View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9332-LTR4-TNT-insertion-7 (Length: 484)

Name: F9332-LTR4-TNT-insertion-7
Description: F9332-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9332-LTR4-TNT-insertion-7
F9332-LTR4-TNT-insertion-7
[»] chr3 (64 HSPs)
chr3 (8-474)||(2644036-2644502)
chr3 (23-470)||(2658831-2659277)
chr3 (53-412)||(2476590-2476943)
chr3 (23-470)||(2635650-2636088)
chr3 (53-428)||(9565554-9565924)
chr3 (48-470)||(7324117-7324531)
chr3 (95-428)||(754334-754662)
chr3 (265-428)||(2492262-2492425)
chr3 (258-452)||(2502357-2502551)
chr3 (266-470)||(7333943-7334145)
chr3 (46-413)||(9561726-9562087)
chr3 (46-428)||(2631306-2631683)
chr3 (352-474)||(7318592-7318715)
chr3 (53-413)||(7442718-7443072)
chr3 (53-235)||(7334152-7334334)
chr3 (8-160)||(2502059-2502211)
chr3 (47-172)||(2492032-2492157)
chr3 (48-172)||(9594600-9594724)
chr3 (109-216)||(746315-746422)
chr3 (46-151)||(7430533-7430638)
chr3 (46-360)||(768120-768431)
chr3 (97-159)||(4142123-4142185)
chr3 (94-172)||(7942482-7942560)
chr3 (96-153)||(2442038-2442095)
chr3 (95-151)||(13498222-13498278)
chr3 (97-159)||(3754600-3754662)
chr3 (97-155)||(4157937-4157995)
chr3 (97-153)||(2696727-2696783)
chr3 (95-159)||(9587174-9587238)
chr3 (93-149)||(43991956-43992012)
chr3 (265-320)||(666992-667047)
chr3 (97-172)||(989396-989471)
chr3 (96-159)||(2456248-2456311)
chr3 (101-159)||(3746012-3746070)
chr3 (99-148)||(2459277-2459326)
chr3 (95-148)||(37753345-37753398)
chr3 (97-149)||(1891063-1891115)
chr3 (97-172)||(956381-956456)
chr3 (97-156)||(1940571-1940630)
chr3 (193-228)||(2502280-2502315)
chr3 (345-411)||(9608071-9608138)
chr3 (96-150)||(771497-771551)
chr3 (107-157)||(44001605-44001655)
chr3 (106-159)||(2686301-2686354)
chr3 (99-148)||(7398179-7398228)
chr3 (95-159)||(783788-783852)
chr3 (97-153)||(803213-803269)
chr3 (96-148)||(12133096-12133148)
chr3 (97-156)||(968671-968730)
chr3 (97-156)||(1007461-1007520)
chr3 (97-156)||(1022489-1022548)
chr3 (97-172)||(1931130-1931205)
chr3 (97-148)||(7432054-7432105)
chr3 (97-159)||(792893-792955)
chr3 (97-159)||(2678388-2678450)
chr3 (265-323)||(9594437-9594495)
chr3 (97-151)||(9608341-9608395)
chr3 (93-151)||(37757733-37757791)
chr3 (99-144)||(997578-997623)
chr3 (99-144)||(1013968-1014013)
chr3 (109-162)||(13479590-13479643)
chr3 (95-156)||(14888604-14888665)
chr3 (99-148)||(23197014-23197063)
chr3 (346-374)||(9586959-9586987)
[»] chr4 (5 HSPs)
chr4 (265-428)||(41456255-41456418)
chr4 (101-173)||(20016160-20016232)
chr4 (97-172)||(20019748-20019823)
chr4 (93-158)||(55419778-55419843)
chr4 (100-156)||(22672119-22672175)
[»] scaffold0097 (2 HSPs)
scaffold0097 (368-470)||(34231-34330)
scaffold0097 (268-321)||(34168-34221)
[»] chr5 (17 HSPs)
chr5 (52-151)||(20292950-20293049)
chr5 (341-428)||(20301675-20301763)
chr5 (341-428)||(20306088-20306176)
chr5 (341-428)||(20310492-20310580)
chr5 (52-151)||(20301398-20301497)
chr5 (52-151)||(20305811-20305910)
chr5 (52-151)||(20310215-20310314)
chr5 (97-159)||(11081813-11081875)
chr5 (97-156)||(23766854-23766913)
chr5 (97-156)||(23816702-23816761)
chr5 (341-428)||(20293228-20293316)
chr5 (97-155)||(23769639-23769697)
chr5 (97-155)||(23819487-23819545)
chr5 (96-152)||(2067048-2067104)
chr5 (97-147)||(3181717-3181767)
chr5 (97-159)||(23732167-23732229)
chr5 (97-159)||(23861015-23861077)
[»] scaffold0044 (2 HSPs)
scaffold0044 (57-172)||(89103-89218)
scaffold0044 (268-373)||(89311-89416)
[»] chr2 (10 HSPs)
chr2 (52-150)||(33038115-33038213)
chr2 (52-150)||(33020268-33020366)
chr2 (97-148)||(36577366-36577417)
chr2 (97-148)||(7156192-7156243)
chr2 (97-148)||(7160754-7160805)
chr2 (52-150)||(33026612-33026710)
chr2 (107-148)||(6538844-6538885)
chr2 (97-148)||(7174373-7174424)
chr2 (265-322)||(33020478-33020535)
chr2 (100-148)||(7168690-7168738)
[»] chr7 (4 HSPs)
chr7 (346-428)||(39299222-39299305)
chr7 (96-148)||(1078160-1078212)
chr7 (97-147)||(1421170-1421220)
chr7 (97-174)||(39298977-39299054)
[»] chr6 (6 HSPs)
chr6 (98-157)||(24417477-24417536)
chr6 (99-148)||(19119065-19119114)
chr6 (99-148)||(19126359-19126408)
chr6 (97-148)||(17368366-17368417)
chr6 (93-158)||(176330-176395)
chr6 (100-148)||(370785-370833)
[»] chr1 (6 HSPs)
chr1 (101-159)||(51381444-51381502)
chr1 (97-148)||(51858606-51858657)
chr1 (97-138)||(23896147-23896188)
chr1 (97-146)||(24629213-24629262)
chr1 (103-148)||(51407559-51407604)
chr1 (97-146)||(51782799-51782848)
[»] scaffold1004 (1 HSPs)
scaffold1004 (57-145)||(2103-2191)
[»] scaffold0760 (1 HSPs)
scaffold0760 (57-145)||(4598-4686)


Alignment Details
Target: chr3 (Bit Score: 467; Significance: 0; HSPs: 64)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 467; E-Value: 0
Query Start/End: Original strand, 8 - 474
Target Start/End: Complemental strand, 2644502 - 2644036
Alignment:
8 cacctgacttcggggatgaaaataatccgtgggactttggtgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggat 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2644502 cacctgacttcggggatgaaaataatccgtgggactttggtgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggat 2644403  T
108 tatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttca 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2644402 tatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttca 2644303  T
208 gaggatgaccaactgttggtggagtgttgtgaaattgagggtgaaactggctatatcaagttggttgtttatgattccaaaactggcacattgaatattc 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2644302 gaggatgaccaactgttggtggagtgttgtgaaattgagggtgaaactggctatatcaagttggttgtttatgattccaaaactggcacattgaatattc 2644203  T
308 ctgagtttcaaaacaaatatgacctgatatactcaaatgtctacattgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggtta 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2644202 ctgagtttcaaaacaaatatgacctgatatactcaaatgtctacattgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggtta 2644103  T
408 gtttttgtctgtgttatttatatgttatgcctgctctaattcttgattacttgttagatcattatta 474  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2644102 gtttttgtctgtgttatttatatgttatgcctgctctaattcttgattacttgttagatcattatta 2644036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 23 - 470
Target Start/End: Complemental strand, 2659277 - 2658831
Alignment:
23 atgaaaataatccgtgggactttggtgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatgg 122  Q
    ||||||||||| |||||||| | |||||| ||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||    
2659277 atgaaaataattcgtgggacgtgggtgtggtgagggattgcttgtgtgtctttgcaagtagtgatgaatattgggatgtttggattatgaaggagtatgg 2659178  T
123 aaatcaagagtcttggactaaattgtacactattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttcagaggatgaccaactg 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||  |||||  |||||||||||||||||||||||||||||||||     
2659177 aaatcaagagtcttggactaaattgtacactattcctaacctgcaagatcaggatttagaagccgatagagctttatatatttcagaggatgaccaacta 2659078  T
223 ttggtggagtgttgtga-aattgagggtgaaactggctatatcaagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaac 321  Q
    |||||  | |||  | |  |||| || ||||  || | |||| |||||||||||||||||||| ||| |||||||||||||| |||||| ||||| ||||    
2659077 ttggtacaatgtcatcaggattg-ggctgaatgtgacgatatgaagttggttgtttatgattctaaagctggcacattgaattttcctgtgtttcgaaac 2658979  T
322 aaatatgacctgatatactcaaatgtctacattgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggttagtttttgtctgtgt 421  Q
    || ||| | |  | | |  |  | ||||||||||||||| | ||||||||||||||   ||||||||||||||||||||||||||||||||||| |||||    
2658978 aactataaacatacacatgccgaagtctacattgagagtctcatatcaccttaagcattgattcaactgcaacatatatatggttagtttttgtttgtgt 2658879  T
422 tatttatatgttatgcctgctctaattcttgattacttgttagatcatt 470  Q
    ||||||||||||||||||||||| ||| ||| | |||||||||||||||    
2658878 tatttatatgttatgcctgctctgatt-ttggtgacttgttagatcatt 2658831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 53 - 412
