccacccttaccttagatt 14025803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 263 - 454
Target Start/End: Complemental strand, 8503992 - 8503803
Alignment:
263 aaccctaatttctataacatcaaaac-tattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcaccctt 361  Q
    |||||||||| ||| ||||||||||| |||||||||||||||| |||||| ||| ||||| | || ||||| |||||| ||||||||||||| |||||||    
8503992 aaccctaatt-ctacaacatcaaaacctattaacaactacaaggttaaactcttgttcaggattacatacttatgattgaagaaggttagtcccaccctt 8503894  T
362 accttagattggttgaattcagactctataagcttgctcctcttctc-ttctctgacttctcactttctccccttttctcccaaaaacagtttc 454  Q
    |||||| ||| | |  | || | |||||  || |||||||| ||||| || |||||||||||||||||| |||||||| ||||||| |||||||    
8503893 accttatattagat--aatcggtctctacgagattgctcctattctctttatctgacttctcactttct-cccttttcccccaaaagcagtttc 8503803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 209 - 290
Target Start/End: Complemental strand, 21398805 - 21398724
Alignment:
209 ccttacgttaattcaatgaatt-acctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaacta 290  Q
    |||||||||||||||||| ||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||    
21398805 ccttacgttaattcaatggatttacctactctttcaacaaccaattttgcaatt-aaccctaatttctataacatcaaaacta 21398724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 263 - 368
Target Start/End: Original strand, 26762350 - 26762455
Alignment:
263 aaccctaatttctataacatcaaaac-tattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcaccctt 361  Q
    |||||||||| ||| ||||||||||| |||||||||||||||| |||||||||||||||| | || ||| | |||||||||||||||||||| |||||||    
26762350 aaccctaatt-ctacaacatcaaaacctattaacaactacaaggttaaaccctttttcaggattacataattatgattaaagaaggttagtcccaccctt 26762448  T
362 accttag 368  Q
    |||||||    
26762449 accttag 26762455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 262 - 408
Target Start/End: Complemental strand, 23199313 - 23199168
Alignment:
262 taaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactata-tactcatgattaaagaaggttagtctcaccct 360  Q
    ||||||||||||||||||||||||||||| ||||||||||||| ||||||| |||||||||| ||||  || ||| |||| |||| | ||||| ||||||    
23199313 taaccctaatttctataacatcaaaactactaacaactacaaggttaaaccatttttcagaattatacaacccattattagagaaagctagtcccaccct 23199214  T
361 taccttagattggttgaattcagactctataagcttgctcctcttctc 408  Q
    ||||||| ||| | |||  || ||||||| ||| |||||| |||||||    
23199213 taccttaaattagatga--tcggactctacaagattgctcttcttctc 23199168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 210 - 320
Target Start/End: Original strand, 24068125 - 24068234
Alignment:
210 cttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaac-tattaacaactacaagctta 308  Q
    |||||||||||||||||  ||||||||| |||||||||| || ||  |||| |||||||||| ||| |||||||||||| |||||||||||||||| |||    
24068125 cttacgttaattcaatggtttacctactttttcaacaattaaatt--caatataaccctaatctctttaacatcaaaacctattaacaactacaaggtta 24068222  T
309 aaccctttttca 320  Q
    ||||||||||||    
24068223 aaccctttttca 24068234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 147 - 253
Target Start/End: Original strand, 17011560 - 17011665
Alignment:
147 acccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaaca 246  Q
    |||||||| |||||||  | ||||||||||||||||||||||||||||  |||||| ||| | |||| ||||||||| ||||||||||||||||| ||||    
17011560 acccaaatcccaaatttgataggaaactcaacctatgtttattctacagcctgaacttcaattcttatgttaattcattgaattacctactcttt-aaca 17011658  T
247 atcaatt 253  Q
    |||||||    
17011659 atcaatt 17011665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 209 - 290
Target Start/End: Original strand, 22111871 - 22111951
Alignment:
209 ccttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaacta 290  Q
    |||||||||||||| ||   ||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||    
22111871 ccttacgttaattcgattgtttacctactctttcaacaaccaattttgcaa-ttaaccctaatttctataacatcaaaacta 22111951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 266 - 372
Target Start/End: Complemental strand, 6551392 - 6551285
Alignment:
266 cctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactata-tactcatgattaaagaaggttagtctcacccttacc 364  Q
    ||||||| ||||||||||||| |||  |||||||||||| |||||||||||||||||| ||||  ||| |  |||| |||| ||||||||||||||||||    
6551392 cctaattcctataacatcaaatctaacaacaactacaaggttaaaccctttttcagaattatacaacttagaattagagaaagttagtctcacccttacc 6551293  T
365 ttagattg 372  Q
    ||||||||    
6551292 ttagattg 6551285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 310 - 381
Target Start/End: Original strand, 21404080 - 21404151
Alignment:
310 accctttttcagaactatatactcatgattaaagaaggttagtctcacccttaccttagattggttgaattc 381  Q
    |||||||||||||| |||| |||||||||||||||||||||||| || |||||||||||||||||| |||||    
21404080 accctttttcagaattatagactcatgattaaagaaggttagtcccatccttaccttagattggttaaattc 21404151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 263 - 364
Target Start/End: Complemental strand, 8833310 - 8833209
Alignment:
263 aaccctaatttctataacatcaaaac-tattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcaccctt 361  Q
    |||||||||| ||| ||||||||||| |||||||||||| ||| |||||||||||||||| | || ||||| ||||||||||||||| |||| |||||||    
8833310 aaccctaatt-ctacaacatcaaaacctattaacaactataaggttaaaccctttttcaggattacatacttatgattaaagaaggtcagtcccaccctt 8833212  T
362 acc 364  Q
    |||    
8833211 acc 8833209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 149 - 253
Target Start/End: Original strand, 265872 - 265975
Alignment:
149 ccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaacaat 248  Q
    |||||| |||||||  | ||||||||||||||||||||||||||||  |||||| ||| | |||| ||||||||| || |||||||||||||| ||||||    
265872 ccaaatcccaaatttgataggaaactcaacctatgtttattctacagcctgaacttcaattcttatgttaattcactggattacctactcttt-aacaat 265970  T
249 caatt 253  Q
    |||||    
265971 caatt 265975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 247 - 453
Target Start/End: Complemental strand, 32607438 - 32607229
Alignment:
247 atcaattttgcaatttaaccctaatttctataacatcaaaacta--ttaacaactacaagcttaaaccctttttcagaactata-tactcatgattaaag 343  Q
    ||||||||||||||||||| ||||||||||||||||||||||||    |||||| ||| | |||||||| |||| ||||  |||  || ||| |||| ||    
32607438 atcaattttgcaatttaactctaatttctataacatcaaaactaacaaaacaacaacatg-ttaaacccctttttagaatcatacaacccattattagag 32607340  T
344 aaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctcttctc---ttctctgacttctcactttctccccttttctc 440  Q
    || | ||||| ||||||||||||||||| | |  | || | |||||  || ||||||||||| ||   |||||||||||||||||||||| | |||||||    
32607339 aaagctagtcccacccttaccttagattagat--aatcggtctctacgagattgctcctcttttctctttctctgacttctcactttctctctttttctc 32607242  T
441 ccaaaaacagttt 453  Q
    |||||| ||||||    
32607241 ccaaaagcagttt 32607229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 147 - 363
Target Start/End: Complemental strand, 21399018 - 21398800
Alignment:
147 acccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaaca 246  Q
    |||||||| |||||||  | || ||||||  |||||||||||||||||| |||||| ||| |   |||  ||||| | |  ||||||||||||||  |||    
21399018 acccaaatcccaaattttatagaaaactcttcctatgtttattctacaacctgaacatcaatttgtacactaattaattagattacctactcttttgaca 21398919  T
247 atcaattttgcaatttaaccctaatttctataacatcaaaactattaacaactacaa----gcttaaacccttttt-cagaactatatactcatgattaa 341  Q
    || || ||  |||| || ||||| | ||||||||||||||||||  |||||| ||||    | ||||||||||||| ||||| |||| ||||||||||||    
21398918 attaaatt--caatcta-ccctattctctataacatcaaaactaacaacaacaacaacaaaggttaaacccttttttcagaattatacactcatgattaa 21398822  T
342 agaaggttagtctcacccttac 363  Q
    |||||||||||| |||||||||    
21398821 agaaggttagtcccacccttac 21398800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 402 - 453
Target Start/End: Complemental strand, 21398597 - 21398546
Alignment:
402 tcttctcttctctgacttctcactttctccccttttctcccaaaaacagttt 453  Q
    ||||||||||||||||||||||||||||||| ||||||||||||| ||||||    
21398597 tcttctcttctctgacttctcactttctccctttttctcccaaaagcagttt 21398546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 337 - 447
Target Start/End: Original strand, 31622139 - 31622249
Alignment:
337 attaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctcttctc-ttctctgacttctcactttctcccctt 435  Q
    |||| |||| |||| || ||||||||||||||||| | ||  ||||||||||| ||||||||| || || || ||||||||||||||||||||| |||||    
31622139 attagagaaagttaatcccacccttaccttagattagatggtttcagactctacaagcttgcttctattttctttctctgacttctcactttct-ccctt 31622237  T
436 ttctcccaaaaa 447  Q
    |||| |||||||    
31622238 ttcttccaaaaa 31622249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 29448692 - 29448777
Alignment:
167 aggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaacaatcaatt 253  Q
    ||||||||||||||||||||||||||||  |||||| ||| | |||| ||||||||| ||  ||||||||||||| |||||||||||    
29448692 aggaaactcaacctatgtttattctacagcctgaacttcaattcttatgttaattcattggtttacctactcttt-aacaatcaatt 29448777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 126 - 202
Target Start/End: Original strand, 9776917 - 9776994
Alignment:
126 ccaaaaacccaatttt-caaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaac 202  Q
    |||||||||||||||| || |||||||||  |||||||  | |||||||| |||||||||||||||||||||||||||    
9776917 ccaaaaacccaatttttcatccacccaaaccccaaatttgataggaaacttaacctatgtttattctacaatctgaac 9776994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 126 - 202
Target Start/End: Complemental strand, 37804313 - 37804236
Alignment:
126 ccaaaaacccaatttt-caaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaac 202  Q
    |||||||||||||||| || |||||||||  |||||||  | |||||||||||| |||||||||||||||||||||||    
37804313 ccaaaaacccaatttttcatccacccaaaccccaaatttgataggaaactcaacatatgtttattctacaatctgaac 37804236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 262 - 328
Target Start/End: Original strand, 660736 - 660801
Alignment:
262 taaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactata 328  Q
    |||||| ||||||||||||||||||||||  |||||||||||| ||||| |||||||||||| ||||    
660736 taacccaaatttctataacatcaaaactaacaacaactacaaggttaaa-cctttttcagaattata 660801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 401 - 473
Target Start/End: Original strand, 21404186 - 21404256
Alignment:
401 ctcttctcttctctgacttctcactttctccccttttctcccaaaaacagtttctacgtattctgactttcta 473  Q
    |||||||||||||||||||||||||||||  | ||||||||||||||  |||| ||||| |||||||| ||||    
21404186 ctcttctcttctctgacttctcactttct--ctttttctcccaaaaattgtttttacgtgttctgactctcta 21404256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 126 - 202
Target Start/End: Complemental strand, 33472804 - 33472727
Alignment:
126 ccaaaaacccaatttt-caaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaac 202  Q
    |||||||||||||||| || |||||||||| |||||||  | |||||||| |||||||| ||||||||||| ||||||    
33472804 ccaaaaacccaatttttcatccacccaaatcccaaatttgataggaaacttaacctatgattattctacaacctgaac 33472727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 168 - 251
Target Start/End: Complemental strand, 30138282 - 30138199
Alignment:
168 ggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaacaatcaa 251  Q
