View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9332-LTR4-TNT-insertion-7 (Length: 484)

Name: F9332-LTR4-TNT-insertion-7
Description: F9332-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9332-LTR4-TNT-insertion-7
[»] chr3 (64 HSPs)
chr3 (8-474)||(2644036-2644502)
chr3 (23-470)||(2658831-2659277)
chr3 (53-412)||(2476590-2476943)
chr3 (23-470)||(2635650-2636088)
chr3 (53-428)||(9565554-9565924)
chr3 (48-470)||(7324117-7324531)
chr3 (95-428)||(754334-754662)
chr3 (265-428)||(2492262-2492425)
chr3 (258-452)||(2502357-2502551)
chr3 (266-470)||(7333943-7334145)
chr3 (46-413)||(9561726-9562087)
chr3 (46-428)||(2631306-2631683)
chr3 (352-474)||(7318592-7318715)
chr3 (53-413)||(7442718-7443072)
chr3 (53-235)||(7334152-7334334)
chr3 (8-160)||(2502059-2502211)
chr3 (47-172)||(2492032-2492157)
chr3 (48-172)||(9594600-9594724)
chr3 (109-216)||(746315-746422)
chr3 (46-151)||(7430533-7430638)
chr3 (46-360)||(768120-768431)
chr3 (97-159)||(4142123-4142185)
chr3 (94-172)||(7942482-7942560)
chr3 (96-153)||(2442038-2442095)
chr3 (95-151)||(13498222-13498278)
chr3 (97-159)||(3754600-3754662)
chr3 (97-155)||(4157937-4157995)
chr3 (97-153)||(2696727-2696783)
chr3 (95-159)||(9587174-9587238)
chr3 (93-149)||(43991956-43992012)
chr3 (265-320)||(666992-667047)
chr3 (97-172)||(989396-989471)
chr3 (96-159)||(2456248-2456311)
chr3 (101-159)||(3746012-3746070)
chr3 (99-148)||(2459277-2459326)
chr3 (95-148)||(37753345-37753398)
chr3 (97-149)||(1891063-1891115)
chr3 (97-172)||(956381-956456)
chr3 (97-156)||(1940571-1940630)
chr3 (193-228)||(2502280-2502315)
chr3 (345-411)||(9608071-9608138)
chr3 (96-150)||(771497-771551)
chr3 (107-157)||(44001605-44001655)
chr3 (106-159)||(2686301-2686354)
chr3 (99-148)||(7398179-7398228)
chr3 (95-159)||(783788-783852)
chr3 (97-153)||(803213-803269)
chr3 (96-148)||(12133096-12133148)
chr3 (97-156)||(968671-968730)
chr3 (97-156)||(1007461-1007520)
chr3 (97-156)||(1022489-1022548)
chr3 (97-172)||(1931130-1931205)
chr3 (97-148)||(7432054-7432105)
chr3 (97-159)||(792893-792955)
chr3 (97-159)||(2678388-2678450)
chr3 (265-323)||(9594437-9594495)
chr3 (97-151)||(9608341-9608395)
chr3 (93-151)||(37757733-37757791)
chr3 (99-144)||(997578-997623)
chr3 (99-144)||(1013968-1014013)
chr3 (109-162)||(13479590-13479643)
chr3 (95-156)||(14888604-14888665)
chr3 (99-148)||(23197014-23197063)
chr3 (346-374)||(9586959-9586987)
[»] chr4 (5 HSPs)
chr4 (265-428)||(41456255-41456418)
chr4 (101-173)||(20016160-20016232)
chr4 (97-172)||(20019748-20019823)
chr4 (93-158)||(55419778-55419843)
chr4 (100-156)||(22672119-22672175)
[»] scaffold0097 (2 HSPs)
scaffold0097 (368-470)||(34231-34330)
scaffold0097 (268-321)||(34168-34221)
[»] chr5 (17 HSPs)
chr5 (52-151)||(20292950-20293049)
chr5 (341-428)||(20301675-20301763)
chr5 (341-428)||(20306088-20306176)
chr5 (341-428)||(20310492-20310580)
chr5 (52-151)||(20301398-20301497)
chr5 (52-151)||(20305811-20305910)
chr5 (52-151)||(20310215-20310314)
chr5 (97-159)||(11081813-11081875)
chr5 (97-156)||(23766854-23766913)
chr5 (97-156)||(23816702-23816761)
chr5 (341-428)||(20293228-20293316)
chr5 (97-155)||(23769639-23769697)
chr5 (97-155)||(23819487-23819545)
chr5 (96-152)||(2067048-2067104)
chr5 (97-147)||(3181717-3181767)
chr5 (97-159)||(23732167-23732229)
chr5 (97-159)||(23861015-23861077)
[»] scaffold0044 (2 HSPs)
scaffold0044 (57-172)||(89103-89218)
scaffold0044 (268-373)||(89311-89416)
[»] chr2 (10 HSPs)
chr2 (52-150)||(33038115-33038213)
chr2 (52-150)||(33020268-33020366)
chr2 (97-148)||(36577366-36577417)
chr2 (97-148)||(7156192-7156243)
chr2 (97-148)||(7160754-7160805)
chr2 (52-150)||(33026612-33026710)
chr2 (107-148)||(6538844-6538885)
chr2 (97-148)||(7174373-7174424)
chr2 (265-322)||(33020478-33020535)
chr2 (100-148)||(7168690-7168738)
[»] chr7 (4 HSPs)
chr7 (346-428)||(39299222-39299305)
chr7 (96-148)||(1078160-1078212)
chr7 (97-147)||(1421170-1421220)
chr7 (97-174)||(39298977-39299054)
[»] chr6 (6 HSPs)
chr6 (98-157)||(24417477-24417536)
chr6 (99-148)||(19119065-19119114)
chr6 (99-148)||(19126359-19126408)
chr6 (97-148)||(17368366-17368417)
chr6 (93-158)||(176330-176395)
chr6 (100-148)||(370785-370833)
[»] chr1 (6 HSPs)
chr1 (101-159)||(51381444-51381502)
chr1 (97-148)||(51858606-51858657)
chr1 (97-138)||(23896147-23896188)
chr1 (97-146)||(24629213-24629262)
chr1 (103-148)||(51407559-51407604)
chr1 (97-146)||(51782799-51782848)
[»] scaffold1004 (1 HSPs)
scaffold1004 (57-145)||(2103-2191)
[»] scaffold0760 (1 HSPs)
scaffold0760 (57-145)||(4598-4686)

Alignment Details
Target: chr3 (Bit Score: 467; Significance: 0; HSPs: 64)
Name: chr3

Target: chr3; HSP #1
Raw Score: 467; E-Value: 0
Query Start/End: Original strand, 8 - 474
Target Start/End: Complemental strand, 2644502 - 2644036
8 cacctgacttcggggatgaaaataatccgtgggactttggtgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggat 107  Q
2644502 cacctgacttcggggatgaaaataatccgtgggactttggtgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggat 2644403  T
108 tatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttca 207  Q
2644402 tatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttca 2644303  T
208 gaggatgaccaactgttggtggagtgttgtgaaattgagggtgaaactggctatatcaagttggttgtttatgattccaaaactggcacattgaatattc 307  Q
2644302 gaggatgaccaactgttggtggagtgttgtgaaattgagggtgaaactggctatatcaagttggttgtttatgattccaaaactggcacattgaatattc 2644203  T
308 ctgagtttcaaaacaaatatgacctgatatactcaaatgtctacattgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggtta 407  Q
2644202 ctgagtttcaaaacaaatatgacctgatatactcaaatgtctacattgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggtta 2644103  T
408 gtttttgtctgtgttatttatatgttatgcctgctctaattcttgattacttgttagatcattatta 474  Q
2644102 gtttttgtctgtgttatttatatgttatgcctgctctaattcttgattacttgttagatcattatta 2644036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 23 - 470
Target Start/End: Complemental strand, 2659277 - 2658831
23 atgaaaataatccgtgggactttggtgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatgg 122  Q
    ||||||||||| |||||||| | |||||| ||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||    
2659277 atgaaaataattcgtgggacgtgggtgtggtgagggattgcttgtgtgtctttgcaagtagtgatgaatattgggatgtttggattatgaaggagtatgg 2659178  T
123 aaatcaagagtcttggactaaattgtacactattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttcagaggatgaccaactg 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||  |||||  |||||||||||||||||||||||||||||||||     
2659177 aaatcaagagtcttggactaaattgtacactattcctaacctgcaagatcaggatttagaagccgatagagctttatatatttcagaggatgaccaacta 2659078  T
223 ttggtggagtgttgtga-aattgagggtgaaactggctatatcaagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaac 321  Q
    |||||  | |||  | |  |||| || ||||  || | |||| |||||||||||||||||||| ||| |||||||||||||| |||||| ||||| ||||    
2659077 ttggtacaatgtcatcaggattg-ggctgaatgtgacgatatgaagttggttgtttatgattctaaagctggcacattgaattttcctgtgtttcgaaac 2658979  T
322 aaatatgacctgatatactcaaatgtctacattgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggttagtttttgtctgtgt 421  Q
    || ||| | |  | | |  |  | ||||||||||||||| | ||||||||||||||   ||||||||||||||||||||||||||||||||||| |||||    
2658978 aactataaacatacacatgccgaagtctacattgagagtctcatatcaccttaagcattgattcaactgcaacatatatatggttagtttttgtttgtgt 2658879  T
422 tatttatatgttatgcctgctctaattcttgattacttgttagatcatt 470  Q
    ||||||||||||||||||||||| ||| ||| | |||||||||||||||    
2658878 tatttatatgttatgcctgctctgatt-ttggtgacttgttagatcatt 2658831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 53 - 412
Target Start/End: Original strand, 2476590 - 2476943
53 tgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacac 152  Q