Target Start/End: Original strand, 2476590 - 2476943
Alignment:
53 tgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacac 152  Q
    ||||||||||||||||| ||| |||| ||||||||   | | |||||||||||||||||||  | ||||||||| |||||||||||||||||||||||||    
2476590 tgagggattgcttgtgtatctctgcagctagtgatatgtttatggatgtttggattatgaaacactatggaaataaagagtcttggactaaattgtacac 2476689  T
153 tattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttcagaggatgaccaactgttggtggagtgttgtgaaattgagggtgaa 252  Q
    | |||||||| ||||||||| |  |||  |||||   |  |||||||| ||||| |||||||||||||||||||| ||||||  ||| |||||  ||||     
2476690 tgttcctaacatgcaagatcggggtttagaagcctacaatgctttatacatttctgaggatgaccaactgttggtcgagtgtcttgagattgaaagtgac 2476789  T
253 actggctatatcaagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgtctaca 352  Q
    | ||     || |||||||||||||| |||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||||    
2476790 aatg-----at-aagttggttgtttacgattccaaaactggtacttcgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgtctaca 2476883  T
353 ttgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggttagtttt 412  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
2476884 ttgagagtttgatatcaccttaagctgggattcaactccaacatatatatggttagtttt 2476943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 175; E-Value: 5e-94
Query Start/End: Original strand, 23 - 470
Target Start/End: Original strand, 2635650 - 2636088
Alignment:
23 atgaaaataatccgtgggactttggtgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatgg 122  Q
    ||||||||  |||||||  ||| | |||| ||||| ||||| ||||||||||||||||||||||||  | |||||||||||||||||||   ||||||||    
2635650 atgaaaatggtccgtggatcttggatgtgatgaggaattgcatgtgtgtctttgcaactagtgatgtgtttttggatgtttggattatg---gagtatgg 2635746  T
123 aaatcaagagtcttggactaaattgtacactattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttcagaggatgaccaactg 222  Q
    || | |||||||||||||||||||||||| | |||||||| ||||| ||| |  |||  ||| |  || ||||||||||||||| ||||||||||||||     
2635747 aagtgaagagtcttggactaaattgtacagtgttcctaacatgcaacatcggggtttagaagtctataaagctttatatatttctgaggatgaccaacta 2635846  T
223 ttggtggagtgttgtgaaattgagggtgaaactggctatatcaagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaaca 322  Q
     |  || |||||| ||| |||||      || |||  |||| |||||||||||||| |||||||||| ||| || || |||||||| |||||||||||||    
2635847 ctcctgcagtgttatgagattga------aagtggagatatgaagttggttgtttacgattccaaaaatggtactttaaatattcccgagtttcaaaaca 2635940  T
323 aatatgacctgatatactcaaatgtctacattgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggttagtttttgtctgtgtt 422  Q
    | ||||| | ||||||| ||||||||||||||| |||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||    
2635941 actatgaacagatatacccaaatgtctacattgcgagtttgatatcaccttaagttgggattcatctgcaacatatatatggttagtttttgtctgtgtt 2636040  T
423 atttatatgttatgcctgctctaattcttgattacttgttagatcatt 470  Q
    |||||| | ||||||||  ||| ||||||| | |||||||||||||||    
2636041 atttatgtattatgcctaatctgattcttggtgacttgttagatcatt 2636088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 149; E-Value: 2e-78
Query Start/End: Original strand, 53 - 428
Target Start/End: Complemental strand, 9565924 - 9565554
Alignment:
53 tgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacac 152  Q
    |||||| |||||||||||||||||||| |||||||   ||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||     
9565924 tgaggggttgcttgtgtgtctttgcaagtagtgatatgtatatggatgtttggattatgaaggagtacggagatcaagagtcttggactaaattgtacat 9565825  T
153 tattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttcagaggatgaccaactgttggtggagtgttgtgaaattgagggtgaa 252  Q
    | |||||||| | |||||||||  | | ||||||  || ||||||||||||||| || ||||||||||||||||| |||| ||  |||||||      ||    
9565824 tgttcctaacatacaagatcagggtgtcaaagcctataaagctttatatatttctgacgatgaccaactgttggtagagt-ttaagaaattg-----caa 9565731  T
253 actggctatatcaagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgtctaca 352  Q
    | |  |  ||||||||||||||||||||||||||| || || || |||||||||||||||||||||||||| ||| | | | ||  ||||||||||||||    
9565730 agtaacagtatcaagttggttgtttatgattccaagaccggtactttgaatattcctgagtttcaaaacaactataaacaggtagcctcaaatgtctaca 9565631  T
353 ttgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggttagtttttgt-ctgtgttatttat 428  Q
    |||||||||||||||||||||| ||  |||||||| ||||||||  ||||||||||||||| | |||||||||||||    
9565630 ttgagagtttgatatcaccttaggcacggattcaaatgcaacattgatatggttagtttttttactgtgttatttat 9565554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 145; E-Value: 4e-76
Query Start/End: Original strand, 48 - 470
Target Start/End: Complemental strand, 7324531 - 7324117
Alignment:
48 tgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattg 147  Q
    |||| ||||||||||| |  || |||||| |||| |||||   | |||||||||||||||||||||||| || |||||| ||||||||||||||||||||    
7324531 tgtggtgagggattgccttggtctctttggaactggtgatatgtctttggatgtttggattatgaaggactacggaaataaagagtcttggactaaattg 7324432  T
148 tacactattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttcagaggatgaccaactgttggtggagtgttgtgaaattgagg 247  Q
    || | | |||||||| |||||||||    |||  |||||      |||||||| ||||| |||||||||||||| ||||| || |||      ||||||     
7324431 tatagtgttcctaacatgcaagatcgcggtttagaagcctacgatgctttatacatttctgaggatgaccaacttttggtcgattgt------attgaga 7324338  T
248 gtgaaactggctatatcaagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgt 347  Q
     ||||| |||| ||   ||||||||| |||| |||||||||||||| || |||||||||||||||||||||||||| ||||| | ||||| | |||||||    
7324337 ttgaaagtggcaatgataagttggttctttacgattccaaaactggtactttgaatattcctgagtttcaaaacaactatgaacggatatgcccaaatgt 7324238  T
348 ctacattgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggttagtttttgtctgtgttatttatatgttatgcctgctctaat 447  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||  | | ||| ||||||||| ||    
7324237 ctacattgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggttagtttttgtttgtgttgtt--tgttttacgcctgctctgat 7324140  T
448 tcttgattacttgttagatcatt 470  Q
    | ||| | ||||||| |||||||    
7324139 ttttgttgacttgttggatcatt 7324117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 95 - 428
Target Start/End: Complemental strand, 754662 - 754334
Alignment:
95 tggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatcagaatttgaaagccagtagagc 194  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | ||||  || | ||||||||   | | ||| ||  |  | |    
754662 tggatgtttggattatgaaggagtatggagatcaagagtcttggactaaattgtacattgttcccgacatacaagatcatggtctcaaaccctttcaacc 754563  T
195 tttatatatttcagaggatgaccaactgttggtggagtgttgtgaaattgagggtgaaactggctatatcaagttggttgtttatgattccaaaactggc 294  Q
    |||||||||||  ||||||||||||||| || |   || || || ||| || |||| ||      |||||||||||||||||||||||||||| |||||     
754562 tttatatatttatgaggatgaccaactgctgctaaggttttatgcaatggaaggtggaa------atatcaagttggttgtttatgattccaagactggt 754469  T
295 acattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgtctacattgagagtttgatatcaccttaagctgggattcaactgcaac 394  Q
    ||  ||||||||||||||||||||||||| ||||| |  |||  |||| ||||||||||||||||||||||||||||||||||  |||||||||||||||    
754468 actctgaatattcctgagtttcaaaacaactatgaacaaataggctcagatgtctacattgagagtttgatatcaccttaagcaaggattcaactgcaac 754369  T
395 atatatatggttagtttttgt-ctgtgttatttat 428  Q
    ||||| |||||||||||||||  ||||||||||||    
754368 atatacatggttagtttttgtattgtgttatttat 754334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 265 - 428
Target Start/End: Original strand, 2492262 - 2492425
Alignment:
265 aagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgtctacattgagagtttga 364  Q
    ||||||||||||||||||||||| ||||  || ||||||||||| |||||||||||||| ||||| | |  |||||||||||||||||||||||||||||    
2492262 aagttggttgtttatgattccaagactgatactttgaatattccagagtttcaaaacaactatgaaccggaatactcaaatgtctacattgagagtttga 2492361  T
365 tatcaccttaagctgggattcaactgcaacatatatatggttagtttttgtctgtgttatttat 428  Q