    ||||||| |||||||| ||||||||||| |||||| ||||  | || ||||||||| || ||| ||||| ||||||||||||||    
30138282 ggaaacttaacctatgattattctacaacctgaacatcatatcatatgttaattcattggattgcctacactttcaacaatcaa 30138199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 185 - 251
Target Start/End: Original strand, 31456721 - 31456787
Alignment:
185 ttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaacaatcaa 251  Q
    ||||||||||| |||||| ||| | | || ||||||||| |||||||||||| ||||||||||||||    
31456721 ttattctacaacctgaacatcaattcatatgttaattcattgaattacctacactttcaacaatcaa 31456787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 126 - 202
Target Start/End: Complemental strand, 27868815 - 27868738
Alignment:
126 ccaaaaacccaatttt-caaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaac 202  Q
    |||||||||||||||| || |||||||||  |||||||  | |||||||| |||||||| ||||||||||| ||||||    
27868815 ccaaaaacccaatttttcatccacccaaaccccaaatttgataggaaacttaacctatgattattctacaacctgaac 27868738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 262 - 318
Target Start/End: Complemental strand, 1627174 - 1627118
Alignment:
262 taaccctaatttctataacatcaaaactattaacaactacaagcttaaacccttttt 318  Q
    |||||||||||||||||||||||||||||  || || ||||||  ||||||||||||    
1627174 taaccctaatttctataacatcaaaactaacaataaatacaagggtaaacccttttt 1627118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 482 - 548
Target Start/End: Complemental strand, 28710268 - 28710200
Alignment:
482 taaccctaattctctaatggtctcatctatttataatcactatctgagttt-gtttt-tcacttaatct 548  Q
    ||||||||||||| ||||| |||  |||||||||||||||||| ||||||| ||||| |||||||||||    
28710268 taaccctaattctttaatgctcttctctatttataatcactatttgagtttagttttctcacttaatct 28710200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 185 - 251
Target Start/End: Original strand, 17875927 - 17875993
Alignment:
185 ttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaacaatcaa 251  Q
    ||||||||||| |||||| ||| | | || ||||||||| || ||||||||| ||||||||||||||    
17875927 ttattctacaacctgaacatcaattcatatgttaattcattggattacctacactttcaacaatcaa 17875993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 401 - 454
Target Start/End: Complemental strand, 21299995 - 21299942
Alignment:
401 ctcttctcttctct-gacttctcactttctccccttttctcccaaaaacagtttc 454  Q
    ||||||| |||||| |||||||||||||||||| ||||||||||||| |||||||    
21299995 ctcttcttttctcttgacttctcactttctccc-ttttctcccaaaagcagtttc 21299942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 337 - 377
Target Start/End: Original strand, 20566568 - 20566608
Alignment:
337 attaaagaaggttagtctcacccttaccttagattggttga 377  Q
    |||| |||| |||||||||||||||||||||||||| ||||    
20566568 attagagaaagttagtctcacccttaccttagattgattga 20566608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 303; Significance: 1e-170; HSPs: 55)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 10 - 550
Target Start/End: Original strand, 34392461 - 34393010
Alignment:
10 gcgagtagaacactcaccngttgcgagttgatatcgaagtcactcgcaaggcgaacaagatcacccgccgtggtgagcgatgacaaacagttctacggga 109  Q
    ||||||||||||||| || |||||||||||| ||||||||||||||| |||||||||||||||| |||||||| ||||||||||| ||||||||||||||    
34392461 gcgagtagaacactcgcc-gttgcgagttgacatcgaagtcactcgcgaggcgaacaagatcactcgccgtggcgagcgatgacagacagttctacggga 34392559  T
110 agaaatctattttttcccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaa-tctgaacctcatt 208  Q
    ||||| || ||||   ||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||    
34392560 agaaacctgttttcagccaaaaacccaattttcaagcacccaaatcccaaattcaaaaggaaactcaacctatgtttattctacaattctgaacctcatt 34392659  T
209 ccttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaacta--ttaacaactacaagct 306  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||| ||| | |    
34392660 ccttacgttaattcaatggattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaactaacaaaacaacaacatg-t 34392758  T
307 taaaccctttttcagaactata-tactcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctctt 405  Q
    ||||||| |||| ||||  |||  || ||| |||| |||| | ||||| ||||||||||||||||||||||||||  ||||||| ||| |||||| | ||    
34392759 taaacccctttttagaatcatacaacccattattagagaaagctagtcacacccttaccttagattggttgaatttggactctacaagattgctcatatt 34392858  T
406 ctcttctctgacttctcactttctccccttttctcccaaaaacagtttctac-------gtattctgactttctaatttgttgtaaccctaattctctaa 498  Q
    ||||||||||||||||||||||||||  |||||||||||||  |||||||||       ||||||||||| |||| | | ||||||||||||||||||||    
34392859 ctcttctctgacttctcactttctccttttttctcccaaaaggagtttctacgtattctgtattctgactctctattcttttgtaaccctaattctctaa 34392958  T
499 tggtctcatctatttataatcactatctgagtttgtttttcacttaatctct 550  Q
    ||||||||||||||||||||||||| |||||||||||| |||||||||||||    
34392959 tggtctcatctatttataatcactaactgagtttgtttctcacttaatctct 34393010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 139; E-Value: 2e-72
Query Start/End: Original strand, 20 - 432
Target Start/End: Complemental strand, 21188380 - 21187968
Alignment:
20 cactcaccngttgcgagttgatatcgaagtcactcgcaaggcgaacaagatc-acccgccgtggtgagcgatgacaaacagttctacgggaagaaatcta 118  Q
    |||||||| |||||||||| | ||||||| ||||||| |||||||||||||| || ||||||||  |||||||||| | || | |||||| | ||| |      
21188380 cactcacc-gttgcgagttaacatcgaagccactcgcgaggcgaacaagatccactcgccgtggcaagcgatgacagatagctttacgggcataaaccag 21188282  T
119 ttttttcccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgtta 218  Q
    ||||  ||||||||||| | || |||| |||||||| |||||||  | |||||||   || |||  ||||||||||| |||||| ||| |  |||  |||    
21188281 ttttcacccaaaaaccccaattacaactacccaaatcccaaatttgataggaaacattacatattcttattctacaacctgaacatcaatttttatatta 21188182  T
219 attcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaactattaacaactacaagcttaaacccttttt 318  Q
    ||||| || ||||||||| |||||||||||||| || ||||||||| ||||| |||||||||||||||||||| |||||||||||  ||||| ||||| |    
21188181 attcattggattacctacactttcaacaatcaaatt-gcaatttaaacctaacttctataacatcaaaactatcaacaactacaaaattaaatcctttct 21188083  T
319 cagaactatatactcatgattaaagaaggttagtctcacccttaccttagattggttgaattcag-actctataagcttgctcctcttctcttctctgac 417  Q
    || || |||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||| | | |||| || ||| ||| ||||||||||||||||    
21188082 caaaattatatactcatgattaaaaaaggttagtcccacccttaccttagattggttaaattctgaattctacaaactttctcttcttctcttctctgac 21187983  T
418 ttctcactttctccc 432  Q
    |||||||||||||||    
21187982 ttctcactttctccc 21187968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 122; E-Value: 3e-62
Query Start/End: Original strand, 263 - 432
Target Start/End: Original strand, 39061268 - 39061437
Alignment:
263 aaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcaccctta 362  Q
    |||||||| |||||||||||||||||||| |||||||||||| ||||||| |||||||||| |||||||||||||||| |||||||||||| ||| ||||    
39061268 aaccctaaattctataacatcaaaactatcaacaactacaaggttaaaccttttttcagaattatatactcatgattacagaaggttagtcccactctta 39061367  T
363 ccttagattggttgaattcagactctataagcttgctcctcttctcttctctgacttctcactttctccc 432  Q
    |||||||| |||||||||||||||||| ||| |||||| |||||||||||||||||||||||||||||||    
39061368 ccttagataggttgaattcagactctacaagtttgctcatcttctcttctctgacttctcactttctccc 39061437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 288 - 447
Target Start/End: Complemental strand, 21243837 - 21243678
Alignment:
288 ctattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcaccctta-ccttagattggttgaattcagact 386  Q
    ||||||||||||||||| |||||||||||||||| | || ||| | ||||||||||||||||||||||||||||| ||||||||| | ||| | | ||||    
21243837 ctattaacaactacaaggttaaaccctttttcaggattacatatttatgattaaagaaggttagtctcacccttacccttagattagatgattccggact 21243738  T
387 ctataagcttgctcctcttctc-ttctctgacttctcactttctccccttttctcccaaaaa 447  Q
    ||| |||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||    
21243737 cta-aagcttgctcctcttctctttctctgacttctcactttct-cccttttctcccaaaaa 21243678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 128 - 453
Target Start/End: Original strand, 8306417 - 8306743
Alignment:
128 aaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaatga 227  Q
    ||||||| || ||||| | |||||||| |||||||  | |||||||| |||||||| |||||| |||||||||||  || |  |||| ||||||||  |     
8306417 aaaaaccaaaatttcatctacccaaatcccaaatttgataggaaacttaacctatgattattcaacaatctgaacaccaattattaccttaattcatcgg 8306516  T
228 attacctactctttcaacaatcaattttgcaattt--aaccctaatttctataacatcaaaactattaacaactaca--agcttaaaccctttttcagaa 323  Q
    ||||||||||||||||||||||||||||  |||||  ||||||||||||||||||||||||||||  || ||| |||  |  |||||||| |||| ||||    
8306517 attacctactctttcaacaatcaatttt--aatttcaaaccctaatttctataacatcaaaactaacaa-aacgacaacatgttaaacccctttttagaa 8306613  T
324 ctata-tactcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctcttctc-ttctctgacttct 421  Q
     ||||  || ||| |||| |||| | ||||| ||| ||||||||||||| | |||  || | |||||  || |||||||||||||| |||||||||||||    
8306614 ttatacaacccattattagagaaagctagtcccactcttaccttagattagatga--tcggtctctacgagattgctcctcttctctttctctgacttct 8306711  T
422 cactttctccccttttctcccaaaaacagttt 453  Q
    ||||||||||| ||||||| ||||| ||||||    
8306712 cactttctccctttttctctcaaaagcagttt 8306743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 209 - 474
Target Start/End: Original strand, 45499434 - 45499701
Alignment:
209 ccttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaacta--ttaacaactacaagct 306  Q
    ||||||||||| |||||   ||||||||||||||||||||||| |||||||||||||||||||||||||||| | |||||||    |||||| ||| | |    
45499434 ccttacgttaaatcaatagtttacctactctttcaacaatcaactttgcaatttaaccctaatttctataacgttaaaactaacaaaacaacaacatg-t 45499532  T
307 taaaccctttttcagaactata-tactcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctctt 405  Q
    ||||||| |||  ||||  |||  || ||| |||| |||| | |||||||||||||||||||||||   ||| | | ||||||| |||||||||||||||    
45499533 taaacccctttatagaatcatacaacccattattagagaaagctagtctcacccttaccttagattatatgattccggactcta-aagcttgctcctctt 45499631  T
406 ctc-ttctctgacttctcactttctccccttttctccc-aaaaacagtttctacgtattctgactttctaa 474  Q
    ||| |||||||||||||||| || || ||||||||||| |||||||||||  ||||||||| | |||||||    
45499632 ctctttctctgacttctcacatt-tctccttttctcccaaaaaacagtttgcacgtattctaattttctaa 45499701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 68; E-Value: 5e-30
Query Start/End: Original strand, 262 - 464
Target Start/End: Complemental strand, 28476840 - 28476625
Alignment:
262 taaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactata-tactcatgattaaagaaggttagtctcaccct 360  Q
    |||||||||||||||||||||||||||||  |||||||||||| |||||||||||||||||| ||||  |||||| |||| ||||   ||||| ||||||    
28476840 taaccctaatttctataacatcaaaactaacaacaactacaaggttaaaccctttttcagaattatacaactcattattagagaaatctagtcccaccct 28476741  T
361 taccttagattggttgaattcagactctataagcttgctcctcttct--------------cttctctgacttctcactttctccccttttctcccaaaa 446  Q
    ||||||||||| | |||   | ||||||  ||| |||||||||||||              ||||||||||||||||||||||||| |||||||||||||    
28476740 taccttagattagatga--ccggactctgcaagattgctcctcttctcacaagattcttcccttctctgacttctcactttctccctttttctcccaaaa 28476643  T
