View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9332-LTR4-TNT-insertion-4 (Length: 199)

Name: F9332-LTR4-TNT-insertion-4
Description: F9332-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9332-LTR4-TNT-insertion-4
F9332-LTR4-TNT-insertion-4
[»] chr8 (1 HSPs)
chr8 (10-189)||(23088714-23088893)


Alignment Details
Target: chr8 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 10 - 189
Target Start/End: Original strand, 23088714 - 23088893
Alignment:
10 tataacccaacctacatctgaacctgacaacaatgaccatcatctttctctgaatgcaatgaaagggacaaatagtatgggtattttgcgattcacggga 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23088714 tataacccaacctacatctgaacctgacaacaatgaccatcatctttctctgaatgcaatgaaagggacaaatagtatgggtattttgcgattcacggga 23088813  T
110 cagatcggacacattgatgtgcaagtgctagtagatggaggtagttcagataatttcttgcagccaagagttgctgaatt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
23088814 cagatcggacacattgatgtgcaagtgctagtagatggaggtagttcagataatttcttgcagccaagaattgctgaatt 23088893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 295304 times since January 2019
Visitors: 3016