    |||||||||||||||||||||||||||  |||||||||||||||||||||| ||||||||||||    
2492362 tatcaccttaagctgggattcaactgcggcatatatatggttagtttttgtgtgtgttatttat 2492425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 111; E-Value: 8e-56
Query Start/End: Original strand, 258 - 452
Target Start/End: Original strand, 2502357 - 2502551
Alignment:
258 ctatatcaagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgtctacattgag 357  Q
    |||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |  | | |  ||| | |||||||||||    
2502357 ctatatcaagtttgttgtttatgattccaaaactggcactttgaatattcctgagtttcaaaacaactatgagcatagagatgcaattttctacattgag 2502456  T
358 agtttgatatcaccttaagctgggattcaactgcaacatatatatggttagtttttgtctgtgttatttatatgttatgcctgctctaattcttg 452  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||||  | | |||||||||||||| ||||||||| | |||||||    
2502457 agtttgatatcaccttaagcatggattcaactgcaacatatatatggttagttttaatttctgttatttatatgtcatgcctgctttgattcttg 2502551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 266 - 470
Target Start/End: Complemental strand, 7334145 - 7333943
Alignment:
266 agttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgtctacattgagagtttgat 365  Q
    ||||||||||||||||| |||||||||| || || ||||| ||||||||||||||||| ||| | |||||| ||||||||||||||||||||||||||||    
7334145 agttggttgtttatgatcccaaaactggtactttaaatatccctgagtttcaaaacaactataaactgatagactcaaatgtctacattgagagtttgat 7334046  T
366 atcaccttaagctgggattcaactgcaacatatatatggttagtttttgtctgtgttatttatatgttatgcctgctctaattcttgattacttgttaga 465  Q
    ||| || |||||||||||||||| |||||||||||||||||||||||| | |||||||||  ||| |||| |||||| | ||| || || ||||||||||    
7334045 atcgccctaagctgggattcaacggcaacatatatatggttagtttttatttgtgttatt--tattttatccctgctttgattattcatgacttgttaga 7333948  T
466 tcatt 470  Q
    |||||    
7333947 tcatt 7333943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 46 - 413
Target Start/End: Complemental strand, 9562087 - 9561726
Alignment:
46 ggtgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaat 145  Q
    |||||| | ||| ||||||||||| |||| || |||||| ||   | ||||||||||||||||||||| |||||||||||||||||||||||||||||||    
9562087 ggtgtgctaaggaattgcttgtgtatcttagctactagtaatttgtttttggatgtttggattatgaatgagtatggaaatcaagagtcttggactaaat 9561988  T
146 tgtacactattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttcagaggatgaccaactgttggtggagtgttgtgaaattga 245  Q
    | |||| | |||||||| ||||||||||   |||  ||||   ||  | |||||||| ||| ||||||||||||||| || | |||| |  ||| ||       
9561987 tatacagtgttcctaacatgcaagatcacggtttagaagcttatactgttttatatagttctgaggatgaccaactgctgctagagtttaatgagat--- 9561891  T
246 gggtgaaactggctatatcaagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaat 345  Q
      | |||  || | |  | |||||||||||||| ||||| || ||||| || |||||||||||||||||||||||||| ||||| | ||||| |  ||||    
9561890 --gcgaag-tgacaaagtgaagttggttgtttacgattctaagactggtactttgaatattcctgagtttcaaaacaactatgatcagatatgccaaaat 9561794  T
346 gtctacattgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggttagttttt 413  Q
     |||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||    
9561793 ttctacattgagagtttgatatcaccttaagcattgattcaactgcaacatatatatggttagttttt 9561726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 46 - 428
Target Start/End: Original strand, 2631306 - 2631683
Alignment:
46 ggtgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaat 145  Q
    |||||| |||| |||| |||||||||||||||||||||||||   | |||| ||||||||||||||||||| ||||||||||||||||||||||||||||    
2631306 ggtgtgctgagtgattacttgtgtgtctttgcaactagtgatatgtttttgaatgtttggattatgaaggaatatggaaatcaagagtcttggactaaat 2631405  T
146 tgtacactattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttcagaggatgaccaactgttggtggagtgttgtgaaattga 245  Q
    ||| || | ||||| || |||| |||||   |||  ||||   |   ||| |||||||||| |||||||| |||||| |  || ||||||  ||  ||||    
2631406 tgtgcagtgttcctgacatgcacgatcacggtttccaagcatctgccgctgtatatatttctgaggatgatcaactgctcttgcagtgttacgagtttga 2631505  T
246 gggtgaaactggctatatcaagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaat 345  Q
      |||      || |    ||||||||||| || |||||||||||||| |  || ||||||| ||||||||||||||| ||||| |  |||| |  |||     
2631506 cagtg------gcgaggagaagttggttgtctacgattccaaaactggtatttttaatattcttgagtttcaaaacaactatgaacatatatcccaaaaa 2631599  T
346 gtctacattgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggttagtttt-tgtctgtgttatttat 428  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| ||| | ||||||||||    
2631600 gtctacattgagagtttaatatcaccttaagctgggattcaactgcaacatatacatggttagttttatgtttatgttatttat 2631683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 352 - 474
Target Start/End: Complemental strand, 7318715 - 7318592
Alignment:
352 attgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggttagt-ttttgtctgtgttatttatatgttatgcctgctctaattct 450  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |||||    
7318715 attgagagtttaatatcaccttaagctgggattcaactgcaacatatatatggttagttttttgtttgtgttatttatatgttatgcctgctctgattct 7318616  T
451 tgattacttgttagatcattatta 474  Q
    |||| |||||||||||||||||||    
7318615 tgatgacttgttagatcattatta 7318592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 53 - 413
Target Start/End: Complemental strand, 7443072 - 7442718
Alignment:
53 tgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacac 152  Q
    ||||||||||||||||||||| || | ||||||||   | |||  |||||||||| ||||||||||||||||||||||||||||||||||| ||||| |     
7443072 tgagggattgcttgtgtgtctatgaagctagtgatttgttttttaatgtttggatcatgaaggagtatggaaatcaagagtcttggactaagttgtatag 7442973  T
153 tattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttcagaggatgaccaactgttggtggagtgttgtgaaattgagggtgaa 252  Q
    | |||||||  ||||| ||| |  ||| ||||||  ||    || |||||| |  ||||||||||||||| || ||| |  |  ||| ||  |      |    
7442972 tgttcctaaaatgcaacatcggcgttttaaagcctatactatttcatatatctatgaggatgaccaactgctgttggggattgttgatatgca------a 7442879  T
253 actggctatatcaagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgtctaca 352  Q
    | | || |||  ||||||| ||||||||||||||| || || || |||||||||||||||||| |||| |  ||||| | ||||||||||||||||||||    
7442878 agtagcaatacaaagttggctgtttatgattccaagacgggtactttgaatattcctgagtttgaaaaaacctatgaaccgatatactcaaatgtctaca 7442779  T
353 ttgagagtttgatatcaccttaagctgggattcaactgcaacatatatatggttagttttt 413  Q
    |||||||||||||||| || |||||||||||||||| ||||||||||||||||||||||||    
7442778 ttgagagtttgatatcgccctaagctgggattcaacggcaacatatatatggttagttttt 7442718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 53 - 235
Target Start/End: Complemental strand, 7334334 - 7334152
Alignment:
53 tgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacac 152  Q
    ||||||||||||||||||||||||| | |||||||  ||||| |||||||||||| |||||||| || |||||| |||||||||||||||||||||||||    
7334334 tgagggattgcttgtgtgtctttgccagtagtgatatatattgggatgtttggatcatgaaggactacggaaataaagagtcttggactaaattgtacac 7334235  T
153 tattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttcagaggatgaccaactgttggtggagtgtt 235  Q
    ||||||||||||| ||||||    |||  |||||  |     |||||||||||||||||||||||||||||||||||||||||    
7334234 tattcctaacctgaaagatcgtggtttagaagccgattctcttttatatatttcagaggatgaccaactgttggtggagtgtt 7334152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 8 - 160
Target Start/End: Original strand, 2502059 - 2502211
Alignment:
8 cacctgacttcggggatgaaaataatccgtgggactttggtgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggat 107  Q
    |||||||||| ||| |||||||||||  |||| | || |||||| | ||||||||||||||||||||||||  |||||||||||||| ||||||||||||    
2502059 cacctgactttgggaatgaaaataattggtggaatttgggtgtgctcagggattgcttgtgtgtctttgcaggtagtgatgaatattgggatgtttggat 2502158  T
108 tatgaaggagtatggaaatcaagagtcttggactaaattgtacactattccta 160  Q
    ||||||||||||||||||| | |||| |||||||||| |||||||||||||||    