447 acagtttctacgtattct 464  Q
     |||||||||| ||||||    
28476642 gcagtttctacatattct 28476625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 306 - 447
Target Start/End: Complemental strand, 17901856 - 17901714
Alignment:
306 ttaaaccctttttcagaactatata-ctcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctct 404  Q
    |||||||||||||||||| |||| | | ||| |||| |||| | ||||||||||||||||||||| | | ||| | | ||||||| ||||||||||||||    
17901856 ttaaaccctttttcagaattatacaacccattattagagaaagctagtctcacccttaccttagaatagatgattccggactcta-aagcttgctcctct 17901758  T
405 tctctt-ctctgacttctcactttctccccttttctcccaaaaa 447  Q
    |||||| |||||||||||||||||||||| ||||||||||||||    
17901757 tctctttctctgacttctcactttctccctttttctcccaaaaa 17901714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 263 - 368
Target Start/End: Complemental strand, 38887191 - 38887086
Alignment:
263 aaccctaatttctataacatcaaaac-tattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcaccctt 361  Q
    |||||||||| ||| ||||||||||| |||||||||||||||| |||||||||||||||| | || ||||| ||||||||||||||||||| ||||||||    
38887191 aaccctaatt-ctacaacatcaaaacctattaacaactacaagattaaaccctttttcaggattacatacttatgattaaagaaggttagtttcaccctt 38887093  T
362 accttag 368  Q
    |||||||    
38887092 accttag 38887086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 210 - 320
Target Start/End: Original strand, 40390046 - 40390155
Alignment:
210 cttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaa-ctattaacaactacaagctta 308  Q
    |||||||||||||||||  |||||||||||||||||||| || ||  |||| |||||||||| ||| ||||||||||| ||||||||||||||||| |||    
40390046 cttacgttaattcaatggtttacctactctttcaacaattaaatt--caatataaccctaatatctttaacatcaaaacctattaacaactacaaggtta 40390143  T
309 aaccctttttca 320  Q
    ||||||||||||    
40390144 aaccctttttca 40390155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 263 - 368
Target Start/End: Complemental strand, 14792667 - 14792562
Alignment:
263 aaccctaatttctataacatcaaaac-tattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcaccctt 361  Q
    |||||||||| ||| |||||| |||| |||||||||||||||| |||||||||||||||| | || ||||| |||||||||||||||||||| |||||||    
14792667 aaccctaatt-ctacaacatcgaaacctattaacaactacaaggttaaaccctttttcaggattacatacttatgattaaagaaggttagtcccaccctt 14792569  T
362 accttag 368  Q
    |||||||    
14792568 accttag 14792562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 356 - 464
Target Start/End: Original strand, 35895140 - 35895248
Alignment:
356 acccttaccttagattggttgaattcagactctataagcttgctcctcttctc-ttctctgacttctcactttctccccttttctcccaaaaacagtttc 454  Q
    |||| ||||||||||| | ||| |||| |||||| |||||||||||||||||| |||||||||||||| |||||| |||||||||||||||||||||||     
35895140 acccataccttagattagatgatttcaaactctacaagcttgctcctcttctctttctctgacttctctctttct-cccttttctcccaaaaacagtttt 35895238  T
455 tacgtattct 464  Q
     |||||||||    
35895239 cacgtattct 35895248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 258 - 328
Target Start/End: Complemental strand, 24719620 - 24719550
Alignment:
258 aatttaaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactata 328  Q
    ||||||||| ||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||    
24719620 aatttaaccttaatttctataacatcaaaactaataacaactacaaggttaaaccctttttcagaattata 24719550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 272 - 368
Target Start/End: Original strand, 18121559 - 18121656
Alignment:
272 ttctataacatcaaaac-tattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcacccttaccttag 368  Q
    ||||| ||||||||||| |||||||||||||||| ||||| |||||||||| | || ||||| ||||||||||||||||| || ||||||||||||||    
18121559 ttctacaacatcaaaacctattaacaactacaaggttaaatcctttttcaggattacatacttatgattaaagaaggttaatcccacccttaccttag 18121656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 306 - 447
Target Start/End: Original strand, 6834166 - 6834307
Alignment:
306 ttaaaccctttttcagaactatata-ctcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctct 404  Q
    |||||||||||||||||| |||| | ||||| |||| |||| | |||| |||||||| ||||||| | | ||| | | ||||||| ||||||||||||||    
6834166 ttaaaccctttttcagaattatacaactcattattagagaaagctagtatcacccttgccttagaatagatgattccggactcta-aagcttgctcctct 6834264  T
405 tctc-ttctctgacttctcactttctccccttttctcccaaaaa 447  Q
    |||| ||||| ||||||||||||||| |||||||||||||||||    
6834265 tctctttctccgacttctcactttct-cccttttctcccaaaaa 6834307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 126 - 253
Target Start/End: Complemental strand, 29763873 - 29763747
Alignment:
126 ccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaat 225  Q
    |||||| ||| | ||||| |||||||||| |||||||  | |||||||||||| ||||||||||||||| ||| ||| ||| | |||| ||||||||| |    
29763873 ccaaaagccccaatttcatccacccaaatcccaaatttgataggaaactcaacttatgtttattctacagtctaaacttcaattcttatgttaattcatt 29763774  T
226 gaattacctactctttcaacaatcaatt 253  Q
    | |||||||||||||| |||||||||||    
29763773 gtattacctactcttt-aacaatcaatt 29763747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 273 - 367
Target Start/End: Complemental strand, 41225549 - 41225454
Alignment:
273 tctataacatcaaaac-tattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcacccttacctta 367  Q
    |||| ||||||||||| ||||| ||||| |||| |||||||||||||||| | || ||||| |||||||||||||||||||| |||||||||||||    
41225549 tctacaacatcaaaacctattatcaactgcaaggttaaaccctttttcaggattacatacttatgattaaagaaggttagtcccacccttacctta 41225454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 273 - 367
Target Start/End: Complemental strand, 41226802 - 41226707
Alignment:
273 tctataacatcaaaac-tattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcacccttacctta 367  Q
    |||| ||||||||||| ||||| ||||| |||| |||||||||||||||| | || ||||| |||||||||||||||||||| |||||||||||||    
41226802 tctacaacatcaaaacctattatcaactgcaaggttaaaccctttttcaggattacatacttatgattaaagaaggttagtcccacccttacctta 41226707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 126 - 253
Target Start/End: Complemental strand, 46197986 - 46197860
Alignment:
126 ccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaat 225  Q
    |||||| ||| | ||||| | |||||||| |||||||  | ||||||||||||||||||||||||||||  |||||| ||| | |||| ||||||||| |    
46197986 ccaaaagccccaatttcatcaacccaaatcccaaatttgataggaaactcaacctatgtttattctacagcctgaacttcaattcttatgttaattcatt 46197887  T
226 gaattacctactctttcaacaatcaatt 253  Q
    | |||||||||||||| |||||||||||    
46197886 ggattacctactcttt-aacaatcaatt 46197860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 228 - 368
Target Start/End: Original strand, 44892362 - 44892502
Alignment:
228 attacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaac-tattaacaactacaagcttaaaccctttttcagaacta 326  Q
    |||| |||||||||| ||||||||||||    |  |||||||||| ||| || |||||||| |||||||||||||||| ||||| |||||||||  | ||    
44892362 attatctactctttctacaatcaattttagtttcaaaccctaatt-ctacaatatcaaaacctattaacaactacaaggttaaatcctttttcaagatta 44892460  T
327 tatactcatgattaaagaaggttagtctcacccttaccttag 368  Q
     ||||| |||||||||||||||||||| |||||||| |||||    
44892461 catacttatgattaaagaaggttagtcccacccttaacttag 44892502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 263 - 378
Target Start/End: Complemental strand, 20708163 - 20708048
Alignment:
263 aaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactatata-ctcatgattaaagaaggttagtctcaccctt 361  Q
    ||||||||||||| |||||||| || ||| ||||||  |||  |||| ||||||||||||| |||| | |||||| |||||||||||||||| |||||||    
20708163 aaccctaatttctttaacatcacaattatcaacaacatcaaagttaacccctttttcagaattatagaactcatg-ttaaagaaggttagtcccaccctt 20708065  T
362 accttagattggttgaa 378  Q
    |||||||||||| ||||    
20708064 accttagattggatgaa 20708048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 126 - 253
Target Start/End: Original strand, 50001287 - 50001413
Alignment:
126 ccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaat 225  Q
    |||||| ||| | ||||| | |||||||| | |||||  | |||||||||||| |||||||||||||||  |||||| ||| | |||| ||||||||| |    
50001287 ccaaaagccccaatttcatcaacccaaatccaaaatttgataggaaactcaacatatgtttattctacagcctgaacttcaattcttatgttaattcatt 50001386  T
226 gaattacctactctttcaacaatcaatt 253  Q
    |||||||||||||||| |||||||||||    
50001387 gaattacctactcttt-aacaatcaatt 50001413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 262 - 328
Target Start/End: Original strand, 12710813 - 12710879
Alignment:
262 taaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactata 328  Q
    ||||| |||||||||||||||||||||||  |||||||||||| |||||||||||||||||| ||||    
12710813 taaccttaatttctataacatcaaaactaacaacaactacaagattaaaccctttttcagaattata 12710879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 247 - 290
Target Start/End: Original strand, 20588566 - 20588609
Alignment:
247 atcaattttgcaatttaaccctaatttctataacatcaaaacta 290  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
20588566 atcaattttgcaatttaaccctaatttctataacatcaaaacta 20588609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 247 - 290
Target Start/End: Original strand, 20593104 - 20593147
Alignment:
247 atcaattttgcaatttaaccctaatttctataacatcaaaacta 290  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
20593104 atcaattttgcaatttaaccctaatttctataacatcaaaacta 20593147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 381 - 447
Target Start/End: Complemental strand, 22823222 - 22823156
Alignment:
381 cagactctataagcttgctcctcttctctt-ctctgacttctcactttctccccttttctcccaaaaa 447  Q
    |||| |||| |||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||    
22823222 cagaatctacaagcttgctcctcttctctttctctgacttctcactttct-cccttttctcccaaaaa 22823156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 263 - 368
Target Start/End: Complemental strand, 24007330 - 24007224
Alignment:
263 aaccctaatttctataacatcaaaactattaacaactac-aagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcaccctt 361  Q
    ||||||||| ||||||||||||||||||  ||||||||| ||| ||||||| |||||||||| |||| | |||| || | |||| | ||||| |||||||    
24007330 aaccctaatctctataacatcaaaactaacaacaactacaaaggttaaaccttttttcagaattatacaatcattatcagagaaagctagtcccaccctt 24007231  T
362 accttag 368  Q
    |||||||    
24007230 accttag 24007224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 126 - 202
Target Start/End: Original strand, 297167 - 297244
Alignment:
126 ccaaaaacccaatttt-caaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaac 202  Q
    |||||||||||||||| || |||||||||  |||||||  | ||||||||||||||||||||||||||||| ||||||    
297167 ccaaaaacccaatttttcatccacccaaaccccaaatttgataggaaactcaacctatgtttattctacaacctgaac 297244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 170 - 367
Target Start/End: Complemental strand, 22145866 - 22145666
Alignment:
170 aaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaacaat-caattttgcaatttaaccct 268  Q
    |||||| ||||||| ||| |||||||  ||||| ||| |  |||| |||||||| || ||||||||||| ||||||||| |||||||    | ||||| |    
22145866 aaactctacctatgattaatctacaacttgaacatcaattattactttaattcattggattacctactccttcaacaattcaattttaatttctaacctt 22145767  T
269 aatttctataa-catcaaaactattaacaactacaagcttaaaccctttttcagaactata-tactcatgattaaagaaggttagtctcacccttacctt 366  Q