    ||||||||||||||||| ||| |||| ||||||||   | | |||||||||||||||||||  | ||||||||| |||||||||||||||||||||||||    
2476590 tgagggattgcttgtgtatctctgcagctagtgatatgtttatggatgtttggattatgaaacactatggaaataaagagtcttggactaaattgtacac 2476689  T
153 tattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttcagaggatgaccaactgttggtggagtgttgtgaaattgagggtgaa 252  Q
    | |||||||| ||||||||| |  |||  |||||   |  |||||||| ||||| |||||||||||||||||||| ||||||  ||| |||||  ||||     
2476690 tgttcctaacatgcaagatcggggtttagaagcctacaatgctttatacatttctgaggatgaccaactgttggtcgagtgtcttgagattgaaagtgac 2476789  T
253 actggctatatcaagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgtctaca 352  Q
    | ||     || |||||||||||||| |||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||||    
2476790 aatg-----at-aagttggttgtttacgattccaaaactggtacttcgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgtctaca 2476883  T
353 ttgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggttagtttt 412  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
2476884 ttgagagtttgatatcaccttaagctgggattcaactccaacatatatatggttagtttt 2476943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 175; E-Value: 5e-94
Query Start/End: Original strand, 23 - 470
Target Start/End: Original strand, 2635650 - 2636088
23 atgaaaataatccgtgggactttggtgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatgg 122  Q
    ||||||||  |||||||  ||| | |||| ||||| ||||| ||||||||||||||||||||||||  | |||||||||||||||||||   ||||||||    
2635650 atgaaaatggtccgtggatcttggatgtgatgaggaattgcatgtgtgtctttgcaactagtgatgtgtttttggatgtttggattatg---gagtatgg 2635746  T
123 aaatcaagagtcttggactaaattgtacactattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttcagaggatgaccaactg 222  Q
    || | |||||||||||||||||||||||| | |||||||| ||||| ||| |  |||  ||| |  || ||||||||||||||| ||||||||||||||     
2635747 aagtgaagagtcttggactaaattgtacagtgttcctaacatgcaacatcggggtttagaagtctataaagctttatatatttctgaggatgaccaacta 2635846  T
223 ttggtggagtgttgtgaaattgagggtgaaactggctatatcaagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaaca 322  Q
     |  || |||||| ||| |||||      || |||  |||| |||||||||||||| |||||||||| ||| || || |||||||| |||||||||||||    
2635847 ctcctgcagtgttatgagattga------aagtggagatatgaagttggttgtttacgattccaaaaatggtactttaaatattcccgagtttcaaaaca 2635940  T
323 aatatgacctgatatactcaaatgtctacattgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggttagtttttgtctgtgtt 422  Q
    | ||||| | ||||||| ||||||||||||||| |||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||    
2635941 actatgaacagatatacccaaatgtctacattgcgagtttgatatcaccttaagttgggattcatctgcaacatatatatggttagtttttgtctgtgtt 2636040  T
423 atttatatgttatgcctgctctaattcttgattacttgttagatcatt 470  Q
    |||||| | ||||||||  ||| ||||||| | |||||||||||||||    
2636041 atttatgtattatgcctaatctgattcttggtgacttgttagatcatt 2636088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 149; E-Value: 2e-78
Query Start/End: Original strand, 53 - 428
Target Start/End: Complemental strand, 9565924 - 9565554
53 tgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacac 152  Q
    |||||| |||||||||||||||||||| |||||||   ||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||     
9565924 tgaggggttgcttgtgtgtctttgcaagtagtgatatgtatatggatgtttggattatgaaggagtacggagatcaagagtcttggactaaattgtacat 9565825  T
153 tattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttcagaggatgaccaactgttggtggagtgttgtgaaattgagggtgaa 252  Q
    | |||||||| | |||||||||  | | ||||||  || ||||||||||||||| || ||||||||||||||||| |||| ||  |||||||      ||    
9565824 tgttcctaacatacaagatcagggtgtcaaagcctataaagctttatatatttctgacgatgaccaactgttggtagagt-ttaagaaattg-----caa 9565731  T
253 actggctatatcaagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgtctaca 352  Q
    | |  |  ||||||||||||||||||||||||||| || || || |||||||||||||||||||||||||| ||| | | | ||  ||||||||||||||    
9565730 agtaacagtatcaagttggttgtttatgattccaagaccggtactttgaatattcctgagtttcaaaacaactataaacaggtagcctcaaatgtctaca 9565631  T
353 ttgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggttagtttttgt-ctgtgttatttat 428  Q
    |||||||||||||||||||||| ||  |||||||| ||||||||  ||||||||||||||| | |||||||||||||    
9565630 ttgagagtttgatatcaccttaggcacggattcaaatgcaacattgatatggttagtttttttactgtgttatttat 9565554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 145; E-Value: 4e-76
Query Start/End: Original strand, 48 - 470
Target Start/End: Complemental strand, 7324531 - 7324117
48 tgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattg 147  Q
    |||| ||||||||||| |  || |||||| |||| |||||   | |||||||||||||||||||||||| || |||||| ||||||||||||||||||||    
7324531 tgtggtgagggattgccttggtctctttggaactggtgatatgtctttggatgtttggattatgaaggactacggaaataaagagtcttggactaaattg 7324432  T
148 tacactattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttcagaggatgaccaactgttggtggagtgttgtgaaattgagg 247  Q
    || | | |||||||| |||||||||    |||  |||||      |||||||| ||||| |||||||||||||| ||||| || |||      ||||||     
7324431 tatagtgttcctaacatgcaagatcgcggtttagaagcctacgatgctttatacatttctgaggatgaccaacttttggtcgattgt------attgaga 7324338  T
248 gtgaaactggctatatcaagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgt 347  Q
     ||||| |||| ||   ||||||||| |||| |||||||||||||| || |||||||||||||||||||||||||| ||||| | ||||| | |||||||    
7324337 ttgaaagtggcaatgataagttggttctttacgattccaaaactggtactttgaatattcctgagtttcaaaacaactatgaacggatatgcccaaatgt 7324238  T
348 ctacattgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggttagtttttgtctgtgttatttatatgttatgcctgctctaat 447  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||  | | ||| ||||||||| ||    
7324237 ctacattgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggttagtttttgtttgtgttgtt--tgttttacgcctgctctgat 7324140  T
448 tcttgattacttgttagatcatt 470  Q
    | ||| | ||||||| |||||||    
7324139 ttttgttgacttgttggatcatt 7324117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 95 - 428
Target Start/End: Complemental strand, 754662 - 754334
95 tggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatcagaatttgaaagccagtagagc 194  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | ||||  || | ||||||||   | | ||| ||  |  | |    
754662 tggatgtttggattatgaaggagtatggagatcaagagtcttggactaaattgtacattgttcccgacatacaagatcatggtctcaaaccctttcaacc 754563  T
195 tttatatatttcagaggatgaccaactgttggtggagtgttgtgaaattgagggtgaaactggctatatcaagttggttgtttatgattccaaaactggc 294  Q
    |||||||||||  ||||||||||||||| || |   || || || ||| || |||| ||      |||||||||||||||||||||||||||| |||||     
754562 tttatatatttatgaggatgaccaactgctgctaaggttttatgcaatggaaggtggaa------atatcaagttggttgtttatgattccaagactggt 754469  T
295 acattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgtctacattgagagtttgatatcaccttaagctgggattcaactgcaac 394  Q
    ||  ||||||||||||||||||||||||| ||||| |  |||  |||| ||||||||||||||||||||||||||||||||||  |||||||||||||||    
754468 actctgaatattcctgagtttcaaaacaactatgaacaaataggctcagatgtctacattgagagtttgatatcaccttaagcaaggattcaactgcaac 754369  T
395 atatatatggttagtttttgt-ctgtgttatttat 428  Q
    ||||| |||||||||||||||  ||||||||||||    
754368 atatacatggttagtttttgtattgtgttatttat 754334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 265 - 428
Target Start/End: Original strand, 2492262 - 2492425
265 aagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgtctacattgagagtttga 364  Q
    ||||||||||||||||||||||| ||||  || ||||||||||| |||||||||||||| ||||| | |  |||||||||||||||||||||||||||||    
2492262 aagttggttgtttatgattccaagactgatactttgaatattccagagtttcaaaacaactatgaaccggaatactcaaatgtctacattgagagtttga 2492361  T
365 tatcaccttaagctgggattcaactgcaacatatatatggttagtttttgtctgtgttatttat 428  Q