2502159 tatgaaggagtatggaaataaggagttttggactaaactgtacactattccta 2502211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 47 - 172
Target Start/End: Original strand, 2492032 - 2492157
Alignment:
47 gtgtgttgagggattgcttgtgtgtctttgcaactagtgat-gaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaat 145  Q
    ||||| ||||||||||||||||||| |||||||||| |||| | || |||| |||||||||||||||||||||||||||||| |||||||||||||||||    
2492032 gtgtgctgagggattgcttgtgtgtttttgcaactattgataggat-tttgaatgtttggattatgaaggagtatggaaatcgagagtcttggactaaat 2492130  T
146 tgtacactattcctaacctgcaagatc 172  Q
    |||| | | |||||||| |||||||||    
2492131 tgtatagtgttcctaacatgcaagatc 2492157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 48 - 172
Target Start/End: Complemental strand, 9594724 - 9594600
Alignment:
48 tgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattg 147  Q
    |||| |||||||||||||||||||||||| ||||||||||   | |||| ||||||||||||||||  |||| |||||| ||||||||||||||||||||    
9594724 tgtgctgagggattgcttgtgtgtctttgaaactagtgatatgtttttgaatgtttggattatgaataagtacggaaatgaagagtcttggactaaattg 9594625  T
148 tacactattcctaacctgcaagatc 172  Q
    | |  | |||||||| |||||||||    
9594624 ttccatgttcctaacatgcaagatc 9594600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 109 - 216
Target Start/End: Complemental strand, 746422 - 746315
Alignment:
109 atgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatcagaatttgaaagccagtagagctttatatatttcag 208  Q
    ||||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||||  |  ||| | ||||  || || |||||||||||| |    
746422 atgaaggagtatggaaatcaagagtcttggactaaattgtacattgttcctaacctacaagattggggtttcatagcctataaagatttatatatttctg 746323  T
209 aggatgac 216  Q
    ||||||||    
746322 aggatgac 746315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 46 - 151
Target Start/End: Complemental strand, 7430638 - 7430533
Alignment:
46 ggtgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaat 145  Q
    |||||||||  ||||||||||||  ||||||||| | || |||  | |||||||||||||||||||||| ||||||||||| || |||||| ||||||||    
7430638 ggtgtgttgtaggattgcttgtgcatctttgcaagttgtcatgggtttttggatgtttggattatgaagaagtatggaaataaaaagtcttagactaaat 7430539  T
146 tgtaca 151  Q
    ||||||    
7430538 tgtaca 7430533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 46 - 360
Target Start/End: Complemental strand, 768431 - 768120
Alignment:
46 ggtgtgttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaat 145  Q
    |||||||||||||||||||||||||| ||||  ||||||||    | |||  |||||||||||||||| ||||| |||||| ||||||||||||||||||    
768431 ggtgtgttgagggattgcttgtgtgtatttgacactagtgaaatgttttttaatgtttggattatgaatgagtacggaaatgaagagtcttggactaaat 768332  T
146 tgtacactattcctaacctgcaagatcagaa---tttgaaagccagtagagctttatatatttcagaggatgaccaactgttggtggagtgttgtgaaat 242  Q
    ||| |  | |||||||  | ||  ||||  |   | | |  |||  || ||||||||||||||  ||||||||  ||||| ||||||||| ||      |    
768331 tgttccatgttcctaaagttcacaatcatcagggtctcagggcctataaagctttatatatttttgaggatgagaaactgctggtggagtttt------t 768238  T
243 tgagggtgaaactggctatatcaagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactca 342  Q
    | | | ||||||| || |||  |||||||||||||| |||||||||||||  || || ||||||| ||||||||||||||| ||||  | |||  || ||    
768237 ttatgttgaaacttgcgataggaagttggttgtttacgattccaaaactgctacttttaatattcttgagtttcaaaacaactatgctcagatgaaccca 768138  T
343 aatgtctacattgagagt 360  Q
    || |||||||||||||||    
768137 aaagtctacattgagagt 768120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 159
Target Start/End: Complemental strand, 4142185 - 4142123
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    ||||||||| |||||||||| ||||||||| ||||||||||||||||||||| ||||||||||    
4142185 gatgtttggcttatgaaggaatatggaaataaagagtcttggactaaattgttcactattcct 4142123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 94 - 172
Target Start/End: Original strand, 7942482 - 7942560
Alignment:
94 ttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatc 172  Q
    ||||||||||||||||||||||||||||| ||| |||||||||||| ||||||||||| | ||||| || || ||||||    
7942482 ttggatgtttggattatgaaggagtatggtaataaagagtcttggattaaattgtacaatgttccttacatggaagatc 7942560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 96 - 153
Target Start/End: Original strand, 2442038 - 2442095
Alignment:
96 ggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacact 153  Q
    ||||||||||||||||||||||||||||||| |||| |||||||||||||||| ||||    
2442038 ggatgtttggattatgaaggagtatggaaataaagattcttggactaaattgttcact 2442095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 95 - 151
Target Start/End: Original strand, 13498222 - 13498278
Alignment:
95 tggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtaca 151  Q
    |||||||||||||||||||||| ||||||||| ||||||||||||||||||| ||||    
13498222 tggatgtttggattatgaaggaatatggaaataaagagtcttggactaaattataca 13498278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 97 - 159
Target Start/End: Original strand, 3754600 - 3754662
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    ||||||||| |||||||||| ||||||||| |||||||||||||||||||||  |||||||||    
3754600 gatgtttgggttatgaaggaatatggaaataaagagtcttggactaaattgtttactattcct 3754662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 97 - 155
Target Start/End: Complemental strand, 4157995 - 4157937
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactat 155  Q
    ||||||||| |||||||||| ||||||||| ||||||||||||||||||||| ||||||    
4157995 gatgtttggcttatgaaggaatatggaaataaagagtcttggactaaattgttcactat 4157937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 97 - 153
Target Start/End: Complemental strand, 2696783 - 2696727
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacact 153  Q
    |||||||||||||||||||| ||||||||| |||||||||||| |||||||| ||||    
2696783 gatgtttggattatgaaggaatatggaaataaagagtcttggattaaattgttcact 2696727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 95 - 159
Target Start/End: Complemental strand, 9587238 - 9587174
Alignment:
95 tggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    |||| ||||||||||||||||| ||||||||| ||||| ||||||| |||||||||| |||||||    
9587238 tggaggtttggattatgaaggaatatggaaataaagagccttggacaaaattgtacaatattcct 9587174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 93 - 149
Target Start/End: Original strand, 43991956 - 43992012
Alignment:
93 tttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgta 149  Q
    |||||||||||||||||||||||| |||||||||  |||||||||||| ||||||||    
43991956 tttggatgtttggattatgaaggaatatggaaatatagagtcttggaccaaattgta 43992012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 265 - 320
Target Start/End: Complemental strand, 667047 - 666992
Alignment:
265 aagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaa 320  Q
    ||||||||||||||||||||||| ||| | || |||||||||||||||||||||||    
667047 aagttggttgtttatgattccaagactagtactttgaatattcctgagtttcaaaa 666992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 172
Target Start/End: Original strand, 989396 - 989471
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatc 172  Q
    ||||||||| | ||||| ||||| |||||| ||||||||||||||||||||| ||||||| || || |||||||||    
989396 gatgtttgggtaatgaaagagtacggaaataaagagtcttggactaaattgttcactatttcttacatgcaagatc 989471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 96 - 159
Target Start/End: Original strand, 2456248 - 2456311
Alignment:
96 ggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    |||||||||| |||||||||| ||||||||| |||| ||||||||||||||||||  |||||||    
2456248 ggatgtttgggttatgaaggaatatggaaataaagactcttggactaaattgtaccatattcct 2456311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 101 - 159
Target Start/End: Original strand, 3746012 - 3746070
Alignment:
101 tttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    |||||||||||||||| |||| ||| ||||||||||||||||||||||  |||||||||    