    ||||| | ||| | ||||| |||  |||||||||||| |||||||||||||||||| || |  || ||| |||| |||| ||||||| ||||||||||||    
22145766 aatttatctaatcctcaaacctaacaacaactacaaggttaaaccctttttcagaattaaacaacccattattagagaaagttagtcccacccttacctt 22145667  T
367 a 367  Q
    |    
22145666 a 22145666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 293 - 372
Target Start/End: Original strand, 50544849 - 50544929
Alignment:
293 aacaactacaagcttaaaccctttttcagaactata-tactcatgattaaagaaggttagtctcacccttaccttagattg 372  Q
    |||||||||||| |||||||||||||||||| ||||  || ||| |||| |||| | ||||||||||||||||||||||||    
50544849 aacaactacaaggttaaaccctttttcagaattatacaacccattattagagaaagctagtctcacccttaccttagattg 50544929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 278 - 368
Target Start/End: Complemental strand, 8276079 - 8275988
Alignment:
278 aacatcaaaactattaacaactacaagcttaaaccctttttcagaactata-tactcatgattaaagaaggttagtctcacccttaccttag 368  Q
    |||||||||| ||| |||||||||||| |||||||||||||||||| ||||  |||||| |||| | || | ||||| ||||||||||||||    
8276079 aacatcaaaaatatcaacaactacaaggttaaaccctttttcagaattataccactcattattagataaagctagtcacacccttaccttag 8275988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 128 - 255
Target Start/End: Complemental strand, 21239282 - 21239155
Alignment:
128 aaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaatga 227  Q
    |||| ||||||||||| | |||||||| | |||||  | || |||||| ||||||| ||||||||||| ||||||  || |  |||| ||| ||||  |     
21239282 aaaatcccaattttcatcaacccaaatcctaaatttgatagaaaactctacctatgattattctacaaactgaacaccaattattaccttagttcatcgg 21239183  T
228 attacctactctttcaacaatcaatttt 255  Q
    ||||||||||||||||||||||||||||    
21239182 attacctactctttcaacaatcaatttt 21239155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 278 - 371
Target Start/End: Complemental strand, 38056762 - 38056668
Alignment:
278 aacatcaaaactattaacaactacaagcttaaaccctttttcagaactata-tactcatgattaaagaaggttagtctcacccttaccttagatt 371  Q
    |||||||||||||  |||||||||||| |||||||||||||||||| ||||  || ||| | || |||| | ||||| |||||||||||||||||    
38056762 aacatcaaaactaacaacaactacaaggttaaaccctttttcagaattatacaacccattactagagaaagctagtcccacccttaccttagatt 38056668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 328 - 372
Target Start/End: Complemental strand, 11808230 - 11808186
Alignment:
328 atactcatgattaaagaaggttagtctcacccttaccttagattg 372  Q
    ||||| ||||||||||||||||||||||||||||||||| |||||    
11808230 atacttatgattaaagaaggttagtctcacccttaccttggattg 11808186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 128 - 251
Target Start/End: Complemental strand, 7052252 - 7052129
Alignment:
128 aaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaatga 227  Q
    |||||||||| ||||| | |||||||| ||||||   | |||||||| |||||||| ||||| ||||| ||||||  || |  |||| ||||||||        
7052252 aaaaacccaaatttcatctacccaaatcccaaatatgataggaaacttaacctatgattattttacaacctgaacaccaattattaccttaattcatcag 7052153  T
228 attacctactctttcaacaatcaa 251  Q
    ||||||||||||||||||||||||    
7052152 attacctactctttcaacaatcaa 7052129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 402 - 464
Target Start/End: Original strand, 12710966 - 12711029
Alignment:
402 tcttctcttctctgacttctcactttctccccttttctcccaaaaacag-tttctacgtattct 464  Q
    ||||||||||||||||||||||||||| ||  ||||||||| ||| ||| ||||||||||||||    
12710966 tcttctcttctctgacttctcactttcaccatttttctccctaaagcagttttctacgtattct 12711029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 128 - 251
Target Start/End: Complemental strand, 24723699 - 24723576
Alignment:
128 aaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaatga 227  Q
    |||||||||| |||||   |||||||| |||||||  | |||||||| |||||||| ||||||||||| ||||||  || |  |||| ||||||||        
24723699 aaaaacccaaatttcatttacccaaatcccaaatttgataggaaacttaacctatgattattctacaacctgaacaccaattattaccttaattcatcat 24723600  T
228 attacctactctttcaacaatcaa 251  Q
    ||||| ||||||||||||||||||    
24723599 attacatactctttcaacaatcaa 24723576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 401 - 446
Target Start/End: Complemental strand, 14237622 - 14237577
Alignment:
401 ctcttctcttctctgacttctcactttctccccttttctcccaaaa 446  Q
    |||||||||||||| ||||||||||||||||| |||||||| ||||    
14237622 ctcttctcttctcttacttctcactttctccctttttctccaaaaa 14237577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 401 - 446
Target Start/End: Original strand, 46560163 - 46560208
Alignment:
401 ctcttctcttctctgacttctcactttctccccttttctcccaaaa 446  Q
    |||||||||||||| ||||||||||||||||| |||||||| ||||    
46560163 ctcttctcttctcttacttctcactttctccctttttctccaaaaa 46560208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 147 - 255
Target Start/End: Complemental strand, 17902022 - 17901914
Alignment:
147 acccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaaca 246  Q
    |||||||| |||||||  | || |||||| ||||||| ||||||||||| ||||||  || |  |||| ||| ||||  | |||| ||||||||||||||    
17902022 acccaaatcccaaatttgatagaaaactctacctatgattattctacaacctgaacaccaattattaccttagttcatcggattatctactctttcaaca 17901923  T
247 atcaatttt 255  Q
    |||||||||    
17901922 atcaatttt 17901914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 409 - 453
Target Start/End: Complemental strand, 20846382 - 20846338
Alignment:
409 ttctctgacttctcactttctccccttttctcccaaaaacagttt 453  Q
    ||||||||||||||||||| |||| ||||||||||||| ||||||    
20846382 ttctctgacttctcactttttccctttttctcccaaaagcagttt 20846338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 409 - 453
Target Start/End: Complemental strand, 28193605 - 28193561
Alignment:
409 ttctctgacttctcactttctccccttttctcccaaaaacagttt 453  Q
    |||||||||||||||||||||| | ||||||||||||| ||||||    
28193605 ttctctgacttctcactttctcactttttctcccaaaagcagttt 28193561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 402 - 453
Target Start/End: Complemental strand, 38056641 - 38056589
Alignment:
402 tcttctcttctct-gacttctcactttctccccttttctcccaaaaacagttt 453  Q
    ||||||||||||| | |||||||||||||||| ||||||||||||| ||||||    
38056641 tcttctcttctcttggcttctcactttctccctttttctcccaaaagcagttt 38056589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 470 - 548
Target Start/End: Original strand, 21496788 - 21496863
Alignment:
470 tctaatttgttgtaaccctaattctctaatggtctcatctatttataatcactatctgagtttgtttttcacttaatct 548  Q
    |||| |||||||||||||||||||||||||  |||| ||||||||||| ||| |   |||||||||| |||||||||||    
21496788 tctattttgttgtaaccctaattctctaatcttctc-tctatttataaacacca--agagtttgtttctcacttaatct 21496863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 337 - 368
Target Start/End: Original strand, 42697806 - 42697837
Alignment:
337 attaaagaaggttagtctcacccttaccttag 368  Q
    ||||||||||||||||||||||||||||||||    
42697806 attaaagaaggttagtctcacccttaccttag 42697837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 337 - 368
Target Start/End: Original strand, 45755542 - 45755573
Alignment:
337 attaaagaaggttagtctcacccttaccttag 368  Q
    ||||||||||||||||||||||||||||||||    
45755542 attaaagaaggttagtctcacccttaccttag 45755573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 402 - 440
Target Start/End: Original strand, 22350810 - 22350848
Alignment:
402 tcttctcttctctgacttctcactttctccccttttctc 440  Q
    |||||| |||| |||||||||||||||||||||||||||    
22350810 tcttcttttctttgacttctcactttctccccttttctc 22350848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 128 - 202
Target Start/End: Complemental strand, 23194750 - 23194676
Alignment:
128 aaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaac 202  Q
    ||||| |||| ||||| | ||||||| ||||||||  | |||||||| |||||||| ||||||||||| ||||||    
23194750 aaaaaaccaaatttcatctacccaaactccaaatttgataggaaacttaacctatgattattctacaacctgaac 23194676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 185 - 251
Target Start/End: Complemental strand, 44822312 - 44822246
Alignment:
185 ttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaacaatcaa 251  Q
    ||||||||||| |||||| ||| | | || ||||||||| || ||||||||| ||||||||||||||    
44822312 ttattctacaacctgaacatcaattcatatgttaattcattggattacctacactttcaacaatcaa 44822246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 216 - 286
Target Start/End: Original strand, 22350570 - 22350641
Alignment:
216 ttaattcaatgaattacctactctttcaacaatcaattttgcaatt--taaccctaatttctataacatcaaa 286  Q
    |||||||| |||||||||||| | ||||||||||||  ||||||||   |||||||| |||||||||||||||    
22350570 ttaattcattgaattacctacaccttcaacaatcaa-attgcaattcaaaaccctaacttctataacatcaaa 22350641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 315 - 372
Target Start/End: Original strand, 22350716 - 22350773
Alignment:
315 ttttcagaactatatactcatgattaaagaaggttagtctcacccttaccttagattg 372  Q
    |||||||||  |||||||||  ||||  ||||||||||| ||||||||||||||||||    
22350716 ttttcagaatcatatactcagaattattgaaggttagtcccacccttaccttagattg 22350773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 263 - 323
Target Start/End: Complemental strand, 22823276 - 22823218
Alignment:
263 aaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaa 323  Q
    |||||||| |||||||| ||||||||||| |||||| |||||||  ||||||||| |||||    
22823276 aaccctaacttctataatatcaaaactatcaacaacgacaagct--aacccttttccagaa 22823218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 402 - 439
Target Start/End: Original strand, 51083255 - 51083292
Alignment:
402 tcttctcttctctgacttctcactttctccccttttct 439  Q
    ||||||||||||| ||||||||||||||||| ||||||    
51083255 tcttctcttctcttacttctcactttctccctttttct 51083292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 345 - 377
Target Start/End: Complemental strand, 7320616 - 7320584
Alignment:
345 aggttagtctcacccttaccttagattggttga 377  Q
    ||||||||| |||||||||||||||||||||||    
7320616 aggttagtcccacccttaccttagattggttga 7320584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 325 - 377
Target Start/End: Original strand, 7703132 - 7703184
Alignment:
325 tatatactcatgattaaagaaggttagtctcacccttaccttagattggttga 377  Q
    |||| |||||| |||| |||| | ||||| |||||||||||||||||||||||    
7703132 tataaactcattattagagaaagctagtcccacccttaccttagattggttga 7703184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 298; Significance: 1e-167; HSPs: 48)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 10 - 548
Target Start/End: Complemental strand, 22610622 - 22610081
Alignment:
10 gcgagtagaacactcaccngttgcgagttgatatcgaagtcactcgcaaggcgaacaagatcacccgccgtggtgagcgatgacaaacagttctacggga 109  Q
    ||||||||||||||  || |||||||||||| ||||||||||||||| |||||||||||||||| |||||||| ||||||||||| ||||||||||||||    
22610622 gcgagtagaacacttgcc-gttgcgagttgacatcgaagtcactcgcgaggcgaacaagatcactcgccgtggcgagcgatgacagacagttctacggga 22610524  T
110 agaaatctattttttcccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattc 209  Q
    ||||| || ||||   ||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||    
22610523 agaaacctgttttcagccaaaaacccaattttcaaccacccaaatccaaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattc 22610424  T
210 cttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaactattaacaactacaagcttaa 309  Q
    ||||||||||||||||| |||||||||||||||||||||||||||| ||| |||||| |||||||||||||||||||||||  || ||  ||| | ||||    
22610423 cttacgttaattcaatggattacctactctttcaacaatcaattttacaaattaaccataatttctataacatcaaaactaacaa-aataacatg-ttaa 22610326  T
310 accctttttcagaactata-tactcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctcttctc 408  Q
    |||| |||| ||||  |||  |||||| |||| |||| ||||||| ||||||||||||||||||||||||||| ||| ||| ||||||| ||||||||||    
22610325 acccctttttagaatcatacaactcattattagagaaagttagtcccacccttaccttagattggttgaattcggaccctacaagcttgttcctcttctc 22610226  T
409 ttctctgacttctcactttctccccttttctcccaaaaacagtttctacgtatt-------ctgactttctaatttgttgtaaccctaattctctaatgg 501  Q
    |||||||||||||||||||||||| ||||||||||||| | |||||||||||||       |||||| |||| | |||||||||||||||||||||||||    
22610225 ttctctgacttctcactttctccctttttctcccaaaagcggtttctacgtattctgtatcctgactctctattctgttgtaaccctaattctctaatgg 22610126  T
502 tctcatctatttataatcactatctgagtttgtttttcacttaatct 548  Q
    |||||||||||||||||||||| || |  |||||| |||||||||||    
22610125 tctcatctatttataatcactaactaa--ttgtttctcacttaatct 22610081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 10 - 550
Target Start/End: Original strand, 23883864 - 23884386
Alignment:
10 gcgagtagaacactcaccngttgcgagttgatatcgaagtcactcgcaaggcgaacaagatcacccgccgtggtgagcgatgacaaacagttctacggga 109  Q
    |||||||||||||||||| |||||||||||| ||||| ||||||||  ||| |||||||||||| |||||||| ||||||||||| ||||||||||||||    
23883864 gcgagtagaacactcacc-gttgcgagttgacatcgaggtcactcgtgaggagaacaagatcactcgccgtggcgagcgatgacagacagttctacggga 23883962  T
110 agaaatctattttttc-ccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcatt 208  Q
    | ||| || |||||   ||||||||||||||| |||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||| |||||    
23883963 aaaaacctgtttttcagccaaaaacccaatttgcaaccacccaaatcgcaaattcaaaaggaaactcaacctatgtttattctacaatctgaacttcatt 23884062  T
209 ccttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaacta--ttaacaactacaagct 306  Q
    ||||||||||||||||||| ||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||    || ||| ||| | |    
23884063 ccttacgttaattcaatgatttacctactctttcaacaatcaattgtgtaatttaaccctaatttctataacatcaaaactaacaaaagaacaacatg-t 23884161  T
307 taaaccctttttcagaactata-tactcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctctt 405  Q
    ||||||| |||| ||||  |||  || |||  ||| |||| | ||||| | ||||||||||||||| | ||||||||||||||| ||| |||||||||||    
23884162 taaacccctttttagaatcatacaacccat--ttagagaaagctagtcccgcccttaccttagattagatgaattcagactctacaagtttgctcctctt 23884259  T
406 ctcttctctgacttctcactttctccccttttctcccaaaaacagtttctacgtattctgactttctaatttgttgtaaccctaattctctaatggtctc 505  Q
    |||||||||||||| ||||||||| |||||||||||||||| |||                 ||||||||||||||||||||||||||||||||||||||    
23884260 ctcttctctgacttttcactttct-cccttttctcccaaaagcag-----------------tttctaatttgttgtaaccctaattctctaatggtctc 23884341  T
506 atctatttataatcactatctgagtttgtttttcacttaatctct 550  Q
     ||||||||||||||||| |||||||||||| |||||||||||||    
23884342 gtctatttataatcactaactgagtttgtttctcacttaatctct 23884386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 181; E-Value: 2e-97
Query Start/End: Original strand, 129 - 465
Target Start/End: Original strand, 20879287 - 20879622
Alignment:
129 aaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaatgaa 228  Q
    ||||||| | ||||||||||| | || |||||||  | |||||||   ||||||  ||||||||||| |||||| ||| | |||| ||||||||| || |    
20879287 aaaaccccaatttcaaccaccaacatcccaaatttgacaggaaacattacctattgttattctacaacctgaacatcaattcttatgttaattcattgga 20879386  T
229 ttacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactata 328  Q
    |||||||| |||| |||||||||||| |||||||||| |||| || |||||||||||||| ||||| ||||||||||||||||||||||| ||||| |||    
20879387 ttacctacacttttaacaatcaattt-gcaatttaacactaacttttataacatcaaaaccattaataactacaagcttaaacccttttttagaaccata 20879485  T
329 tactcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctcttctcttctctgacttctcactttc 428  Q
    |||| |||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||||    
20879486 tacttatgattaaagaaggttagtcccacccttaccttagattggttgaattcggactctacaagtttgctcctcttctcttctctgacttctcactttc 20879585  T
429 tccccttttctcccaaaaacagtttctacgtattctg 465  Q
    |||| |||||||||||||  |||||||||||||||||    
20879586 tccctttttctcccaaaagtagtttctacgtattctg 20879622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 109; E-Value: 2e-54
Query Start/End: Original strand, 263 - 601
Target Start/End: Complemental strand, 20517140 - 20516798
Alignment:
263 aaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcaccctta 362  Q
    |||||||| |||| |||||||| || ||| || ||| ||||  ||||||| ||||  |||| |||||||| |||||||||||||||||||| ||||||||    
20517140 aaccctaacttctttaacatcacaattatcaagaacaacaaaattaaaccattttctagaattatatacttatgattaaagaaggttagtcccaccctta 20517041  T
363 ccttagattggttgaattcagact-ctataagcttgctc--------------ctcttctcttctctgacttctcactttctccccttttctcccaaaaa 447  Q
    ||||||||||||| || || || | ||| |||||| | |              |||||||||||||||| |||||||||||||||           ||||    
20517040 ccttagattggttaaactctgaattctacaagctttcccttcttctcacaaagctcttctcttctctgatttctcactttctccc-----------aaaa 20516952  T
448 cagtttctacgtattctgactttctaatttgttgtaaccctaattctctaatggtctcatctatttataatcactatctgagtttgtttttcacttaatc 547  Q
    | |||| ||||| || ||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |||| |||||    
20516951 ctgtttttacgtgttttgactctctattttgttgtaaccctaattctctaatggtctcatctatttataatcaccaactgagtttgtttctcacctaatc 20516852  T
548 tctttgattataaacctacataatcttccttattccaattctacccttatgcct 601  Q
    ||| | ||||||||||||||||||||||||||||||| ||||  ||||||||||    
20516851 tctctcattataaacctacataatcttccttattccagttctgtccttatgcct 20516798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 128 - 281
Target Start/End: Complemental strand, 36732723 - 36732570
Alignment:
128 aaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaatga 227  Q
    |||||||||| ||||  | |||||||| |||||||  | ||||||||  ||||||| ||||||||||||||||||||| ||||||||||||||||||||     
36732723 aaaaacccaaatttcgtctacccaaatcccaaatttgataggaaacttgacctatgattattctacaatctgaacctccttccttacgttaattcaatgg 36732624  T
228 attacctactctttcaacaatcaattttgcaatttaaccctaatttctataaca 281  Q
     ||||||||||||||||||||||||||||||| |||||||||||||| ||||||    
36732623 tttacctactctttcaacaatcaattttgcaaattaaccctaatttcaataaca 36732570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 216 - 550
Target Start/End: Complemental strand, 21678995 - 21678659
Alignment:
216 ttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctt 315  Q
    |||||||| ||||||||||||||||||||| ||| | || |||||| || ||||||| |||||| ||||||||||| |||||||||||  |||||||||     
21678995 ttaattcattgaattacctactctttcaaccatccaatt-gcaattcaaacctaattgctataatatcaaaactatcaacaactacaaagttaaacccta 21678897  T
316 tttcagaactatatactcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagact-ctataagcttgctcctcttctc------ 408  Q
    ||||| || |||| || ||| |||| ||||| | |||| ||||||||||||||||||||| || || || | ||| ||| || | | |||||||          
21678896 tttcataattataaacccattattagagaagct-agtcccacccttaccttagattggttaaactctgaattctacaagttttcccttcttctcacgaag 21678798  T
409 --------ttctctgacttctcactttctccccttttctcccaaaaacagtttctacgtattctgactttctaatttgttgtaaccctaattctctaatg 500  Q
            ||||||||||||||||||||||||           ||||| ||||  |||| |||||||| |||| |||||||||||| ||||| |||||||    
21678797 ctcatatcttctctgacttctcactttctccc-----------aaaactgttttcacgtgttctgactctctattttgttgtaaccgtaattttctaatg 21678709  T
501 gtctcatctatttataatcactatctgagtttgtttttcacttaatctct 550  Q
    ||||||||||||||||||||||| |||||||||||| |||||||||||||    
21678708 gtctcatctatttataatcactaactgagtttgtttctcacttaatctct 21678659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 228 - 408
Target Start/End: Complemental strand, 21579345 - 21579167
Alignment:
228 attacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaac-tattaacaactacaagcttaaaccctttttcagaacta 326  Q
    |||| |||||||||| ||||||||||||    |  |||||||||| ||| ||||||||||| |||||||||||||||| |||||||||||||||| | ||    
21579345 attatctactctttctacaatcaattttagtttcgaaccctaatt-ctacaacatcaaaacatattaacaactacaaggttaaaccctttttcaggatta 21579247  T
327 tatactcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctcttctc 408  Q
     ||||| |||||||||||||||||||| ||||||||||||| ||| | |||  || ||||||| ||| ||||||||||||||    
21579246 catacttatgattaaagaaggttagtcacacccttaccttaaattagatga--tcggactctacaagattgctcctcttctc 21579167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 228 - 377
Target Start/End: Original strand, 22474669 - 22474818
Alignment:
228 attacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaac-tattaacaactacaagcttaaaccctttttcagaacta 326  Q
    |||| |||||||||| ||||||||||||    |  |||||||||| ||| ||||||||||| |||||||||||||||| |||||||||||||||| | ||    
22474669 attatctactctttcgacaatcaattttagtttcaaaccctaatt-ctacaacatcaaaacctattaacaactacaaggttaaaccctttttcaggatta 22474767  T
327 tatactcatgattaaagaaggttagtctcacccttaccttagattggttga 377  Q
     ||||| |||||||||||||||||||| |||||||||||||||||| ||||    
22474768 catacttatgattaaagaaggttagtcccacccttaccttagattgattga 22474818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 68; E-Value: 5e-30
Query Start/End: Original strand, 306 - 447
Target Start/End: Original strand, 22483928 - 22484068
Alignment:
306 ttaaaccctttttcagaactatata-ctcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctct 404  Q
    ||||||||||||| |||| |||| | ||||| |||| |||| ||||||| | | ||||||||||||||||||||||| ||||||| ||||||||||||||    
22483928 ttaaaccctttttaagaattatacaactcattattagagaaagttagtccc-cgcttaccttagattggttgaattcggactcta-aagcttgctcctct 22484025  T
405 tctc-ttctctgacttctcactttctccccttttctcccaaaaa 447  Q
    |||| ||||||||||||||||||||| |||||||||||||||||    
22484026 tctctttctctgacttctcactttct-cccttttctcccaaaaa 22484068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 263 - 453
Target Start/End: Original strand, 22208216 - 22208405
Alignment:
263 aaccctaatttctataacatcaaaac-tattaacaactacaagcttaaaccctttttcagaactata-tactcatgattaaagaaggttagtctcaccct 360  Q
    |||||||||| ||| ||||||||||| |||||||||||||||| |||||||||||||||||| ||||  || ||| |||| |||| | ||||| ||||||    
22208216 aaccctaatt-ctacaacatcaaaacctattaacaactacaaggttaaaccctttttcagaattatacaacccattattagagaaagctagtcccaccct 22208314  T
361 taccttagattggttgaattcagactctataagcttgctcctcttctc-ttctctgacttctcactttctccccttttctcccaaaaacagttt 453  Q
    ||||||||||| | |||  || | |||||  || |||||||||||||| |||| |||||||||||||||| |||||||||||||||| ||||||    
22208315 taccttagattagatga--tcggtctctaccagattgctcctcttctctttctttgacttctcactttct-cccttttctcccaaaagcagttt 22208405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 461 - 550
Target Start/End: Complemental strand, 21676402 - 21676313
Alignment:
461 ttctgactttctaatttgttgtaaccctaattctctaatggtctcatctatttataatcactatctgagtttgtttttcacttaatctct 550  Q
    |||||||| |||| |||||||||||||||||||||||||||| ||||||| |||||||||||| |||||||||||| |||||||||||||    