    |||||||||||||||||||||||||||  |||||||||||||||||||||| ||||||||||||    
2492362 tatcaccttaagctgggattcaactgcggcatatatatggttagtttttgtgtgtgttatttat 2492425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 111; E-Value: 8e-56
Query Start/End: Original strand, 258 - 452
Target Start/End: Original strand, 2502357 - 2502551
258 ctatatcaagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgtctacattgag 357  Q
    |||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |  | | |  ||| | |||||||||||    
2502357 ctatatcaagtttgttgtttatgattccaaaactggcactttgaatattcctgagtttcaaaacaactatgagcatagagatgcaattttctacattgag 2502456  T
358 agtttgatatcaccttaagctgggattcaactgcaacatatatatggttagtttttgtctgtgttatttatatgttatgcctgctctaattcttg 452  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||||  | | |||||||||||||| ||||||||| | |||||||    
2502457 agtttgatatcaccttaagcatggattcaactgcaacatatatatggttagttttaatttctgttatttatatgtcatgcctgctttgattcttg 2502551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 266 - 470
Target Start/End: Complemental strand, 7334145 - 7333943
266 agttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgtctacattgagagtttgat 365  Q
    ||||||||||||||||| |||||||||| || || ||||| ||||||||||||||||| ||| | |||||| ||||||||||||||||||||||||||||    
7334145 agttggttgtttatgatcccaaaactggtactttaaatatccctgagtttcaaaacaactataaactgatagactcaaatgtctacattgagagtttgat 7334046  T
366 atcaccttaagctgggattcaactgcaacatatatatggttagtttttgtctgtgttatttatatgttatgcctgctctaattcttgattacttgttaga 465  Q
    ||| || |||||||||||||||| |||||||||||||||||||||||| | |||||||||  ||| |||| |||||| | ||| || || ||||||||||    
7334045 atcgccctaagctgggattcaacggcaacatatatatggttagtttttatttgtgttatt--tattttatccctgctttgattattcatgacttgttaga 7333948  T
466 tcatt 470  Q
7333947 tcatt 7333943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 46 - 413
Target Start/End: Complemental strand, 9562087 - 9561726
46 ggtgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaat 145  Q
    |||||| | ||| ||||||||||| |||| || |||||| ||   | ||||||||||||||||||||| |||||||||||||||||||||||||||||||    
9562087 ggtgtgctaaggaattgcttgtgtatcttagctactagtaatttgtttttggatgtttggattatgaatgagtatggaaatcaagagtcttggactaaat 9561988  T
146 tgtacactattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttcagaggatgaccaactgttggtggagtgttgtgaaattga 245  Q
    | |||| | |||||||| ||||||||||   |||  ||||   ||  | |||||||| ||| ||||||||||||||| || | |||| |  ||| ||       
9561987 tatacagtgttcctaacatgcaagatcacggtttagaagcttatactgttttatatagttctgaggatgaccaactgctgctagagtttaatgagat--- 9561891  T
246 gggtgaaactggctatatcaagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaat 345  Q
      | |||  || | |  | |||||||||||||| ||||| || ||||| || |||||||||||||||||||||||||| ||||| | ||||| |  ||||    
9561890 --gcgaag-tgacaaagtgaagttggttgtttacgattctaagactggtactttgaatattcctgagtttcaaaacaactatgatcagatatgccaaaat 9561794  T
346 gtctacattgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggttagttttt 413  Q
     |||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||    
9561793 ttctacattgagagtttgatatcaccttaagcattgattcaactgcaacatatatatggttagttttt 9561726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 46 - 428
Target Start/End: Original strand, 2631306 - 2631683
46 ggtgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaat 145  Q
    |||||| |||| |||| |||||||||||||||||||||||||   | |||| ||||||||||||||||||| ||||||||||||||||||||||||||||    
2631306 ggtgtgctgagtgattacttgtgtgtctttgcaactagtgatatgtttttgaatgtttggattatgaaggaatatggaaatcaagagtcttggactaaat 2631405  T
146 tgtacactattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttcagaggatgaccaactgttggtggagtgttgtgaaattga 245  Q
    ||| || | ||||| || |||| |||||   |||  ||||   |   ||| |||||||||| |||||||| |||||| |  || ||||||  ||  ||||    
2631406 tgtgcagtgttcctgacatgcacgatcacggtttccaagcatctgccgctgtatatatttctgaggatgatcaactgctcttgcagtgttacgagtttga 2631505  T
246 gggtgaaactggctatatcaagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaat 345  Q
      |||      || |    ||||||||||| || |||||||||||||| |  || ||||||| ||||||||||||||| ||||| |  |||| |  |||     
2631506 cagtg------gcgaggagaagttggttgtctacgattccaaaactggtatttttaatattcttgagtttcaaaacaactatgaacatatatcccaaaaa 2631599  T
346 gtctacattgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggttagtttt-tgtctgtgttatttat 428  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| ||| | ||||||||||    
2631600 gtctacattgagagtttaatatcaccttaagctgggattcaactgcaacatatacatggttagttttatgtttatgttatttat 2631683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 352 - 474
Target Start/End: Complemental strand, 7318715 - 7318592
352 attgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggttagt-ttttgtctgtgttatttatatgttatgcctgctctaattct 450  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |||||    
7318715 attgagagtttaatatcaccttaagctgggattcaactgcaacatatatatggttagttttttgtttgtgttatttatatgttatgcctgctctgattct 7318616  T
451 tgattacttgttagatcattatta 474  Q
    |||| |||||||||||||||||||    
7318615 tgatgacttgttagatcattatta 7318592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 53 - 413
Target Start/End: Complemental strand, 7443072 - 7442718
53 tgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacac 152  Q
    ||||||||||||||||||||| || | ||||||||   | |||  |||||||||| ||||||||||||||||||||||||||||||||||| ||||| |     
7443072 tgagggattgcttgtgtgtctatgaagctagtgatttgttttttaatgtttggatcatgaaggagtatggaaatcaagagtcttggactaagttgtatag 7442973  T
153 tattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttcagaggatgaccaactgttggtggagtgttgtgaaattgagggtgaa 252  Q
    | |||||||  ||||| ||| |  ||| ||||||  ||    || |||||| |  ||||||||||||||| || ||| |  |  ||| ||  |      |    
7442972 tgttcctaaaatgcaacatcggcgttttaaagcctatactatttcatatatctatgaggatgaccaactgctgttggggattgttgatatgca------a 7442879  T
253 actggctatatcaagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgtctaca 352  Q
    | | || |||  ||||||| ||||||||||||||| || || || |||||||||||||||||| |||| |  ||||| | ||||||||||||||||||||    
7442878 agtagcaatacaaagttggctgtttatgattccaagacgggtactttgaatattcctgagtttgaaaaaacctatgaaccgatatactcaaatgtctaca 7442779  T
353 ttgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggttagttttt 413  Q
    |||||||||||||||| || |||||||||||||||| ||||||||||||||||||||||||    
7442778 ttgagagtttgatatcgccctaagctgggattcaacggcaacatatatatggttagttttt 7442718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 53 - 235
Target Start/End: Complemental strand, 7334334 - 7334152
53 tgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacac 152  Q
    ||||||||||||||||||||||||| | |||||||  ||||| |||||||||||| |||||||| || |||||| |||||||||||||||||||||||||    
7334334 tgagggattgcttgtgtgtctttgccagtagtgatatatattgggatgtttggatcatgaaggactacggaaataaagagtcttggactaaattgtacac 7334235  T
153 tattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttcagaggatgaccaactgttggtggagtgtt 235  Q
    ||||||||||||| ||||||    |||  |||||  |     |||||||||||||||||||||||||||||||||||||||||    
7334234 tattcctaacctgaaagatcgtggtttagaagccgattctcttttatatatttcagaggatgaccaactgttggtggagtgtt 7334152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 8 - 160
Target Start/End: Original strand, 2502059 - 2502211
8 cacctgacttcggggatgaaaataatccgtgggactttggtgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggat 107  Q
    |||||||||| ||| |||||||||||  |||| | || |||||| | ||||||||||||||||||||||||  |||||||||||||| ||||||||||||    
2502059 cacctgactttgggaatgaaaataattggtggaatttgggtgtgctcagggattgcttgtgtgtctttgcaggtagtgatgaatattgggatgtttggat 2502158  T
108 tatgaaggagtatggaaatcaagagtcttggactaaattgtacactattccta 160  Q