3746012 tttggattatgaaggaatatgcaaagcaagagtcttggactaaattgttgactattcct 3746070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 99 - 148
Target Start/End: Original strand, 2459277 - 2459326
Alignment:
99 tgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    |||||||||||||||||| ||||||||| ||||||||||||| |||||||    
2459277 tgtttggattatgaaggaatatggaaataaagagtcttggacaaaattgt 2459326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 95 - 148
Target Start/End: Complemental strand, 37753398 - 37753345
Alignment:
95 tggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    ||||||||||||||||| |||| ||||||||  |||||||||||||||||||||    
37753398 tggatgtttggattatggaggaatatggaaagaaagagtcttggactaaattgt 37753345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 97 - 149
Target Start/End: Complemental strand, 1891115 - 1891063
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgta 149  Q
    ||||||||||||||||||||  |||||||| |||| |||||||||||||||||    
1891115 gatgtttggattatgaaggaacatggaaataaagactcttggactaaattgta 1891063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 97 - 172
Target Start/End: Original strand, 956381 - 956456
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatc 172  Q
    |||||||||||||||||||| ||||||||  |||||||||||  |||||||| || |||| || || |||||||||    
956381 gatgtttggattatgaaggaatatggaaaaaaagagtcttggcataaattgttcattatttctcacatgcaagatc 956456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 97 - 156
Target Start/End: Complemental strand, 1940630 - 1940571
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactatt 156  Q
    ||||||||| ||||||||||  ||||||||||||| || ||||||||||||| |||||||    
1940630 gatgtttgggttatgaaggaacatggaaatcaagactcgtggactaaattgttcactatt 1940571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 193 - 228
Target Start/End: Original strand, 2502280 - 2502315
Alignment:
193 gctttatatatttcagaggatgaccaactgttggtg 228  Q
    ||||||||||||||||||||||||||||||||||||    
2502280 gctttatatatttcagaggatgaccaactgttggtg 2502315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 345 - 411
Target Start/End: Complemental strand, 9608138 - 9608071
Alignment:
345 tgtctacattgagagtttgatatcaccttaagc-tgggattcaactgcaacatatatatggttagttt 411  Q
    ||||||||  ||||||||||||||||||||||| || ||||||| ||| |||||||||| ||||||||    
9608138 tgtctacaacgagagtttgatatcaccttaagcatgagattcaagtgctacatatatattgttagttt 9608071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 96 - 150
Target Start/End: Complemental strand, 771551 - 771497
Alignment:
96 ggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtac 150  Q
    |||||||||| |||||||||| |||||||||  ||| ||||||||||||||||||    
771551 ggatgtttgggttatgaaggaatatggaaatacagactcttggactaaattgtac 771497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 107 - 157
Target Start/End: Original strand, 44001605 - 44001655
Alignment:
107 ttatgaaggagtatggaaatcaagagtcttggactaaattgtacactattc 157  Q
    |||||||||| ||||||| | ||||||||||||||||| ||||||||||||    
44001605 ttatgaaggaatatggaattaaagagtcttggactaaactgtacactattc 44001655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 106 - 159
Target Start/End: Complemental strand, 2686354 - 2686301
Alignment:
106 attatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    ||||||||||| ||||||||  |||||||||||| |||||||| ||||||||||    
2686354 attatgaaggaatatggaaaaaaagagtcttggaataaattgttcactattcct 2686301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 99 - 148
Target Start/End: Complemental strand, 7398228 - 7398179
Alignment:
99 tgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    ||||||| | |||||||||||||||||| |||||||||||| ||||||||    
7398228 tgtttggttgatgaaggagtatggaaatgaagagtcttggattaaattgt 7398179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 95 - 159
Target Start/End: Complemental strand, 783852 - 783788
Alignment:
95 tggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    |||||||||||||||||||||| |||||||||  | || | |||||||||||||| ||| |||||    
783852 tggatgtttggattatgaaggaatatggaaatacaaagccatggactaaattgtatactgttcct 783788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 97 - 153
Target Start/End: Complemental strand, 803269 - 803213
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacact 153  Q
    ||||||||| ||||||| || ||||||||| |||||||||||||||| |||| ||||    
803269 gatgtttgggttatgaaagaatatggaaataaagagtcttggactaagttgttcact 803213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 96 - 148
Target Start/End: Original strand, 12133096 - 12133148
Alignment:
96 ggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    |||||||||| |||||| |||||||||||||  |||||| |||||||||||||    
12133096 ggatgtttgggttatgagggagtatggaaatagagagtcgtggactaaattgt 12133148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 97 - 156
Target Start/End: Original strand, 968671 - 968730
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactatt 156  Q
    ||||||||| ||||||||||  |||||||| ||||||| ||||||||||| | |||||||    
968671 gatgtttgggttatgaaggaacatggaaataaagagtcatggactaaattattcactatt 968730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 97 - 156
Target Start/End: Original strand, 1007461 - 1007520
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactatt 156  Q
    ||||||||| | |||||||| ||||||||| | ||||| ||||||||||||| |||||||    
1007461 gatgtttgggtaatgaaggaatatggaaataacgagtcctggactaaattgttcactatt 1007520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 97 - 156
Target Start/End: Original strand, 1022489 - 1022548
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactatt 156  Q
    ||||||||| | |||||||| ||||||||| | ||||| ||||||||||||| |||||||    
1022489 gatgtttgggtaatgaaggaatatggaaataacgagtcatggactaaattgttcactatt 1022548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 97 - 172
Target Start/End: Complemental strand, 1931205 - 1931130
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatc 172  Q
    ||||||||| |||||| |||  |||||||| |||| || ||||||||||||| ||||||| || || |||||||||    
1931205 gatgtttgggttatgatggaacatggaaataaagactcctggactaaattgttcactatttcttacatgcaagatc 1931130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 97 - 148
Target Start/End: Complemental strand, 7432105 - 7432054
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    |||||||||| ||||||||| ||||||||| |||| || |||||||||||||    
7432105 gatgtttggagtatgaaggaatatggaaataaagaatcgtggactaaattgt 7432054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 97 - 159
Target Start/End: Complemental strand, 792955 - 792893
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    |||||||||||||||||||||||||| ||  | || ||||||| |||||| | ||||||||||    
792955 gatgtttggattatgaaggagtatggtaaagaggaatcttggagtaaattattcactattcct 792893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 97 - 159
Target Start/End: Complemental strand, 2678450 - 2678388
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    ||||||||| |||||||  | ||||||||  ||||||| ||||||||||||| ||||||||||    
2678450 gatgtttgggttatgaaacaatatggaaaaaaagagtcatggactaaattgttcactattcct 2678388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 265 - 323
Target Start/End: Complemental strand, 9594495 - 9594437
Alignment:
265 aagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaa 323  Q
    ||||||| |||||| |||||||||||||  || || ||||||| |||||||||||||||    
9594495 aagttggctgtttacgattccaaaactgttacttttaatattcttgagtttcaaaacaa 9594437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 97 - 151
Target Start/End: Complemental strand, 9608395 - 9608341
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtaca 151  Q
    ||||||||| |||||||||| |||||||||  ||| |||||||||||||| ||||    
9608395 gatgtttgggttatgaaggaatatggaaatatagattcttggactaaattataca 9608341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 93 - 151
Target Start/End: Complemental strand, 37757791 - 37757733
Alignment:
93 tttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtaca 151  Q
    ||||||| | |||||||||||||| ||||||||  ||||||||||||| || |||||||    
37757791 tttggatatatggattatgaaggaatatggaaacaaagagtcttggacgaagttgtaca 37757733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 99 - 144
Target Start/End: Original strand, 997578 - 997623
Alignment:
99 tgtttggattatgaaggagtatggaaatcaagagtcttggactaaa 144  Q
    ||||||| | |||||||| ||||||||| |||||||||||||||||    
997578 tgtttgggtaatgaaggaatatggaaataaagagtcttggactaaa 997623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 99 - 144
Target Start/End: Original strand, 1013968 - 1014013
Alignment:
99 tgtttggattatgaaggagtatggaaatcaagagtcttggactaaa 144  Q
    ||||||| | |||||||| ||||||||| |||||||||||||||||    
1013968 tgtttgggtaatgaaggaatatggaaataaagagtcttggactaaa 1014013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 162
Target Start/End: Original strand, 13479590 - 13479643
Alignment:
109 atgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaac 162  Q
    ||||| || ||||||| ||||||||||||||| ||||||| ||||||| |||||    
13479590 atgaaagaatatggaattcaagagtcttggacaaaattgttcactatttctaac 13479643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 95 - 156
Target Start/End: Complemental strand, 14888665 - 14888604
Alignment:
95 tggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactatt 156  Q
    |||| |||||||||||||| || |||| |||| ||||| ||| |||||||||||||| ||||    
14888665 tggaggtttggattatgaatgaatatgaaaataaagagccttagactaaattgtacaatatt 14888604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 99 - 148
Target Start/End: Original strand, 23197014 - 23197063
Alignment:
99 tgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    ||||||| | |||||||| ||||||||| |||| ||||||||||||||||    
23197014 tgtttggctgatgaaggaatatggaaatgaagaatcttggactaaattgt 23197063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 346 - 374
Target Start/End: Complemental strand, 9586987 - 9586959
Alignment:
346 gtctacattgagagtttgatatcacctta 374  Q
    |||||||||||||||||||||||||||||    
9586987 gtctacattgagagtttgatatcacctta 9586959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 72; Significance: 1e-32; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 265 - 428
Target Start/End: Original strand, 41456255 - 41456418
Alignment:
265 aagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgtctacattgagagtttga 364  Q
    ||||||||||||||||||| ||| | ||| || |||||||||||||||||||||||||| ||||| | || | || | ||| |||||||||||||||| |    
41456255 aagttggttgtttatgatttcaagattggtactttgaatattcctgagtttcaaaacaactatgaacggacagaccctaatatctacattgagagtttaa 41456354  T
365 tatcaccttaagctgggattcaactgcaacatatatatggttagtttttgtctgtgttatttat 428  Q
    |||||||||||||  | |||||| |||||| |  ||||||||| ||||||| ||||||||||||    
41456355 tatcaccttaagcacgaattcaaatgcaacgttgatatggttaatttttgtttgtgttatttat 41456418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 101 - 173
Target Start/End: Complemental strand, 20016232 - 20016160
Alignment:
101 tttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatca 173  Q
    ||||||| |||||||| ||||||| ||||||||||||||||||||||| |||| || ||||| ||||||||||    
20016232 tttggatcatgaaggaatatggaattcaagagtcttggactaaattgttcactctttctaacatgcaagatca 20016160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 97 - 172
Target Start/End: Complemental strand, 20019823 - 20019748
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatc 172  Q
    ||||||||| | |||||||| ||||||| ||||||||||||||||||||||| |||| || ||||| |||||||||    
20019823 gatgtttgggtcatgaaggaatatggaattcaagagtcttggactaaattgttcactctttctaacatgcaagatc 20019748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 93 - 158
Target Start/End: Original strand, 55419778 - 55419843
Alignment:
93 tttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcc 158  Q
    ||||||| | ||| |||||||||  ||||||||| |||| ||||||||||||||||  ||||||||    
55419778 tttggatatctggcttatgaaggtttatggaaataaagattcttggactaaattgtttactattcc 55419843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 100 - 156
Target Start/End: Complemental strand, 22672175 - 22672119
Alignment:
100 gtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactatt 156  Q
    |||||| | |||||||| ||||||||| | || |||||||||||||||| |||||||    
22672175 gtttgggtaatgaaggaatatggaaataaggaatcttggactaaattgttcactatt 22672119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0097 (Bit Score: 56; Significance: 5e-23; HSPs: 2)
Name: scaffold0097
Description:

Target: scaffold0097; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 368 - 470
Target Start/End: Original strand, 34231 - 34330
Alignment:
368 caccttaagctgggattcaactgcaacatatatatggttagtttttgtctgtgttatttatatgttatgcctgctctaattcttgattacttgttagatc 467  Q
    ||||||||||  |||||||||||||||||||||||||||||||||||| |||||||||  ||||||||||||||||| ||| ||| | ||||||| ||||    
34231 caccttaagcatggattcaactgcaacatatatatggttagtttttgtttgtgttatt--tatgttatgcctgctctgatt-ttggtgacttgtttgatc 34327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0097; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 268 - 321
Target Start/End: Original strand, 34168 - 34221
Alignment:
268 ttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaac 321  Q
    ||||||||||||||| ||||||||||||| | |||||||||| |||||||||||    
34168 ttggttgtttatgataccaaaactggcacttcgaatattcctcagtttcaaaac 34221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 52; Significance: 1e-20; HSPs: 17)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 52 - 151
Target Start/End: Original strand, 20292950 - 20293049
Alignment:
52 ttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtaca 151  Q
    |||||||||||||||||  ||| || ||||||||||    ||||||||||||||||||||||||| ||||||| | ||||||||||||||||||| ||||    
20292950 ttgagggattgcttgtgcatctatgtaactagtgatctggatttggatgtttggattatgaaggaatatggaattaaagagtcttggactaaattataca 20293049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 341 - 428
Target Start/End: Original strand, 20301675 - 20301763
Alignment:
341 caaatgtctacattgagagtttgatatcaccttaagc-tgggattcaactgcaacatatatatggttagtttttgtctgtgttatttat 428  Q
    |||| ||||||||||||||||| |||||||||||||| || || ||| |||||||||| ||||||||||||| ||| ||||||||||||    
20301675 caaaagtctacattgagagtttaatatcaccttaagcatgagactcagctgcaacatagatatggttagtttctgtttgtgttatttat 20301763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 341 - 428
Target Start/End: Original strand, 20306088 - 20306176
Alignment:
341 caaatgtctacattgagagtttgatatcaccttaagc-tgggattcaactgcaacatatatatggttagtttttgtctgtgttatttat 428  Q
    |||| ||||||||||||||||| |||||||||||||| || || ||| |||||||||| ||||||||||||| ||| ||||||||||||    
20306088 caaaagtctacattgagagtttaatatcaccttaagcatgagactcagctgcaacatagatatggttagtttctgtttgtgttatttat 20306176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 341 - 428
Target Start/End: Original strand, 20310492 - 20310580
Alignment:
341 caaatgtctacattgagagtttgatatcaccttaagc-tgggattcaactgcaacatatatatggttagtttttgtctgtgttatttat 428  Q
    |||| ||||||||||||||||| |||||||||||||| || || ||| |||||||||| ||||||||||||| ||| ||||||||||||    
20310492 caaaagtctacattgagagtttaatatcaccttaagcatgagactcagctgcaacatagatatggttagtttctgtttgtgttatttat 20310580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 52 - 151
Target Start/End: Original strand, 20301398 - 20301497
Alignment:
52 ttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtaca 151  Q
    |||||||||||||||||  ||| || ||||||||||    ||||||||||||||||||||||||| |||| || | ||||||||||||||||||| ||||    
20301398 ttgagggattgcttgtgcatctatgtaactagtgatctggatttggatgtttggattatgaaggaatatgcaattaaagagtcttggactaaattataca 20301497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 52 - 151
Target Start/End: Original strand, 20305811 - 20305910
Alignment:
52 ttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtaca 151  Q