21676402 ttctgactctctattttgttgtaaccctaattctctaatggtttcatctacttataatcactaactgagtttgtttctcacttaatctct 21676313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 272 - 408
Target Start/End: Complemental strand, 29762964 - 29762829
Alignment:
272 ttctataacatcaaaact-attaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcacccttaccttagat 370  Q
    ||||| |||||||||||| ||||||||||||||| |||||||||||||||| | || ||||| ||||||||||||||||||| |||||||||||||| ||    
29762964 ttctacaacatcaaaacttattaacaactacaaggttaaaccctttttcaggattacatacttatgattaaagaaggttagtttcacccttaccttaaat 29762865  T
371 tggttgaattcagactctataagcttgctcctcttctc 408  Q
    | | |||  || ||||||| ||| |||||| |||||||    
29762864 tagatga--tcggactctacaagattgctcttcttctc 29762829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 209 - 446
Target Start/End: Original strand, 36305898 - 36306140
Alignment:
209 ccttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaactattaacaactacaagctta 308  Q
    ||||||||||||||||||  ||||||||||||||||||||||| ||||||| |||||||||||||||||||   ||||||    |||||| || |  |||    
36305898 ccttacgttaattcaatggtttacctactctttcaacaatcaactttgcaaattaaccctaatttctataa---caaaac----aacaacaaccatttta 36305990  T
309 aaccctttttcagaactatatactcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcc------- 401  Q
    || ||||||||||||  ||| |  | | |||| |||| | ||||||||||||||||||||||| | |||  || ||||||| ||| |||||||           
36305991 aaacctttttcagaatcatacaaccgttattagagaaagctagtctcacccttaccttagattagatga--tcggactctacaagattgctcctcttctc 36306088  T
402 -------tcttctcttctctgacttctcactttctccccttttctcccaaaa 446  Q
           ||||||||||||||||||||||||||||||| |||||||||||||    
36306089 acaagattcttctcttctctgacttctcactttctccctttttctcccaaaa 36306140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 210 - 320
Target Start/End: Original strand, 22966706 - 22966815
Alignment:
210 cttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaa-ctattaacaactacaagctta 308  Q
    |||||||||||||||||| |||||||||||||||||||| || ||  |||| ||||||||||  || ||||||||||| ||||||||||||||||| |||    
22966706 cttacgttaattcaatgatttacctactctttcaacaattaaatt--caatataaccctaatcgctttaacatcaaaacctattaacaactacaaggtta 22966803  T
309 aaccctttttca 320  Q
    ||||||||||||    
22966804 aaccctttttca 22966815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 272 - 409
Target Start/End: Complemental strand, 12037260 - 12037124
Alignment:
272 ttctataacatcaaaa-ctattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcacccttaccttagat 370  Q
    ||||| |||||||||| ||||||||||||||||| |||||||||||||||| | || ||||| ||||||||| |||||||||| ||||||||||||| ||    
12037260 ttctacaacatcaaaagctattaacaactacaaggttaaaccctttttcaggattacatacttatgattaaacaaggttagtcccacccttaccttatat 12037161  T
371 tggttgaattcagactctataagcttgctcctcttctct 409  Q
    | | |||  || |||||||  || |||||||||||||||    
12037160 tagatga--tcggactctacgagattgctcctcttctct 12037124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 349 - 447
Target Start/End: Original strand, 22345198 - 22345296
Alignment:
349 tagtctcacccttaccttagattggttgaattcagactctataagcttgctcctcttctc-ttctctgacttctcactttctccccttttctcccaaaaa 447  Q
    ||||| ||||||||||||||||| | ||| | ||||||||| |||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||    
22345198 tagtcccacccttaccttagattagatgattacagactctacaagcttgctcctcttctctttctctgacttctcactttct-cccttttctcccaaaaa 22345296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 349 - 447
Target Start/End: Original strand, 22356858 - 22356956
Alignment:
349 tagtctcacccttaccttagattggttgaattcagactctataagcttgctcctcttctc-ttctctgacttctcactttctccccttttctcccaaaaa 447  Q
    ||||| ||||||||||||||||| | ||| | ||||||||| |||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||    
22356858 tagtcccacccttaccttagattagatgattacagactctacaagcttgctcctcttctctttctctgacttctcactttct-cccttttctcccaaaaa 22356956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 185 - 370
Target Start/End: Complemental strand, 21676773 - 21676590
Alignment:
185 ttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatca 284  Q
    ||||||||||| |||||| ||| |  |||  |||||||| || ||||||||||||||||||  || | || | ||||||| |||||||||||||| ||||    
21676773 ttattctacaacctgaacatcaatttttatattaattcattggattacctactctttcaaccttccaatt-gaaatttaaacctaatttctataatatca 21676675  T
285 aaactattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcacccttaccttagat 370  Q
    ||||||| |||||||||||  ||||||||| ||||| || |||| || ||| |||| |||| | ||||| ||||||||||||||||    
21676674 aaactatcaacaactacaaagttaaaccctatttcataattataaacccattattagagaa-gctagtcccacccttaccttagat 21676590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 262 - 368
Target Start/End: Complemental strand, 4380723 - 4380616
Alignment:
262 taaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactata-tactcatgattaaagaaggttagtctcaccct 360  Q
    |||||||||||||||||||||||||||||  |||||||||||| |||||||||||||||||| ||||  ||| |  |||| |||| ||||||| ||||||    
4380723 taaccctaatttctataacatcaaaactaacaacaactacaaggttaaaccctttttcagaattatacaacttagaattagagaaagttagtcccaccct 4380624  T
361 taccttag 368  Q
    ||||||||    
4380623 taccttag 4380616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 126 - 253
Target Start/End: Original strand, 16198647 - 16198773
Alignment:
126 ccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaat 225  Q
    |||||| ||| | ||||| | |||||||| |||||||  | ||||||||||||||||||||||||||||  |||||| ||| | |||| ||||||||| |    
16198647 ccaaaagccccaatttcatcaacccaaatcccaaatttgataggaaactcaacctatgtttattctacagcctgaacttcaattcttatgttaattcatt 16198746  T
226 gaattacctactctttcaacaatcaatt 253  Q
    |||||||||||||||| |||||||||||    
16198747 gaattacctactcttt-aacaatcaatt 16198773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 156 - 255
Target Start/End: Original strand, 22483621 - 22483720
Alignment:
156 ccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaacaatcaatttt 255  Q
    |||||||||| ||||||||||||||||||||||||||||| |||||| ||| | |||| |||||||||    ||||||||||||||||||||| ||||||    
22483621 ccaaattcaataggaaactcaacctatgtttattctacaacctgaacatcaattcttatgttaattcatcagattacctactctttcaacaataaatttt 22483720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 147 - 254
Target Start/End: Complemental strand, 25657734 - 25657628
Alignment:
147 acccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaaca 246  Q
    |||||||| |||||||  | ||||||||||||||||||||||||||||  |||||| ||| | |||| ||||||||| ||||||||||||||||| ||||    
25657734 acccaaatcccaaatttgataggaaactcaacctatgtttattctacagcctgaacatcaattcttatgttaattcattgaattacctactcttt-aaca 25657636  T
247 atcaattt 254  Q
    ||||||||    
25657635 atcaattt 25657628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 210 - 318
Target Start/End: Complemental strand, 21697616 - 21697509
Alignment:
210 cttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaa-ctattaacaactacaagctta 308  Q
    |||||||||||||||||  |||||||||||||||||||| || ||  |||| |||||||||| ||| ||||||||||| ||||||||||||||||  |||    
21697616 cttacgttaattcaatggtttacctactctttcaacaattaaatt--caatataaccctaatctctttaacatcaaaacctattaacaactacaatgtta 21697519  T
309 aacccttttt 318  Q
    ||||||||||    
21697518 aacccttttt 21697509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 263 - 368
Target Start/End: Complemental strand, 41680237 - 41680132
Alignment:
263 aaccctaatttctataacatcaaaac-tattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcaccctt 361  Q
    |||||||||| ||| ||||||||||| |||||||||||||||| ||||||||||| |||| | || ||||| |||||||||||||||||||| |||| ||    
41680237 aaccctaatt-ctacaacatcaaaacctattaacaactacaaggttaaaccctttatcaggattacatacttatgattaaagaaggttagtcccaccttt 41680139  T
362 accttag 368  Q
    |||||||    
41680138 accttag 41680132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 262 - 372
Target Start/End: Complemental strand, 18816401 - 18816290
Alignment:
262 taaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactata-tactcatgattaaagaaggttagtctcaccct 360  Q
    |||||||||||||||||||||||||||||  |||||||||||| |||||||||||||||||| ||||  || |||  ||| |||| | ||||| ||||||    
18816401 taaccctaatttctataacatcaaaactaacaacaactacaaggttaaaccctttttcagaattatacaacccatttttagagaaagctagtcccaccct 18816302  T
361 taccttagattg 372  Q
    ||||||| ||||    
18816301 taccttatattg 18816290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 263 - 368
Target Start/End: Complemental strand, 17978520 - 17978415
Alignment:
263 aaccctaatttctataacatcaaaac-tattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcaccctt 361  Q
    |||||||||| ||| ||||||||||| |||||||||||||||| ||||| |||||||||| | || ||||| ||||||| ||||| |||||| |||||||    
17978520 aaccctaatt-ctacaacatcaaaacctattaacaactacaaggttaaatcctttttcaggattacatacttatgattatagaagtttagtcccaccctt 17978422  T
362 accttag 368  Q
    |||||||    
17978421 accttag 17978415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 262 - 367
Target Start/End: Original strand, 21514637 - 21514743
Alignment:
262 taaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactata-tactcatgattaaagaaggttagtctcaccct 360  Q
    |||||||||||||||||||||||||||||  |||||||||||| ||||||||||||| |||| ||||  |||||| |||| ||||   ||||| ||||||    
21514637 taaccctaatttctataacatcaaaactaacaacaactacaaggttaaaccctttttaagaattatacaactcattattagagaaatctagtcccaccct 21514736  T
361 tacctta 367  Q
    |||||||    
21514737 tacctta 21514743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 167 - 250
Target Start/End: Original strand, 23478934 - 23479016
Alignment:
167 aggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaacaatca 250  Q
    ||||||||||||||||||||||||||||  |||||| ||| | |||| ||||||||| ||||||||||||||||| ||||||||    
23478934 aggaaactcaacctatgtttattctacagcctgaacttcaattcttatgttaattcattgaattacctactcttt-aacaatca 23479016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 279 - 377
Target Start/End: Complemental strand, 36405221 - 36405122
Alignment:
279 acatcaaaac-tattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcacccttaccttagattggttga 377  Q
    |||||||||| |||||||||||||||| ||||||||||||   | | || ||||| |||||||||||| ||||||| |||||||||||||||||| ||||    
36405221 acatcaaaacctattaacaactacaaggttaaacccttttcagggattacatacttatgattaaagaaagttagtcacacccttaccttagattgattga 36405122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 19880675 - 19880760
Alignment:
167 aggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaacaatcaatt 253  Q
    ||||||||||||||||||||||||||||  |||||| ||| | |||| ||||||||| | ||||||||||||||| |||||||||||    
19880675 aggaaactcaacctatgtttattctacagcctgaacttcaattcttatgttaattcatttaattacctactcttt-aacaatcaatt 19880760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 26454558 - 26454643
Alignment:
167 aggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaacaatcaatt 253  Q
    ||||||||||||||||||||||||||||  |||||| | | | |||| ||||||||| ||||||||||||||||| |||||||||||    
26454558 aggaaactcaacctatgtttattctacagcctgaactttaattcttatgttaattcattgaattacctactcttt-aacaatcaatt 26454643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 247 - 290
Target Start/End: Original strand, 18834356 - 18834399