    ||||||||||||||||||| | |||| |||||||||| |||||||||||||||    
2502159 tatgaaggagtatggaaataaggagttttggactaaactgtacactattccta 2502211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 47 - 172
Target Start/End: Original strand, 2492032 - 2492157
47 gtgtgttgagggattgcttgtgtgtctttgcaactagtgat-gaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaat 145  Q
    ||||| ||||||||||||||||||| |||||||||| |||| | || |||| |||||||||||||||||||||||||||||| |||||||||||||||||    
2492032 gtgtgctgagggattgcttgtgtgtttttgcaactattgataggat-tttgaatgtttggattatgaaggagtatggaaatcgagagtcttggactaaat 2492130  T
146 tgtacactattcctaacctgcaagatc 172  Q
    |||| | | |||||||| |||||||||    
2492131 tgtatagtgttcctaacatgcaagatc 2492157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 48 - 172
Target Start/End: Complemental strand, 9594724 - 9594600
48 tgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattg 147  Q
    |||| |||||||||||||||||||||||| ||||||||||   | |||| ||||||||||||||||  |||| |||||| ||||||||||||||||||||    
9594724 tgtgctgagggattgcttgtgtgtctttgaaactagtgatatgtttttgaatgtttggattatgaataagtacggaaatgaagagtcttggactaaattg 9594625  T
148 tacactattcctaacctgcaagatc 172  Q
    | |  | |||||||| |||||||||    
9594624 ttccatgttcctaacatgcaagatc 9594600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 109 - 216
Target Start/End: Complemental strand, 746422 - 746315
109 atgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttcag 208  Q
    ||||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||||  |  ||| | ||||  || || |||||||||||| |    
746422 atgaaggagtatggaaatcaagagtcttggactaaattgtacattgttcctaacctacaagattggggtttcatagcctataaagatttatatatttctg 746323  T
209 aggatgac 216  Q
746322 aggatgac 746315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 46 - 151
Target Start/End: Complemental strand, 7430638 - 7430533
46 ggtgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaat 145  Q
    |||||||||  ||||||||||||  ||||||||| | || |||  | |||||||||||||||||||||| ||||||||||| || |||||| ||||||||    
7430638 ggtgtgttgtaggattgcttgtgcatctttgcaagttgtcatgggtttttggatgtttggattatgaagaagtatggaaataaaaagtcttagactaaat 7430539  T
146 tgtaca 151  Q
7430538 tgtaca 7430533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 46 - 360
Target Start/End: Complemental strand, 768431 - 768120
46 ggtgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaat 145  Q
    |||||||||||||||||||||||||| ||||  ||||||||    | |||  |||||||||||||||| ||||| |||||| ||||||||||||||||||    
768431 ggtgtgttgagggattgcttgtgtgtatttgacactagtgaaatgttttttaatgtttggattatgaatgagtacggaaatgaagagtcttggactaaat 768332  T
146 tgtacactattcctaacctgcaagatcagaa---tttgaaagccagtagagctttatatatttcagaggatgaccaactgttggtggagtgttgtgaaat 242  Q
    ||| |  | |||||||  | ||  ||||  |   | | |  |||  || ||||||||||||||  ||||||||  ||||| ||||||||| ||      |    
768331 tgttccatgttcctaaagttcacaatcatcagggtctcagggcctataaagctttatatatttttgaggatgagaaactgctggtggagtttt------t 768238  T
243 tgagggtgaaactggctatatcaagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactca 342  Q
    | | | ||||||| || |||  |||||||||||||| |||||||||||||  || || ||||||| ||||||||||||||| ||||  | |||  || ||    
768237 ttatgttgaaacttgcgataggaagttggttgtttacgattccaaaactgctacttttaatattcttgagtttcaaaacaactatgctcagatgaaccca 768138  T
343 aatgtctacattgagagt 360  Q
    || |||||||||||||||    
768137 aaagtctacattgagagt 768120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 159
Target Start/End: Complemental strand, 4142185 - 4142123
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    ||||||||| |||||||||| ||||||||| ||||||||||||||||||||| ||||||||||    
4142185 gatgtttggcttatgaaggaatatggaaataaagagtcttggactaaattgttcactattcct 4142123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 94 - 172
Target Start/End: Original strand, 7942482 - 7942560
94 ttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatc 172  Q
    ||||||||||||||||||||||||||||| ||| |||||||||||| ||||||||||| | ||||| || || ||||||    
7942482 ttggatgtttggattatgaaggagtatggtaataaagagtcttggattaaattgtacaatgttccttacatggaagatc 7942560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 96 - 153
Target Start/End: Original strand, 2442038 - 2442095
96 ggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacact 153  Q
    ||||||||||||||||||||||||||||||| |||| |||||||||||||||| ||||    
2442038 ggatgtttggattatgaaggagtatggaaataaagattcttggactaaattgttcact 2442095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 95 - 151
Target Start/End: Original strand, 13498222 - 13498278
95 tggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtaca 151  Q
    |||||||||||||||||||||| ||||||||| ||||||||||||||||||| ||||    
13498222 tggatgtttggattatgaaggaatatggaaataaagagtcttggactaaattataca 13498278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 97 - 159
Target Start/End: Original strand, 3754600 - 3754662
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    ||||||||| |||||||||| ||||||||| |||||||||||||||||||||  |||||||||    
3754600 gatgtttgggttatgaaggaatatggaaataaagagtcttggactaaattgtttactattcct 3754662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 97 - 155
Target Start/End: Complemental strand, 4157995 - 4157937
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactat 155  Q
    ||||||||| |||||||||| ||||||||| ||||||||||||||||||||| ||||||    
4157995 gatgtttggcttatgaaggaatatggaaataaagagtcttggactaaattgttcactat 4157937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 97 - 153
Target Start/End: Complemental strand, 2696783 - 2696727
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacact 153  Q
    |||||||||||||||||||| ||||||||| |||||||||||| |||||||| ||||    
2696783 gatgtttggattatgaaggaatatggaaataaagagtcttggattaaattgttcact 2696727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 95 - 159
Target Start/End: Complemental strand, 9587238 - 9587174
95 tggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    |||| ||||||||||||||||| ||||||||| ||||| ||||||| |||||||||| |||||||    
9587238 tggaggtttggattatgaaggaatatggaaataaagagccttggacaaaattgtacaatattcct 9587174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 93 - 149
Target Start/End: Original strand, 43991956 - 43992012
93 tttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgta 149  Q
    |||||||||||||||||||||||| |||||||||  |||||||||||| ||||||||    
43991956 tttggatgtttggattatgaaggaatatggaaatatagagtcttggaccaaattgta 43992012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 265 - 320
Target Start/End: Complemental strand, 667047 - 666992
265 aagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaa 320  Q
    ||||||||||||||||||||||| ||| | || |||||||||||||||||||||||    
667047 aagttggttgtttatgattccaagactagtactttgaatattcctgagtttcaaaa 666992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 172
Target Start/End: Original strand, 989396 - 989471
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatc 172  Q
    ||||||||| | ||||| ||||| |||||| ||||||||||||||||||||| ||||||| || || |||||||||    
989396 gatgtttgggtaatgaaagagtacggaaataaagagtcttggactaaattgttcactatttcttacatgcaagatc 989471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 96 - 159
Target Start/End: Original strand, 2456248 - 2456311
96 ggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    |||||||||| |||||||||| ||||||||| |||| ||||||||||||||||||  |||||||    
2456248 ggatgtttgggttatgaaggaatatggaaataaagactcttggactaaattgtaccatattcct 2456311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 101 - 159
Target Start/End: Original strand, 3746012 - 3746070
101 tttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    |||||||||||||||| |||| ||| ||||||||||||||||||||||  |||||||||    
