View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9332-LTR4-TNT-insertion-4 (Length: 199)

Name: F9332-LTR4-TNT-insertion-4
Description: F9332-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9332-LTR4-TNT-insertion-4
[»] chr8 (1 HSPs)
chr8 (10-189)||(23088714-23088893)

Alignment Details
Target: chr8 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 10 - 189
Target Start/End: Original strand, 23088714 - 23088893
10 tataacccaacctacatctgaacctgacaacaatgaccatcatctttctctgaatgcaatgaaagggacaaatagtatgggtattttgcgattcacggga 109  Q
23088714 tataacccaacctacatctgaacctgacaacaatgaccatcatctttctctgaatgcaatgaaagggacaaatagtatgggtattttgcgattcacggga 23088813  T
110 cagatcggacacattgatgtgcaagtgctagtagatggaggtagttcagataatttcttgcagccaagagttgctgaatt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
23088814 cagatcggacacattgatgtgcaagtgctagtagatggaggtagttcagataatttcttgcagccaagaattgctgaatt 23088893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 125102 times since January 2019
Visitors: 1439