Alignment:
247 atcaattttgcaatttaaccctaatttctataacatcaaaacta 290  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
18834356 atcaattttgcaatttaaccctaatttctataacatcaaaacta 18834399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 247 - 290
Target Start/End: Original strand, 21399647 - 21399690
Alignment:
247 atcaattttgcaatttaaccctaatttctataacatcaaaacta 290  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
21399647 atcaattttgcaatttaaccctaatttctataacatcaaaacta 21399690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 247 - 290
Target Start/End: Original strand, 21794140 - 21794183
Alignment:
247 atcaattttgcaatttaaccctaatttctataacatcaaaacta 290  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
21794140 atcaattttgcaatttaaccctaatttctataacatcaaaacta 21794183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 266 - 368
Target Start/End: Complemental strand, 36732514 - 36732411
Alignment:
266 cctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactata-tactcatgattaaagaaggttagtctcacccttacc 364  Q
    ||||||| |||||||||||||||||  |||||||||||| |||||| ||||||||||| ||||  || ||| |||| |||| | ||||| ||||||||||    
36732514 cctaattcctataacatcaaaactaacaacaactacaaggttaaactctttttcagaattatacaacccattattagagaaagctagtcacacccttacc 36732415  T
365 ttag 368  Q
    ||||    
36732414 ttag 36732411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 216 - 378
Target Start/End: Complemental strand, 22708476 - 22708313
Alignment:
216 ttaattcaatgaattacctactctttcaacaatcaattttgcaatttaa--ccctaatttctataacatcaaaactattaacaactacaagcttaaaccc 313  Q
    |||||||| || ||||| ||| ||||||| |||||| || |||||||||  |||||| |||| |||||||| || ||| ||||||  |||  |||  |||    
22708476 ttaattcattgtattacttacactttcaagaatcaaatt-gcaatttaaaaccctaacttctttaacatcacaattatcaacaacatcaaagttagcccc 22708378  T
314 tttttcagaactatata-ctcatgattaaagaaggttagtctcacccttaccttagattggttgaa 378  Q
    ||||| |||| |||| | ||||| ||||||||||||||||| ||||||||||||||||||| ||||    
22708377 ttttttagaattatagaactcat-attaaagaaggttagtcccacccttaccttagattggatgaa 22708313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 263 - 368
Target Start/End: Original strand, 12577826 - 12577932
Alignment:
263 aaccctaatttctataacatcaaaactattaacaacta-caagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcaccctt 361  Q
    ||||||||| ||||||||||||||||||  ||||||||  ||| |||||||||||||| ||| |||| |   || |||| |||| ||||||| |||||||    
12577826 aaccctaatctctataacatcaaaactaacaacaactataaaggttaaaccctttttcggaattatacaactattattagagaaagttagtcccaccctt 12577925  T
362 accttag 368  Q
    |||||||    
12577926 accttag 12577932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 401 - 453
Target Start/End: Complemental strand, 17611262 - 17611210
Alignment:
401 ctcttctcttctctgacttctcactttctccccttttctcccaaaaacagttt 453  Q
    |||||||||||||| |||||||||||| |||| ||||||||||||| ||||||    
17611262 ctcttctcttctcttacttctcactttttccctttttctcccaaaagcagttt 17611210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 281 - 373
Target Start/End: Complemental strand, 21676585 - 21676494
Alignment:
281 atcaaaactattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcacccttaccttagattgg 373  Q
    ||||||||||| |||||||||||  ||||||||| ||||| || |||| || ||| |||| |||| | ||||| |||||||||||||||||||    
21676585 atcaaaactatcaacaactacaaagttaaaccctatttcataattataaacccattattagagaa-gctagtcccacccttaccttagattgg 21676494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 126 - 202
Target Start/End: Complemental strand, 8413989 - 8413912
Alignment:
126 ccaaaaacccaatttt-caaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaac 202  Q
    |||||||||||||||| || |||||||||  |||||||  | |||||||| |||||||| ||||||||||| ||||||    
8413989 ccaaaaacccaatttttcatccacccaaaccccaaatttgataggaaacttaacctatgattattctacaacctgaac 8413912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 272 - 367
Target Start/End: Complemental strand, 22258403 - 22258306
Alignment:
272 ttctataacatcaaaac-tattaacaactacaagcttaaaccctttttcagaactatata-ctcatgattaaagaaggttagtctcacccttacctta 367  Q
    ||||| ||||||||||| ||| ||||||| |||| |||||||||||||  ||| |||| | ||||| |||| |||| | |||||||||||||||||||    
22258403 ttctacaacatcaaaacctatcaacaactgcaaggttaaacccttttttggaattatacaactcattattagagaaagctagtctcacccttacctta 22258306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 401 - 432
Target Start/End: Complemental strand, 21676451 - 21676420
Alignment:
401 ctcttctcttctctgacttctcactttctccc 432  Q
    ||||||||||||||||||||||||||||||||    
21676451 ctcttctcttctctgacttctcactttctccc 21676420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 126 - 202
Target Start/End: Original strand, 19882759 - 19882836
Alignment:
126 ccaaaaacccaatttt-caaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaac 202  Q
    ||||||| |||||||| || |||||||||  |||||||  | |||||||| |||||||| ||||||||||| ||||||    
19882759 ccaaaaagccaatttttcatccacccaaaccccaaatttgataggaaacttaacctatgattattctacaacctgaac 19882836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 126 - 194
Target Start/End: Complemental strand, 14397149 - 14397082
Alignment:
126 ccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctaca 194  Q
    |||||| ||| | ||||| | |||||||| |||||||  | ||||||||||||||||||||||||||||    
14397149 ccaaaagccccaatttcatcaacccaaat-ccaaatttgataggaaactcaacctatgtttattctaca 14397082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 315 - 371
Target Start/End: Complemental strand, 15202358 - 15202302
Alignment:
315 ttttcagaactatatactcatgattaaagaaggttagtctcacccttaccttagatt 371  Q
    |||||||||  ||| ||||| |||||  ||| |||||||||||||||||||||||||    
15202358 ttttcagaatcatagactcaagattattgaatgttagtctcacccttaccttagatt 15202302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 402 - 453
Target Start/End: Original strand, 18834521 - 18834573
Alignment:
402 tcttctcttctct-gacttctcactttctccccttttctcccaaaaacagttt 453  Q
    |||||| |||||| ||||| |||||||||||| ||||||||||||| ||||||    
18834521 tcttcttttctcttgacttatcactttctccctttttctcccaaaagcagttt 18834573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 315 - 367
Target Start/End: Original strand, 20463195 - 20463247
Alignment:
315 ttttcagaactatatactcatgattaaagaaggttagtctcacccttacctta 367  Q
    |||||||||  |||||||||  ||||  |||||||||||||||||||||||||    
20463195 ttttcagaatcatatactcagaattattgaaggttagtctcacccttacctta 20463247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 409 - 453
Target Start/End: Original strand, 39834655 - 39834699
Alignment:
409 ttctctgacttctcactttctccccttttctcccaaaaacagttt 453  Q
    ||||||||||||||| |||||||  ||||||||||||| ||||||    
39834655 ttctctgacttctcattttctccttttttctcccaaaagcagttt 39834699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 263; Significance: 1e-146; HSPs: 70)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 10 - 550
Target Start/End: Complemental strand, 36300997 - 36300458
Alignment:
10 gcgagtagaacactcaccngttgcgagttgatatcgaagtcactcgcaaggcgaacaagatcacccgccgtggtgagcgatgacaaacagttctacggga 109  Q
    |||||||||||||||  | |||||||||||| ||||||||||||||  ||| |||||||||||| |||||| | |||| |||||| ||||||||||||||    
36300997 gcgagtagaacactcgtc-gttgcgagttgacatcgaagtcactcgtgaggtgaacaagatcactcgccgtagcgagcaatgacagacagttctacggga 36300899  T
110 agaaatctattttttcccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaat-ctgaacctcatt 208  Q
    |||||  | ||||   ||||||||||||||||||| ||||||||| | ||||||||||||||||||||||||||||||||||||||| |||||||||| |    
36300898 agaaacttgttttcagccaaaaacccaattttcaatcacccaaatcctaaattcaaaaggaaactcaacctatgtttattctacaattctgaacctcact 36300799  T
209 ccttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaactattaacaactacaagctta 308  Q
    |||||||||||||||||| ||||||||||||||||||| | ||||||||||||||||||||||| ||||| |||||||||||  || ||  ||| | |||    
36300798 ccttacgttaattcaatggattacctactctttcaacagttaattttgcaatttaaccctaattcctatatcatcaaaactaacaa-aataacatg-tta 36300701  T
309 aaccctttttcagaactata-tactcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctcttct 407  Q
    ||||| |||| ||||  |||  || ||| |||| |||| | |||||||||| ||||||||||||| |||||||| || |||| ||| |||||||||||||    
36300700 aacccctttttagaatcatacaacccattattagagaaagctagtctcacctttaccttagattgattgaattcggattctacaagtttgctcctcttct 36300601  T
408 cttctctgacttctcactttctccccttttctcccaaaaacagtttctacgtattctgactttctaatttgttgtaaccctaattctctaatggtctcat 507  Q
    ||||||||||||||||||||||| | || ||  |||||| ||||||||||||||| ||  | |||| |||||||||||||||||||||||||||||||||    
36300600 cttctctgacttctcactttctcactttctccaccaaaagcagtttctacgtattatgtatctctattttgttgtaaccctaattctctaatggtctcat 36300501  T
508 ctatttataatcactatctgagtttgtttttcacttaatctct 550  Q
    |||||||||||||||| |||||||||||| |||||||||||||    
36300500 ctatttataatcactaactgagtttgtttctcacttaatctct 36300458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 177; E-Value: 4e-95
Query Start/End: Original strand, 10 - 432
Target Start/End: Complemental strand, 8931124 - 8930700
Alignment:
10 gcgagtagaacactcaccngttgcgagttgatatcgaagtcactcgcaaggcgaacaagatcacccgccgtggtgagcgatgacaaacagttctacggga 109  Q
    |||||||||||||||  | |||||||||||| ||||||||||||||| |||||||||||||||| |||||||| ||| || |||| ||||||||||||||    
8931124 gcgagtagaacactcgtc-gttgcgagttgacatcgaagtcactcgcgaggcgaacaagatcactcgccgtggcgagtgacgacagacagttctacggga 8931026  T
110 agaaatctattttttcccaaaaacccaatttt-caaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcatt 208  Q
    |||||  | ||||   |||||||| ||||||| |||||||||||||  ||||||||||| ||||||||||||||||||||| ||||||||||| ||||||    
8931025 agaaacatgttttcagccaaaaactcaatttttcaaccacccaaatctcaaattcaaaaagaaactcaacctatgtttattatacaatctgaagctcatt 8930926  T
209 ccttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaacta--ttaacaactacaagct 306  Q
    |||| |||||||||||||  ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    |||||| ||| | |    
8930925 cctttcgttaattcaatggtttacctactctttcaacaatcaattttgcaaattaaccctaatttctataacatcaaaactaacaaaacaacaacatg-t 8930827  T
307 taaaccctttttcagaactata-tactcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctctt 405  Q
    ||||||| |||| ||||  |||  || ||| |||| ||||   ||||| ||||||||||||||||| | ||| | | ||| ||| |||||||||||||||    
8930826 taaacccctttttagaatcatacaacccattattagagaaatgtagtcccacccttaccttagattagatgattccggacgcta-aagcttgctcctctt 8930728  T
406 ctc-ttctctgacttctcactttctccc 432  Q
    ||| |||| |||||||||||||||||||    
8930727 ctctttctttgacttctcactttctccc 8930700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 174; E-Value: 3e-93
Query Start/End: Original strand, 306 - 606
Target Start/End: Original strand, 38299738 - 38300039
Alignment:
306 ttaaaccctttttcagaactatata-ctcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctct 404  Q
    |||||||||||||||||| |||| | | ||| |||| |||| | ||||| ||||||||||||||||| | ||| ||||||||||| ||||||||||||||    
38299738 ttaaaccctttttcagaattatacaacccattattagagaaagctagtcccacccttaccttagattagatgatttcagactctacaagcttgctcctct 38299837  T
405 tctcttctctgacttctcactttctccccttttctcccaaaaacagtttctacgtattctgactttctaatttgttgtaaccctaattctctaatggtct 504  Q