3746012 tttggattatgaaggaatatgcaaagcaagagtcttggactaaattgttgactattcct 3746070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 99 - 148
Target Start/End: Original strand, 2459277 - 2459326
99 tgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    |||||||||||||||||| ||||||||| ||||||||||||| |||||||    
2459277 tgtttggattatgaaggaatatggaaataaagagtcttggacaaaattgt 2459326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 95 - 148
Target Start/End: Complemental strand, 37753398 - 37753345
95 tggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    ||||||||||||||||| |||| ||||||||  |||||||||||||||||||||    
37753398 tggatgtttggattatggaggaatatggaaagaaagagtcttggactaaattgt 37753345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 97 - 149
Target Start/End: Complemental strand, 1891115 - 1891063
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgta 149  Q
    ||||||||||||||||||||  |||||||| |||| |||||||||||||||||    
1891115 gatgtttggattatgaaggaacatggaaataaagactcttggactaaattgta 1891063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 97 - 172
Target Start/End: Original strand, 956381 - 956456
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatc 172  Q
    |||||||||||||||||||| ||||||||  |||||||||||  |||||||| || |||| || || |||||||||    
956381 gatgtttggattatgaaggaatatggaaaaaaagagtcttggcataaattgttcattatttctcacatgcaagatc 956456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 97 - 156
Target Start/End: Complemental strand, 1940630 - 1940571
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactatt 156  Q
    ||||||||| ||||||||||  ||||||||||||| || ||||||||||||| |||||||    
1940630 gatgtttgggttatgaaggaacatggaaatcaagactcgtggactaaattgttcactatt 1940571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 193 - 228
Target Start/End: Original strand, 2502280 - 2502315
193 gctttatatatttcagaggatgaccaactgttggtg 228  Q
2502280 gctttatatatttcagaggatgaccaactgttggtg 2502315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 345 - 411
Target Start/End: Complemental strand, 9608138 - 9608071
345 tgtctacattgagagtttgatatcaccttaagc-tgggattcaactgcaacatatatatggttagttt 411  Q
    ||||||||  ||||||||||||||||||||||| || ||||||| ||| |||||||||| ||||||||    
9608138 tgtctacaacgagagtttgatatcaccttaagcatgagattcaagtgctacatatatattgttagttt 9608071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 96 - 150
Target Start/End: Complemental strand, 771551 - 771497
96 ggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtac 150  Q
    |||||||||| |||||||||| |||||||||  ||| ||||||||||||||||||    
771551 ggatgtttgggttatgaaggaatatggaaatacagactcttggactaaattgtac 771497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 107 - 157
Target Start/End: Original strand, 44001605 - 44001655
107 ttatgaaggagtatggaaatcaagagtcttggactaaattgtacactattc 157  Q
    |||||||||| ||||||| | ||||||||||||||||| ||||||||||||    
44001605 ttatgaaggaatatggaattaaagagtcttggactaaactgtacactattc 44001655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 106 - 159
Target Start/End: Complemental strand, 2686354 - 2686301
106 attatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    ||||||||||| ||||||||  |||||||||||| |||||||| ||||||||||    
2686354 attatgaaggaatatggaaaaaaagagtcttggaataaattgttcactattcct 2686301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 99 - 148
Target Start/End: Complemental strand, 7398228 - 7398179
99 tgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    ||||||| | |||||||||||||||||| |||||||||||| ||||||||    
7398228 tgtttggttgatgaaggagtatggaaatgaagagtcttggattaaattgt 7398179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 95 - 159
Target Start/End: Complemental strand, 783852 - 783788
95 tggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    |||||||||||||||||||||| |||||||||  | || | |||||||||||||| ||| |||||    
783852 tggatgtttggattatgaaggaatatggaaatacaaagccatggactaaattgtatactgttcct 783788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 97 - 153
Target Start/End: Complemental strand, 803269 - 803213
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacact 153  Q
    ||||||||| ||||||| || ||||||||| |||||||||||||||| |||| ||||    
803269 gatgtttgggttatgaaagaatatggaaataaagagtcttggactaagttgttcact 803213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 96 - 148
Target Start/End: Original strand, 12133096 - 12133148
96 ggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    |||||||||| |||||| |||||||||||||  |||||| |||||||||||||    
12133096 ggatgtttgggttatgagggagtatggaaatagagagtcgtggactaaattgt 12133148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 97 - 156
Target Start/End: Original strand, 968671 - 968730
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactatt 156  Q
    ||||||||| ||||||||||  |||||||| ||||||| ||||||||||| | |||||||    
968671 gatgtttgggttatgaaggaacatggaaataaagagtcatggactaaattattcactatt 968730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 97 - 156
Target Start/End: Original strand, 1007461 - 1007520
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactatt 156  Q
    ||||||||| | |||||||| ||||||||| | ||||| ||||||||||||| |||||||    
1007461 gatgtttgggtaatgaaggaatatggaaataacgagtcctggactaaattgttcactatt 1007520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 97 - 156
Target Start/End: Original strand, 1022489 - 1022548
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactatt 156  Q
    ||||||||| | |||||||| ||||||||| | ||||| ||||||||||||| |||||||    
1022489 gatgtttgggtaatgaaggaatatggaaataacgagtcatggactaaattgttcactatt 1022548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 97 - 172
Target Start/End: Complemental strand, 1931205 - 1931130
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatc 172  Q
    ||||||||| |||||| |||  |||||||| |||| || ||||||||||||| ||||||| || || |||||||||    
1931205 gatgtttgggttatgatggaacatggaaataaagactcctggactaaattgttcactatttcttacatgcaagatc 1931130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 97 - 148
Target Start/End: Complemental strand, 7432105 - 7432054
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    |||||||||| ||||||||| ||||||||| |||| || |||||||||||||    
7432105 gatgtttggagtatgaaggaatatggaaataaagaatcgtggactaaattgt 7432054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 97 - 159
Target Start/End: Complemental strand, 792955 - 792893
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    |||||||||||||||||||||||||| ||  | || ||||||| |||||| | ||||||||||    
792955 gatgtttggattatgaaggagtatggtaaagaggaatcttggagtaaattattcactattcct 792893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 97 - 159
Target Start/End: Complemental strand, 2678450 - 2678388
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    ||||||||| |||||||  | ||||||||  ||||||| ||||||||||||| ||||||||||    
2678450 gatgtttgggttatgaaacaatatggaaaaaaagagtcatggactaaattgttcactattcct 2678388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 265 - 323
Target Start/End: Complemental strand, 9594495 - 9594437
265 aagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaa 323  Q
    ||||||| |||||| |||||||||||||  || || ||||||| |||||||||||||||    
9594495 aagttggctgtttacgattccaaaactgttacttttaatattcttgagtttcaaaacaa 9594437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 97 - 151
Target Start/End: Complemental strand, 9608395 - 9608341
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtaca 151  Q
    ||||||||| |||||||||| |||||||||  ||| |||||||||||||| ||||    
9608395 gatgtttgggttatgaaggaatatggaaatatagattcttggactaaattataca 9608341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 93 - 151
Target Start/End: Complemental strand, 37757791 - 37757733