    |||||||||||||||||  ||| || ||||||||||    |||||||||| |||||||||||||| ||||||| | ||||||||||||||||||| ||||    
20305811 ttgagggattgcttgtgcatctatgtaactagtgatctggatttggatgtctggattatgaaggaatatggaattaaagagtcttggactaaattataca 20305910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 52 - 151
Target Start/End: Original strand, 20310215 - 20310314
Alignment:
52 ttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtaca 151  Q
    |||||||||||||||||  ||| || ||||||||||    |||||||||| |||||||||||||| ||||||| | ||||||||||||||||||| ||||    
20310215 ttgagggattgcttgtgcatctatgtaactagtgatctggatttggatgtctggattatgaaggaatatggaattaaagagtcttggactaaattataca 20310314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 97 - 159
Target Start/End: Original strand, 11081813 - 11081875
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    ||||||||| |||||||||||||||||||| |||||||||||||||||||||  |||||||||    
11081813 gatgtttgggttatgaaggagtatggaaataaagagtcttggactaaattgtttactattcct 11081875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 97 - 156
Target Start/End: Complemental strand, 23766913 - 23766854
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactatt 156  Q
    ||||||||||||||||| || ||||||||| ||||||||||||||||||||| |||||||    
23766913 gatgtttggattatgaaagaatatggaaataaagagtcttggactaaattgttcactatt 23766854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 97 - 156
Target Start/End: Complemental strand, 23816761 - 23816702
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactatt 156  Q
    ||||||||||||||||| || ||||||||| ||||||||||||||||||||| |||||||    
23816761 gatgtttggattatgaaagaatatggaaataaagagtcttggactaaattgttcactatt 23816702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 341 - 428
Target Start/End: Original strand, 20293228 - 20293316
Alignment:
341 caaatgtctacattgagagtttgatatcaccttaagc-tgggattcaactgcaacatatatatggttagtttttgtctgtgttatttat 428  Q
    |||| ||||||||||||||||| ||||||||||||||  | ||  ||||||||||||| ||||||||||||| ||| ||| ||||||||    
20293228 caaaagtctacattgagagtttaatatcaccttaagcaagagacacaactgcaacatagatatggttagtttctgtttgttttatttat 20293316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 97 - 155
Target Start/End: Complemental strand, 23769697 - 23769639
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactat 155  Q
    |||||||||||||||||||| ||||| ||| ||| ||||||||||||||||| ||||||    
23769697 gatgtttggattatgaaggaatatgggaataaagcgtcttggactaaattgttcactat 23769639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 97 - 155
Target Start/End: Complemental strand, 23819545 - 23819487
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactat 155  Q
    |||||||||||||||||||| ||||| ||| ||| ||||||||||||||||| ||||||    
23819545 gatgtttggattatgaaggaatatgggaataaagcgtcttggactaaattgttcactat 23819487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 96 - 152
Target Start/End: Complemental strand, 2067104 - 2067048
Alignment:
96 ggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacac 152  Q
    |||||||||||||||||||||||||||||||  || |||||||| |||| |||||||    
2067104 ggatgtttggattatgaaggagtatggaaatgtagggtcttggattaaactgtacac 2067048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 147
Target Start/End: Original strand, 3181717 - 3181767
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattg 147  Q
    ||||||||| |||||||||| ||||||||| |||||||||||| |||||||    
3181717 gatgtttggcttatgaaggaatatggaaatgaagagtcttggattaaattg 3181767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 159
Target Start/End: Original strand, 23732167 - 23732229
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    |||||||||||||||||||| ||||| ||| ||| |||||||| |||| ||| ||||||||||    
23732167 gatgtttggattatgaaggaatatgggaataaagcgtcttggaataaactgttcactattcct 23732229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 97 - 159
Target Start/End: Complemental strand, 23861077 - 23861015
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    ||||||||||| |||||||| ||||| |   ||| ||||||||||||||||| ||||||||||    
23861077 gatgtttggataatgaaggaatatgggatgaaagcgtcttggactaaattgttcactattcct 23861015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0044 (Bit Score: 48; Significance: 3e-18; HSPs: 2)
Name: scaffold0044
Description:

Target: scaffold0044; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 57 - 172
Target Start/End: Original strand, 89103 - 89218
Alignment:
57 ggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactatt 156  Q
    ||||||||||||  ||||| ||| |||||||  || ||| ||| ||||| |||||||||| ||||||||| |||||||||||||||||||||||| | ||    
89103 ggattgcttgtgcatctttacaagtagtgatatattttttgatatttgggttatgaaggaatatggaaataaagagtcttggactaaattgtacaatgtt 89202  T
157 cctaacctgcaagatc 172  Q
    ||| || || ||||||    
89203 ccttacatggaagatc 89218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0044; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 268 - 373
Target Start/End: Original strand, 89311 - 89416
Alignment:
268 ttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaacaaatatgacctgatatactcaaatgtctacattgagagtttgatat 367  Q
    ||||||||||||||||| |||| ||| || ||||| ||||||| | |||||||||   ||   | |||  || |||| ||||||||||||||||||||||    
89311 ttggttgtttatgattcaaaaaatggtactttgaagattcctgtgattcaaaacatcaatcgtcggatggacccaaaagtctacattgagagtttgatat 89410  T
368 cacctt 373  Q
    ||||||    
89411 cacctt 89416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 47; Significance: 1e-17; HSPs: 10)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 52 - 150
Target Start/End: Original strand, 33038115 - 33038213
Alignment:
52 ttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtac 150  Q
    |||||||||||||||||  ||||||||| |||||||   | ||| |||||||||||||||||||| ||||||||  || |||||||||||| |||||||    
33038115 ttgagggattgcttgtgcatctttgcaagtagtgatatgttttttgatgtttggattatgaaggaatatggaaacaaaaagtcttggactagattgtac 33038213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 52 - 150
Target Start/End: Original strand, 33020268 - 33020366
Alignment:
52 ttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtac 150  Q
    |||||||||||||||||  ||||||||| |||||||   | |||  |||| |||||||||||||| ||||||||| || |||||||||||| |||||||    
33020268 ttgagggattgcttgtgcttctttgcaaatagtgatatgttttttaatgtgtggattatgaaggaatatggaaataaaaagtcttggactagattgtac 33020366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 148
Target Start/End: Original strand, 36577366 - 36577417
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    |||||||||||||||||||| ||||||||| |||||||||||| ||||||||    
36577366 gatgtttggattatgaaggaatatggaaataaagagtcttggattaaattgt 36577417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 97 - 148
Target Start/End: Complemental strand, 7156243 - 7156192
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    ||||||||| |||||||||||||||||||| |||| |||||| |||||||||    
7156243 gatgtttggcttatgaaggagtatggaaatgaagattcttgggctaaattgt 7156192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 97 - 148
Target Start/End: Complemental strand, 7160805 - 7160754
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    ||||||||| |||||||||||||||||||| | || ||||||||||||||||    
7160805 gatgtttggcttatgaaggagtatggaaataatgattcttggactaaattgt 7160754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 52 - 150
Target Start/End: Original strand, 33026612 - 33026710
Alignment:
52 ttgagggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtac 150  Q
    |||||||||||||||||  |||||| ||  | ||||   | ||||||||||||| |||||||| | ||||||||| || |||||||||||| |||||||    
33026612 ttgagggattgcttgtgcatctttgtaagaaatgatatgtttttggatgtttgggttatgaagcaatatggaaataaaaagtcttggactagattgtac 33026710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 107 - 148
Target Start/End: Original strand, 6538844 - 6538885
Alignment:
107 ttatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    |||||||||||||||||||| |||| ||||||||||||||||    
6538844 ttatgaaggagtatggaaataaagattcttggactaaattgt 6538885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 97 - 148
Target Start/End: Complemental strand, 7174424 - 7174373
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    ||||| ||| |||||||||| |||||||||||||| |||||||||| |||||    
7174424 gatgtctggcttatgaaggaatatggaaatcaagattcttggactagattgt 7174373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 322
Target Start/End: Original strand, 33020478 - 33020535
Alignment:
265 aagttggttgtttatgattccaaaactggcacattgaatattcctgagtttcaaaaca 322  Q
    |||||||||||||| |||||||||  ||| || ||||| ||||||||| |||||||||    
33020478 aagttggttgtttacgattccaaagatggtactttgaagattcctgagattcaaaaca 33020535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 100 - 148
Target Start/End: Complemental strand, 7168738 - 7168690
Alignment:
100 gtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    |||||| |||||||||| ||||||||| | || ||||||||||||||||    
7168738 gtttggcttatgaaggaatatggaaataacgattcttggactaaattgt 7168690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 44; Significance: 8e-16; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 346 - 428
Target Start/End: Original strand, 39299222 - 39299305
Alignment:
346 gtctacattgagagtttgatatcaccttaagc-tgggattcaactgcaacatatatatggttagtttttgtctgtgttatttat 428  Q
    |||||||||||||| ||||||| ||||||||| || ||||||||| ||| || || ||||||||||||||| ||||||||||||    
39299222 gtctacattgagagcttgatattaccttaagcatgagattcaactacaagatctacatggttagtttttgtttgtgttatttat 39299305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 96 - 148
Target Start/End: Complemental strand, 1078212 - 1078160
Alignment:
96 ggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    |||||||||| ||||||||||||||||||||  |||||| |||||||||||||    
1078212 ggatgtttgggttatgaaggagtatggaaatagagagtcgtggactaaattgt 1078160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 97 - 147
Target Start/End: Complemental strand, 1421220 - 1421170
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattg 147  Q
    ||||||||| |||||||||| || |||||| |||||||||||| |||||||    
1421220 gatgtttggcttatgaaggaatacggaaataaagagtcttggattaaattg 1421170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 97 - 174
Target Start/End: Original strand, 39298977 - 39299054
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcctaacctgcaagatcag 174  Q
    ||||||||| || ||||||| | ||||||| ||||||| ||||||||||| |||| | ||||| || || ||||||||    
39298977 gatgtttgggttttgaaggaatgtggaaataaagagtcctggactaaattttacagtgttccttacatggaagatcag 39299054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 98 - 157
Target Start/End: Complemental strand, 24417536 - 24417477
Alignment:
98 atgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattc 157  Q
    |||||||||||||||| || ||||||||| |||| ||||||||||||||||||| |||||    
24417536 atgtttggattatgaaagaatatggaaataaagaatcttggactaaattgtacagtattc 24417477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 99 - 148
Target Start/End: Original strand, 19119065 - 19119114
Alignment:
99 tgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    ||||||| | |||||||| ||||||||| |||||||||||||||||||||    
19119065 tgtttggttgatgaaggaatatggaaatgaagagtcttggactaaattgt 19119114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 99 - 148
Target Start/End: Original strand, 19126359 - 19126408
Alignment:
99 tgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    ||||||| | |||||||| ||||||||| |||||||||||||||||||||    
19126359 tgtttggttgatgaaggaatatggaaatgaagagtcttggactaaattgt 19126408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 97 - 148
Target Start/End: Original strand, 17368366 - 17368417
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    ||||||||| | ||||| |||||||||||| ||| |||||||||||||||||    
17368366 gatgtttggctgatgaaagagtatggaaatgaagggtcttggactaaattgt 17368417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 93 - 158
Target Start/End: Original strand, 176330 - 176395
Alignment:
93 tttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcc 158  Q
    ||||||| |||||  |||||| || ||||||||| |||| |||||||||||||||| |||| ||||    
176330 tttggatatttggcgtatgaatgattatggaaataaagattcttggactaaattgttcactcttcc 176395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 100 - 148
Target Start/End: Complemental strand, 370833 - 370785
Alignment:
100 gtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    |||||| |||||||| | ||||||||| |||| ||||||||||||||||    
370833 gtttgggttatgaagaattatggaaataaagattcttggactaaattgt 370785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 6)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 101 - 159
Target Start/End: Complemental strand, 51381502 - 51381444
Alignment:
101 tttggattatgaaggagtatggaaatcaagagtcttggactaaattgtacactattcct 159  Q
    ||||||||||||| || ||||||||| ||||||||||||||||||||| || |||||||    
51381502 tttggattatgaaagaatatggaaatgaagagtcttggactaaattgttcagtattcct 51381444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 97 - 148
Target Start/End: Original strand, 51858606 - 51858657
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    ||||||||||| |||||||| |||||||||  ||| ||||||||||||||||    
51858606 gatgtttggatcatgaaggaatatggaaatgtagaatcttggactaaattgt 51858657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 97 - 138
Target Start/End: Complemental strand, 23896188 - 23896147
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttgg 138  Q
    ||||||||| |||||||||| ||||||||| |||||||||||    
23896188 gatgtttggcttatgaaggaatatggaaataaagagtcttgg 23896147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 97 - 146
Target Start/End: Complemental strand, 24629262 - 24629213
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaatt 146  Q
    ||||||||| |||||||||| || |||||| |||||||||||| ||||||    
24629262 gatgtttggcttatgaaggaatacggaaataaagagtcttggattaaatt 24629213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 103 - 148
Target Start/End: Complemental strand, 51407604 - 51407559
Alignment:
103 tggattatgaaggagtatggaaatcaagagtcttggactaaattgt 148  Q
    |||||||||||||| ||||| ||| || ||||||||||||||||||    
51407604 tggattatgaaggaatatgggaatgaacagtcttggactaaattgt 51407559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 97 - 146
Target Start/End: Original strand, 51782799 - 51782848
Alignment:
97 gatgtttggattatgaaggagtatggaaatcaagagtcttggactaaatt 146  Q
    |||||||||||||||||||| ||||||||| || | ||||||| ||||||    
51782799 gatgtttggattatgaaggaatatggaaatgaacaatcttggaataaatt 51782848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1004 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold1004
Description:

Target: scaffold1004; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 57 - 145
Target Start/End: Original strand, 2103 - 2191
Alignment:
57 ggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaat 145  Q
    ||||||||||||  ||||||||| || |||||  | |||| ||||||||  ||||||||| |||||||||  |||||||||||||||||    
2103 ggattgcttgtgcatctttgcaagtaatgatgtgtttttgaatgtttgggctatgaaggaatatggaaatgtagagtcttggactaaat 2191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0760 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0760
Description:

Target: scaffold0760; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 57 - 145
Target Start/End: Original strand, 4598 - 4686
Alignment:
57 ggattgcttgtgtgtctttgcaactagtgatgaatatttggatgtttggattatgaaggagtatggaaatcaagagtcttggactaaat 145  Q
    ||||||||||||  ||||||||| || |||||  | |||| ||||||||  ||||||||| |||||||||  |||||||||||||||||    
4598 ggattgcttgtgcatctttgcaagtaatgatgtgtttttgaatgtttgggctatgaaggaatatggaaatgtagagtcttggactaaat 4686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125308 times since January 2019
Visitors: 1457