    |||||||||||||||||||||||||||| |||||||||||||   ||||||||||||| || || |||| ||||||||||||||||||||||||||||||    
38299838 tctcttctctgacttctcactttctccctttttctcccaaaagtcgtttctacgtattatggctctctattttgttgtaaccctaattctctaatggtct 38299937  T
505 catctatttataatcactatctgagtttgtttttcacttaatctctttgattataaacctacataatcttccttattccaattctacccttatgcctaat 604  Q
    |||||||||||||||||||  | ||||||||| ||||||||||||| | ||||||||||| |||||||||||||||| ||||||| ||||||||||| ||    
38299938 catctatttataatcactaattaagtttgtttctcacttaatctctctcattataaacctgcataatcttccttatttcaattctgcccttatgcctcat 38300037  T
605 ta 606  Q
    ||    
38300038 ta 38300039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 152; E-Value: 3e-80
Query Start/End: Original strand, 62 - 447
Target Start/End: Original strand, 18570392 - 18570778
Alignment:
62 gaacaagatcacccgccgtggtgagcgatgacaaacagttctacgggaagaaatctattttttcccaaaaacccaattttcaaccacccaaattccaaat 161  Q
    |||||||| ||| |||||| | || || ||||| |||| |||||||||||||| || ||||   ||||||||||||||||||||||||||||| ||||||    
18570392 gaacaagaacactcgccgtagcgaacgctgacagacagctctacgggaagaaacctgttttcagccaaaaacccaattttcaaccacccaaatcccaaat 18570491  T
162 tcaaaaggaaactcaacctatgtttattctacaa-tctgaacctcattccttacgttaattcaatgaattacctactctttcaacaatcaattttgcaat 260  Q
    |||| |||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||  ||||||||||||||||||||||||| | |||     
18570492 tcaagaggaaattcaacctatgtttattctacaattctgaacctcattccttacgttaattcaatg-gttacctactctttcaacaatcaattctacaaa 18570590  T
261 ttaaccctaatttctataacatcaaaactattaacaactaca--agcttaaaccctttttcagaa-ctatatactcatgattaaagaaggttagtctcac 357  Q
    |||||| ||| |||||||||||||||||||  || ||| |||  |  |||||||| |||  |||| ||    || ||| |||| |||| | |||||||||    
18570591 ttaaccataacttctataacatcaaaactaacaa-aacaacaatatgttaaacccctttctagaatcttacaacccattattagagaaagctagtctcac 18570689  T
358 ccttaccttagattggttgaattcagactctataagcttgctcctcttctc-ttctctgacttctcactttctccccttttctcccaaaaa 447  Q
    |||||||||||||||||||||||| ||||||| |||||||| ||||||||| |||||| ||||||||||||| |||||||||| |||||||    
18570690 ccttaccttagattggttgaattcggactcta-aagcttgcccctcttctctttctctaacttctcactttc-ccccttttcttccaaaaa 18570778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 10 - 255
Target Start/End: Original strand, 38295298 - 38295542
Alignment:
10 gcgagtagaacactcaccngttgcgagttgatatcgaagtcactcgcaaggcgaacaagatcacccgccgtggtgagcgatgacaaacagttctacggga 109  Q
    ||||||||||||||| || |||||||||||| ||||||||||||||| |||||||||||||| | || ||||| ||||||||||| |||||||||||||     
38295298 gcgagtagaacactcgcc-gttgcgagttgacatcgaagtcactcgcgaggcgaacaagatccctcgtcgtggggagcgatgacacacagttctacgggg 38295396  T
110 agaaatctattttttcccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattc 209  Q
    ||||   | ||||   ||||||||||||||||||||||||||||| |||||||||| ||||||||| ||||||| ||||||||||  ||||||  || |     
38295397 agaatcttgttttcagccaaaaacccaattttcaaccacccaaatcccaaattcaataggaaactctacctatgattattctacatcctgaacaccaatt 38295496  T
210 cttacgttaattcaatgaattacctactctttcaacaatcaatttt 255  Q
     |||| ||| ||||  | ||||||||||||| ||||||||||||||    
38295497 attaccttacttcatcggattacctactcttgcaacaatcaatttt 38295542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 104; E-Value: 2e-51
Query Start/End: Original strand, 130 - 381
Target Start/End: Complemental strand, 42566069 - 42565819
Alignment:
130 aaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaatgaat 229  Q
    |||||| | ||||||| ||||||||| ||||||  | |||||||   ||||||  ||||||||||| |||||| ||| |   || ||||||||| || ||    
42566069 aaaccccagtttcaactacccaaatttcaaatttgataggaaacattacctattgttattctacaacctgaacatcaatttctatgttaattcattggat 42565970  T
230 tacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaactatat 329  Q
    ||| ||| |||||||||||||| ||| |||||||| ||||| |||||||||| ||||| ||| |||||||||||| |||||||||||||||||| |||||    
42565969 tacgtacactttcaacaatcaaattt-caatttaaacctaacttctataacaacaaaattatcaacaactacaagattaaaccctttttcagaattatat 42565871  T
330 actcatgattaaagaaggttagtctcacccttaccttagattggttgaattc 381  Q
    | | ||||||||||||| |||||||||||||||||||||||||||| |||||    
42565870 atttatgattaaagaagattagtctcacccttaccttagattggttaaattc 42565819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 100; E-Value: 4e-49
Query Start/End: Original strand, 84 - 286
Target Start/End: Complemental strand, 33556379 - 33556187
Alignment:
84 gagcgatgacaaacagttctacgggaagaaatctattttttcccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatg 183  Q
    ||||||||||| ||| ||||||||||||||| || ||||   |||||||||||||||| ||||||||||||||       ||||||||||||||||||||    
33556379 gagcgatgacagacaattctacgggaagaaacctgttttcagccaaaaacccaattttgaaccacccaaattc-------aaaaggaaactcaacctatg 33556287  T
184 tttattctacaatctgaacctcattccttacgttaattcaat-gaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacat 282  Q
    ||||   | | ||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| ||| ||||||||||||||||||||||    
33556286 ttta---tcccatctgaacctcattccttacgttaattcaatggatttacctactctttcaacaatcaatttttcaa-ttaaccctaatttctataacat 33556191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 96; E-Value: 9e-47
Query Start/End: Original strand, 209 - 447
Target Start/End: Complemental strand, 15700892 - 15700656
Alignment:
209 ccttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaactattaacaactacaagctta 308  Q
    |||||||||||||||||   ||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |||||||  |||||||||| | |||    
15700892 ccttacgttaattcaatagtttacctactctttcaacaaccaattttgcaatt-aaccctaatttctataacattaaaactaacaacaactacatg-tta 15700795  T
309 aaccctttttcagaactatata-ctcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctcttct 407  Q
    ||||| |||| ||||| ||| | | ||| |||| |||| | |||| ||| ||||||||||||||   ||| | | ||||||| || ||||||||||||||    
15700794 aacccctttttagaaccatacaacccattattagagaaagctagtatcatccttaccttagattatatgattactgactctacaatcttgctcctcttct 15700695  T
408 cttctctgacttctcactttctccccttttctcccaaaaa 447  Q
    ||||||| |||||||||||||| |||||||||||||||||    
15700694 cttctctaacttctcactttct-cccttttctcccaaaaa 15700656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 84 - 381
Target Start/End: Original strand, 33060208 - 33060504
Alignment:
84 gagcgatgacaaacagttctacgggaagaaatctattttttcccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatg 183  Q
    ||||||||||||| || |||| ||| ||||||| |||||   |||||||||| | || |||| |||||||| |||||||| | | |||||   ||||||     
33060208 gagcgatgacaaatagctctaagggcagaaatcaattttcatccaaaaaccccaattacaactacccaaatcccaaattcgatatgaaacattacctatt 33060307  T
184 tttattctacaatctgaacctcattccttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatc 283  Q
     ||||||||| | |||||| ||| |  |||  |||||||  || ||| ||||| |||||||||||||| || |||||| || ||||| |||||| |||||    
33060308 gttattctacgacctgaacatcaatttttatattaattctttggattgcctacactttcaacaatcaaatt-gcaattcaaacctaacttctattacatc 33060406  T
284 aaaactattaacaactacaagcttaaaccctttttcagaactatatactcatgattaaagaaggttagtctcacccttaccttagattggttgaattc 381  Q
    |||| ||| |||||| ||||  |||||||||||| ||||| |||| |||||||||||||||||||||||| ||||||||||||||||| ||| |||||    
33060407 aaaattataaacaacaacaaaattaaacccttttccagaattatagactcatgattaaagaaggttagtcccacccttaccttagatttgttcaattc 33060504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 125 - 447
Target Start/End: Original strand, 37539258 - 37539580
Alignment:
125 cccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaa 224  Q
    |||||||| |||| ||||| | ||||||||||||||||  | |||||||| |||||| | ||||||||||| |||||   || |  | ||  | |||||     
37539258 cccaaaaatccaaatttcatctacccaaattccaaatttgataggaaacttaacctaagattattctacaacctgaataacaattttcaccatgattcat 37539357  T
225 tgaattacctactctttcaacaatcaattttgcaatt-taaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaa 323  Q
    || ||||||||| |||||||||||||| || | |||| ||| |||||||||  |||||||| || | | |||||| ||||   ||||| | |||||| ||    
37539358 tggattacctacactttcaacaatcaaatt-gaaattctaaacctaatttcattaacatcataatt-tcaacaacaacaatggtaaactccttttcataa 37539455  T
324 ctat-atactcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctcttctc-ttctctgacttct 421  Q
     ||| | ||||||||||| |||| ||||||| ||||||||| ||||||| | ||| | ||||||||| |||||||||||||||||| |||||||||||||    
37539456 ttatgaaactcatgattatagaatgttagtcccacccttactttagattagatgattacagactctacaagcttgctcctcttctctttctctgacttct 37539555  T
422 cactttctccccttttctcccaaaaa 447  Q
    |||||||| | |||||||||||||||    
37539556 cactttct-ctcttttctcccaaaaa 37539580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 209 - 447
Target Start/End: Complemental strand, 13744667 - 13744430
Alignment:
209 ccttacgttaattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaactattaacaactacaagctta 308  Q
    ||||||||||| |||||   |||||| |||||||||| ||||| ||||||| |||||||||||||||||||||| |||| ||  || ||| ||| | |||    
13744667 ccttacgttaaatcaatagtttaccttctctttcaacgatcaactttgcaaattaaccctaatttctataacattaaaaataacaa-aacaacatg-tta 13744570  T
309 aaccctttttcagaactatata-ctcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctcttct 407  Q
    ||||| |||| ||||  ||| | | ||| |||| |||| | ||||| ||||||||||||||||| | ||| | ||||||||| |||||||||||||||||    
13744569 aacccctttttagaatcataaaacccattattagagaaagctagtcccacccttaccttagattagatgattacagactctacaagcttgctcctcttct 13744470  T
408 c-ttctctgacttctcactttctccccttttctcccaaaaa 447  Q
    | |||||| |||||||| ||||| |||||||||||||||||    
13744469 ctttctctaacttctcaatttct-cccttttctcccaaaaa 13744430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 126 - 447
Target Start/End: Complemental strand, 13315322 - 13315002
Alignment:
126 ccaaaaacccaattttcaaccacccaaattccaaattcaaaaggaaactcaacctatgtttattctacaatctgaacctcattccttacgttaattcaat 225  Q
    |||||||||| | ||||| | |||||||| |||||||  | || |||||| ||||||| ||||||||||| ||||||  || |  || | |||||||| |    
13315322 ccaaaaaccccaatttcatcaacccaaatcccaaatttgatagaaaactctacctatgattattctacaacctgaacaccaattatttccttaattcatt 13315223  T
226 gaattacctactctttcaacaatcaattttgcaattt--aaccctaatttctataacatcaaaactattaacaactacaagcttaaaccctttttcagaa 323  Q
    |  |||||||||||||||||||||||||||  |||||  || ||||||||||  |  ||||||| ||  || ||| ||| | |||||||| |||||||||    
13315222 gggttacctactctttcaacaatcaatttt--aatttcaaaacctaatttctcaacaatcaaaattaacaa-aacaacatg-ttaaaccccttttcagaa 13315127  T
324 ctatata-ctcatgattaaagaaggttagtctcacccttaccttagattggttgaattcagactctataagcttgctcctcttctc-ttctctgacttct 421  Q
      ||| | | ||| |||| |||| | ||||||||||||||||||||||| | | | ||||||||||| |||||||||||| ||||| |||||||||||||    
13315126 tcatacaacccattattagagaaagatagtctcacccttaccttagattagattatttcagactctacaagcttgctcctattctctttctctgacttct 13315027  T
422 cactttctccccttttctcccaaaaa 447  Q
    || ||||| |||||||||||||||||    
13315026 cattttct-cccttttctcccaaaaa 13315002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 217 - 406
Target Start/End: Complemental strand, 14161006 - 14160819
Alignment:
217 taattcaatgaattacctactctttcaacaatcaattttgcaatttaaccctaatttctataacatcaaaac-tattaacaactacaagcttaaaccctt 315  Q
    |||||||  |||||| |||||||||| ||||||||||||    |  |||||||||| ||| ||||||||||| |||||||||||||||| |||||||| |