93 tttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtaca 151  Q
    ||||||| | |||||||||||||| ||||||||  ||||||||||||| || |||||||    
37757791 tttggatatatggattatgaaggaatatggaaacaaagagtcttggacgaagttgtaca 37757733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 99 - 144
Target Start/End: Original strand, 997578 - 997623
99 tgtttggattatgaaggagtatggaaatcaagagtcttggactaaa 144  Q
    ||||||| | |||||||| ||||||||| |||||||||||||||||    
997578 tgtttgggtaatgaaggaatatggaaataaagagtcttggactaaa 997623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 99 - 144
Target Start/End: Original strand, 1013968 - 1014013
99 tgtttggattatgaaggagtatggaaatcaagagtcttggactaaa 144  Q
    ||||||| | |||||||| ||||||||| |||||||||||||||||    
1013968 tgtttgggtaatgaaggaatatggaaataaagagtcttggactaaa 1014013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 162
Target Start/End: Original strand, 13479590 - 13479643
109 atgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaac 162  Q
    ||||| || ||||||| ||||||||||||||| ||||||| ||||||| |||||    
13479590 atgaaagaatatggaattcaagagtcttggacaaaattgttcactatttctaac 13479643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 95 - 156
Target Start/End: Complemental strand, 14888665 - 14888604
95 tggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactatt 156  Q
    |||| |||||||||||||| || |||| |||| ||||| ||| |||||||||||||| ||||    
14888665 tggaggtttggattatgaatgaatatgaaaataaagagccttagactaaattgtacaatatt 14888604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 99 - 148
Target Start/End: Original strand, 23197014 - 23197063
99 tgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    ||||||| | |||||||| ||||||||| |||| ||||||||||||||||    
23197014 tgtttggctgatgaaggaatatggaaatgaagaatcttggactaaattgt 23197063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 346 - 374
Target Start/End: Complemental strand, 9586987 - 9586959
346 gtctacattgagagtttgatatcacctta 374  Q
9586987 gtctacattgagagtttgatatcacctta 9586959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 72; Significance: 1e-32; HSPs: 5)
Name: chr4

Target: chr4; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 265 - 428
Target Start/End: Original strand, 41456255 - 41456418
265 aagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgtctacattgagagtttga 364  Q
    ||||||||||||||||||| ||| | ||| || |||||||||||||||||||||||||| ||||| | || | || | ||| |||||||||||||||| |    
41456255 aagttggttgtttatgatttcaagattggtactttgaatattcctgagtttcaaaacaactatgaacggacagaccctaatatctacattgagagtttaa 41456354  T
365 tatcaccttaagctgggattcaactgcaacatatatatggttagtttttgtctgtgttatttat 428  Q
    |||||||||||||  | |||||| |||||| |  ||||||||| ||||||| ||||||||||||    
41456355 tatcaccttaagcacgaattcaaatgcaacgttgatatggttaatttttgtttgtgttatttat 41456418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 101 - 173
Target Start/End: Complemental strand, 20016232 - 20016160
101 tttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatca 173  Q
    ||||||| |||||||| ||||||| ||||||||||||||||||||||| |||| || ||||| ||||||||||    
20016232 tttggatcatgaaggaatatggaattcaagagtcttggactaaattgttcactctttctaacatgcaagatca 20016160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 97 - 172
Target Start/End: Complemental strand, 20019823 - 20019748
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatc 172  Q
    ||||||||| | |||||||| ||||||| ||||||||||||||||||||||| |||| || ||||| |||||||||    
20019823 gatgtttgggtcatgaaggaatatggaattcaagagtcttggactaaattgttcactctttctaacatgcaagatc 20019748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 93 - 158
Target Start/End: Original strand, 55419778 - 55419843
93 tttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcc 158  Q
    ||||||| | ||| |||||||||  ||||||||| |||| ||||||||||||||||  ||||||||    
55419778 tttggatatctggcttatgaaggtttatggaaataaagattcttggactaaattgtttactattcc 55419843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 100 - 156
Target Start/End: Complemental strand, 22672175 - 22672119
100 gtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactatt 156  Q
    |||||| | |||||||| ||||||||| | || |||||||||||||||| |||||||    
22672175 gtttgggtaatgaaggaatatggaaataaggaatcttggactaaattgttcactatt 22672119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0097 (Bit Score: 56; Significance: 5e-23; HSPs: 2)
Name: scaffold0097

Target: scaffold0097; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 368 - 470
Target Start/End: Original strand, 34231 - 34330
368 caccttaagctgggattcaactgcaacatatatatggttagtttttgtctgtgttatttatatgttatgcctgctctaattcttgattacttgttagatc 467  Q
    ||||||||||  |||||||||||||||||||||||||||||||||||| |||||||||  ||||||||||||||||| ||| ||| | ||||||| ||||    
34231 caccttaagcatggattcaactgcaacatatatatggttagtttttgtttgtgttatt--tatgttatgcctgctctgatt-ttggtgacttgtttgatc 34327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0097; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 34168 - 34221
268 ttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaac 321  Q
    ||||||||||||||| ||||||||||||| | |||||||||| |||||||||||    
34168 ttggttgtttatgataccaaaactggcacttcgaatattcctcagtttcaaaac 34221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 52; Significance: 1e-20; HSPs: 17)
Name: chr5

Target: chr5; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 52 - 151
Target Start/End: Original strand, 20292950 - 20293049
52 ttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtaca 151  Q
    |||||||||||||||||  ||| || ||||||||||    ||||||||||||||||||||||||| ||||||| | ||||||||||||||||||| ||||    
20292950 ttgagggattgcttgtgcatctatgtaactagtgatctggatttggatgtttggattatgaaggaatatggaattaaagagtcttggactaaattataca 20293049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 341 - 428
Target Start/End: Original strand, 20301675 - 20301763
341 caaatgtctacattgagagtttgatatcaccttaagc-tgggattcaactgcaacatatatatggttagtttttgtctgtgttatttat 428  Q
    |||| ||||||||||||||||| |||||||||||||| || || ||| |||||||||| ||||||||||||| ||| ||||||||||||    
20301675 caaaagtctacattgagagtttaatatcaccttaagcatgagactcagctgcaacatagatatggttagtttctgtttgtgttatttat 20301763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 341 - 428
Target Start/End: Original strand, 20306088 - 20306176
341 caaatgtctacattgagagtttgatatcaccttaagc-tgggattcaactgcaacatatatatggttagtttttgtctgtgttatttat 428  Q
    |||| ||||||||||||||||| |||||||||||||| || || ||| |||||||||| ||||||||||||| ||| ||||||||||||    
20306088 caaaagtctacattgagagtttaatatcaccttaagcatgagactcagctgcaacatagatatggttagtttctgtttgtgttatttat 20306176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 341 - 428
Target Start/End: Original strand, 20310492 - 20310580
341 caaatgtctacattgagagtttgatatcaccttaagc-tgggattcaactgcaacatatatatggttagtttttgtctgtgttatttat 428  Q
    |||| ||||||||||||||||| |||||||||||||| || || ||| |||||||||| ||||||||||||| ||| ||||||||||||    
20310492 caaaagtctacattgagagtttaatatcaccttaagcatgagactcagctgcaacatagatatggttagtttctgtttgtgttatttat 20310580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 52 - 151
Target Start/End: Original strand, 20301398 - 20301497
52 ttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtaca 151  Q
    |||||||||||||||||  ||| || ||||||||||    ||||||||||||||||||||||||| |||| || | ||||||||||||||||||| ||||    
20301398 ttgagggattgcttgtgcatctatgtaactagtgatctggatttggatgtttggattatgaaggaatatgcaattaaagagtcttggactaaattataca 20301497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 52 - 151
Target Start/End: Original strand, 20305811 - 20305910
52 ttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtaca 151  Q
    |||||||||||||||||  ||| || ||||||||||    |||||||||| |||||||||||||| ||||||| | ||||||||||||||||||| ||||    
20305811 ttgagggattgcttgtgcatctatgtaactagtgatctggatttggatgtctggattatgaaggaatatggaattaaagagtcttggactaaattataca 20305910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 52 - 151
Target Start/End: Original strand, 20310215 - 20310314
52 ttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtaca 151  Q
    |||||||||||||||||  ||| || ||||||||||    |||||||||| |||||||||||||| ||||||| | ||||||||||||||||||| ||||    
20310215 ttgagggattgcttgtgcatctatgtaactagtgatctggatttggatgtctggattatgaaggaatatggaattaaagagtcttggactaaattataca 20310314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 159
Target Start/End: Original strand, 11081813 - 11081875
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    ||||||||| |||||||||||||||||||| |||||||||||||||||||||  |||||||||    
11081813 gatgtttgggttatgaaggagtatggaaataaagagtcttggactaaattgtttactattcct 11081875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 97 - 156
Target Start/End: Complemental strand, 23766913 - 23766854
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactatt 156  Q
    ||||||||||||||||| || ||||||||| ||||||||||||||||||||| |||||||    
23766913 gatgtttggattatgaaagaatatggaaataaagagtcttggactaaattgttcactatt 23766854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 97 - 156
Target Start/End: Complemental strand, 23816761 - 23816702
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactatt 156  Q
    ||||||||||||||||| || ||||||||| ||||||||||||||||||||| |||||||    
23816761 gatgtttggattatgaaagaatatggaaataaagagtcttggactaaattgttcactatt 23816702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 341 - 428
Target Start/End: Original strand, 20293228 - 20293316
341 caaatgtctacattgagagtttgatatcaccttaagc-tgggattcaactgcaacatatatatggttagtttttgtctgtgttatttat 428  Q
    |||| ||||||||||||||||| ||||||||||||||  | ||  ||||||||||||| ||||||||||||| ||| ||| ||||||||    
20293228 caaaagtctacattgagagtttaatatcaccttaagcaagagacacaactgcaacatagatatggttagtttctgtttgttttatttat 20293316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 97 - 155
Target Start/End: Complemental strand, 23769697 - 23769639
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactat 155  Q
    |||||||||||||||||||| ||||| ||| ||| ||||||||||||||||| ||||||    
23769697 gatgtttggattatgaaggaatatgggaataaagcgtcttggactaaattgttcactat 23769639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 97 - 155
Target Start/End: Complemental strand, 23819545 - 23819487
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactat 155  Q
    |||||||||||||||||||| ||||| ||| ||| ||||||||||||||||| ||||||    
23819545 gatgtttggattatgaaggaatatgggaataaagcgtcttggactaaattgttcactat 23819487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 96 - 152
Target Start/End: Complemental strand, 2067104 - 2067048
96 ggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacac 152  Q
    |||||||||||||||||||||||||||||||  || |||||||| |||| |||||||    
2067104 ggatgtttggattatgaaggagtatggaaatgtagggtcttggattaaactgtacac 2067048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 147
Target Start/End: Original strand, 3181717 - 3181767
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattg 147  Q
    ||||||||| |||||||||| ||||||||| |||||||||||| |||||||    
3181717 gatgtttggcttatgaaggaatatggaaatgaagagtcttggattaaattg 3181767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 159
Target Start/End: Original strand, 23732167 - 23732229
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    |||||||||||||||||||| ||||| ||| ||| |||||||| |||| ||| ||||||||||    
23732167 gatgtttggattatgaaggaatatgggaataaagcgtcttggaataaactgttcactattcct 23732229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 97 - 159
Target Start/End: Complemental strand, 23861077 - 23861015
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    ||||||||||| |||||||| ||||| |   ||| ||||||||||||||||| ||||||||||    
23861077 gatgtttggataatgaaggaatatgggatgaaagcgtcttggactaaattgttcactattcct 23861015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0044 (Bit Score: 48; Significance: 3e-18; HSPs: 2)
Name: scaffold0044

Target: scaffold0044; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 57 - 172
Target Start/End: Original strand, 89103 - 89218
57 ggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactatt 156  Q
    ||||||||||||  ||||| ||| |||||||  || ||| ||| ||||| |||||||||| ||||||||| |||||||||||||||||||||||| | ||    
89103 ggattgcttgtgcatctttacaagtagtgatatattttttgatatttgggttatgaaggaatatggaaataaagagtcttggactaaattgtacaatgtt 89202  T
157 cctaacctgcaagatc 172  Q
    ||| || || ||||||    
89203 ccttacatggaagatc 89218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0044; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 268 - 373
Target Start/End: Original strand, 89311 - 89416
268 ttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgtctacattgagagtttgatat 367  Q
    ||||||||||||||||| |||| ||| || ||||| ||||||| | |||||||||   ||   | |||  || |||| ||||||||||||||||||||||    
89311 ttggttgtttatgattcaaaaaatggtactttgaagattcctgtgattcaaaacatcaatcgtcggatggacccaaaagtctacattgagagtttgatat 89410  T
368 cacctt 373  Q
89411 cacctt 89416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 47; Significance: 1e-17; HSPs: 10)
Name: chr2

Target: chr2; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 52 - 150
Target Start/End: Original strand, 33038115 - 33038213
52 ttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtac 150  Q
    |||||||||||||||||  ||||||||| |||||||   | ||| |||||||||||||||||||| ||||||||  || |||||||||||| |||||||    
33038115 ttgagggattgcttgtgcatctttgcaagtagtgatatgttttttgatgtttggattatgaaggaatatggaaacaaaaagtcttggactagattgtac 33038213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 52 - 150
Target Start/End: Original strand, 33020268 - 33020366
52 ttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtac 150  Q
    |||||||||||||||||  ||||||||| |||||||   | |||  |||| |||||||||||||| ||||||||| || |||||||||||| |||||||    
33020268 ttgagggattgcttgtgcttctttgcaaatagtgatatgttttttaatgtgtggattatgaaggaatatggaaataaaaagtcttggactagattgtac 33020366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 148
Target Start/End: Original strand, 36577366 - 36577417
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    |||||||||||||||||||| ||||||||| |||||||||||| ||||||||    
36577366 gatgtttggattatgaaggaatatggaaataaagagtcttggattaaattgt 36577417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 97 - 148
Target Start/End: Complemental strand, 7156243 - 7156192
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    ||||||||| |||||||||||||||||||| |||| |||||| |||||||||    
7156243 gatgtttggcttatgaaggagtatggaaatgaagattcttgggctaaattgt 7156192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 97 - 148
Target Start/End: Complemental strand, 7160805 - 7160754
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    ||||||||| |||||||||||||||||||| | || ||||||||||||||||    
7160805 gatgtttggcttatgaaggagtatggaaataatgattcttggactaaattgt 7160754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 52 - 150
Target Start/End: Original strand, 33026612 - 33026710
52 ttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtac 150  Q
    |||||||||||||||||  |||||| ||  | ||||   | ||||||||||||| |||||||| | ||||||||| || |||||||||||| |||||||    
33026612 ttgagggattgcttgtgcatctttgtaagaaatgatatgtttttggatgtttgggttatgaagcaatatggaaataaaaagtcttggactagattgtac 33026710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 107 - 148
Target Start/End: Original strand, 6538844 - 6538885
107 ttatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    |||||||||||||||||||| |||| ||||||||||||||||    
6538844 ttatgaaggagtatggaaataaagattcttggactaaattgt 6538885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 97 - 148
Target Start/End: Complemental strand, 7174424 - 7174373
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    ||||| ||| |||||||||| |||||||||||||| |||||||||| |||||    
7174424 gatgtctggcttatgaaggaatatggaaatcaagattcttggactagattgt 7174373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 322
Target Start/End: Original strand, 33020478 - 33020535
265 aagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaaca 322  Q
    |||||||||||||| |||||||||  ||| || ||||| ||||||||| |||||||||    
33020478 aagttggttgtttacgattccaaagatggtactttgaagattcctgagattcaaaaca 33020535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 100 - 148
Target Start/End: Complemental strand, 7168738 - 7168690
100 gtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    |||||| |||||||||| ||||||||| | || ||||||||||||||||    
7168738 gtttggcttatgaaggaatatggaaataacgattcttggactaaattgt 7168690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 44; Significance: 8e-16; HSPs: 4)
Name: chr7

Target: chr7; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 346 - 428
Target Start/End: Original strand, 39299222 - 39299305
346 gtctacattgagagtttgatatcaccttaagc-tgggattcaactgcaacatatatatggttagtttttgtctgtgttatttat 428  Q
    |||||||||||||| ||||||| ||||||||| || ||||||||| ||| || || ||||||||||||||| ||||||||||||    
39299222 gtctacattgagagcttgatattaccttaagcatgagattcaactacaagatctacatggttagtttttgtttgtgttatttat 39299305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 96 - 148
Target Start/End: Complemental strand, 1078212 - 1078160
96 ggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    |||||||||| ||||||||||||||||||||  |||||| |||||||||||||    
1078212 ggatgtttgggttatgaaggagtatggaaatagagagtcgtggactaaattgt 1078160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 97 - 147
Target Start/End: Complemental strand, 1421220 - 1421170
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattg 147  Q
    ||||||||| |||||||||| || |||||| |||||||||||| |||||||    
1421220 gatgtttggcttatgaaggaatacggaaataaagagtcttggattaaattg 1421170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 39298977 - 39299054
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatcag 174  Q
    ||||||||| || ||||||| | ||||||| ||||||| ||||||||||| |||| | ||||| || || ||||||||    
39298977 gatgtttgggttttgaaggaatgtggaaataaagagtcctggactaaattttacagtgttccttacatggaagatcag 39299054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 6)
Name: chr6

Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 98 - 157
Target Start/End: Complemental strand, 24417536 - 24417477
98 atgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattc 157  Q
    |||||||||||||||| || ||||||||| |||| ||||||||||||||||||| |||||    
24417536 atgtttggattatgaaagaatatggaaataaagaatcttggactaaattgtacagtattc 24417477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 99 - 148
Target Start/End: Original strand, 19119065 - 19119114
99 tgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    ||||||| | |||||||| ||||||||| |||||||||||||||||||||    
19119065 tgtttggttgatgaaggaatatggaaatgaagagtcttggactaaattgt 19119114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 99 - 148
Target Start/End: Original strand, 19126359 - 19126408
99 tgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    ||||||| | |||||||| ||||||||| |||||||||||||||||||||    
19126359 tgtttggttgatgaaggaatatggaaatgaagagtcttggactaaattgt 19126408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 97 - 148
Target Start/End: Original strand, 17368366 - 17368417
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    ||||||||| | ||||| |||||||||||| ||| |||||||||||||||||    
17368366 gatgtttggctgatgaaagagtatggaaatgaagggtcttggactaaattgt 17368417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 93 - 158
Target Start/End: Original strand, 176330 - 176395
93 tttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcc 158  Q
    ||||||| |||||  |||||| || ||||||||| |||| |||||||||||||||| |||| ||||    
176330 tttggatatttggcgtatgaatgattatggaaataaagattcttggactaaattgttcactcttcc 176395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 100 - 148
Target Start/End: Complemental strand, 370833 - 370785
100 gtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    |||||| |||||||| | ||||||||| |||| ||||||||||||||||    
370833 gtttgggttatgaagaattatggaaataaagattcttggactaaattgt 370785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 6)
Name: chr1

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 101 - 159
Target Start/End: Complemental strand, 51381502 - 51381444
101 tttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    ||||||||||||| || ||||||||| ||||||||||||||||||||| || |||||||    
51381502 tttggattatgaaagaatatggaaatgaagagtcttggactaaattgttcagtattcct 51381444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 97 - 148
Target Start/End: Original strand, 51858606 - 51858657
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    ||||||||||| |||||||| |||||||||  ||| ||||||||||||||||    
51858606 gatgtttggatcatgaaggaatatggaaatgtagaatcttggactaaattgt 51858657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 97 - 138
Target Start/End: Complemental strand, 23896188 - 23896147
97 gatgtttggattatgaaggagtatggaaatcaagagtcttgg 138  Q
    ||||||||| |||||||||| ||||||||| |||||||||||    
23896188 gatgtttggcttatgaaggaatatggaaataaagagtcttgg 23896147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 97 - 146
Target Start/End: Complemental strand, 24629262 - 24629213
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaatt 146  Q
    ||||||||| |||||||||| || |||||| |||||||||||| ||||||    
24629262 gatgtttggcttatgaaggaatacggaaataaagagtcttggattaaatt 24629213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 103 - 148
Target Start/End: Complemental strand, 51407604 - 51407559
103 tggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    |||||||||||||| ||||| ||| || ||||||||||||||||||    
51407604 tggattatgaaggaatatgggaatgaacagtcttggactaaattgt 51407559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 97 - 146
Target Start/End: Original strand, 51782799 - 51782848
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaatt 146  Q
    |||||||||||||||||||| ||||||||| || | ||||||| ||||||    
51782799 gatgtttggattatgaaggaatatggaaatgaacaatcttggaataaatt 51782848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1004 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold1004

Target: scaffold1004; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 57 - 145
Target Start/End: Original strand, 2103 - 2191
57 ggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaat 145  Q
    ||||||||||||  ||||||||| || |||||  | |||| ||||||||  ||||||||| |||||||||  |||||||||||||||||    
2103 ggattgcttgtgcatctttgcaagtaatgatgtgtttttgaatgtttgggctatgaaggaatatggaaatgtagagtcttggactaaat 2191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0760 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0760

Target: scaffold0760; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 57 - 145
Target Start/End: Original strand, 4598 - 4686
57 ggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaat 145  Q
    ||||||||||||  ||||||||| || |||||  | |||| ||||||||  ||||||||| |||||||||  |||||||||||||||||    
4598 ggattgcttgtgcatctttgcaagtaatgatgtgtttttgaatgtttgggctatgaaggaatatggaaatgtagagtcttggactaaat 4686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 318494 times since January 2019
Visitors: 3039