View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9333-LTR4-TNT-insertion-2 (Length: 693)

Name: F9333-LTR4-TNT-insertion-2
Description: F9333-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9333-LTR4-TNT-insertion-2
[»] chr3 (5 HSPs)
chr3 (8-684)||(44992416-44993092)
chr3 (455-547)||(11267642-11267734)
chr3 (445-501)||(44993755-44993811)
chr3 (455-523)||(1127364-1127432)
chr3 (480-536)||(50305645-50305701)
[»] chr2 (9 HSPs)
chr2 (455-523)||(30901384-30901452)
chr2 (638-684)||(30901466-30901512)
chr2 (484-600)||(36718926-36719041)
chr2 (454-546)||(30902129-30902222)
chr2 (453-491)||(1442350-1442388)
chr2 (455-525)||(2992833-2992903)
chr2 (455-504)||(6198902-6198951)
chr2 (455-523)||(2992002-2992070)
chr2 (480-536)||(26021033-26021089)
[»] chr8 (5 HSPs)
chr8 (451-523)||(39656894-39656966)
chr8 (452-491)||(35237962-35238001)
chr8 (454-504)||(45163116-45163166)
chr8 (436-502)||(8491447-8491515)
chr8 (454-491)||(29184189-29184226)
[»] scaffold0041 (2 HSPs)
scaffold0041 (454-550)||(44184-44280)
scaffold0041 (455-504)||(44938-44987)
[»] chr7 (7 HSPs)
chr7 (454-550)||(40905738-40905834)
chr7 (453-503)||(36661683-36661733)
chr7 (454-492)||(38315783-38315821)
chr7 (454-491)||(34827788-34827825)
chr7 (455-504)||(40905031-40905080)
chr7 (455-523)||(3820394-3820462)
chr7 (455-491)||(43551147-43551183)
[»] chr5 (6 HSPs)
chr5 (453-525)||(39949490-39949562)
chr5 (454-521)||(6353683-6353750)
chr5 (455-521)||(30003548-30003614)
chr5 (454-523)||(39950313-39950382)
chr5 (455-504)||(41784622-41784671)
chr5 (456-504)||(18669867-18669915)
[»] chr4 (5 HSPs)
chr4 (455-523)||(37142692-37142760)
chr4 (455-525)||(17979092-17979162)
chr4 (453-521)||(5825332-5825400)
chr4 (455-523)||(17978263-17978331)
chr4 (455-523)||(32894680-32894748)
[»] chr1 (8 HSPs)
chr1 (454-502)||(45597623-45597671)
chr1 (452-503)||(22862600-22862651)
chr1 (453-491)||(13536279-13536317)
chr1 (454-504)||(51129372-51129422)
chr1 (454-503)||(22425521-22425570)
chr1 (480-536)||(3789305-3789361)
chr1 (455-523)||(4530193-4530261)
chr1 (455-523)||(51132289-51132357)
[»] chr6 (2 HSPs)
chr6 (455-504)||(1528561-1528610)
chr6 (454-503)||(6841956-6842005)

Alignment Details
Target: chr3 (Bit Score: 673; Significance: 0; HSPs: 5)
Name: chr3

Target: chr3; HSP #1
Raw Score: 673; E-Value: 0
Query Start/End: Original strand, 8 - 684
Target Start/End: Original strand, 44992416 - 44993092
8 aaaatgtgggattaaaattaaacctaattacagtttaatcggagatcattagttatatgaaacatcttttctttaagaggatgaaaccatcttttagtga 107  Q
44992416 aaaatgtgggattaaaattaaacctaattacagtttaatcggagatcattagttatatgaaacatcttttctttaagaggatgaaaccatcttttagtga 44992515  T
108 aattgaaagttaatcaagaaataatctaatagctcttaacaatgattcatttttctttacaaaaaggaaagaactttgtccattgggtcatttgggtgtg 207  Q
44992516 aattgaaagttaatcaagaaataatctaatagctcttaacaatgattcatttttctttacaaaaaggaaagaactttgtccattgggtcatttgggtgtg 44992615  T
208 agcttcataatttctcttaagagtgttaattaagtacgaaagttgagatttttaagaactaagctatgaagcaaaatgaaaaggaagttgggtaaatgca 307  Q
44992616 agcttcataatttctcttaagagtgttaattaagtacgaaagttgagatttttaagaactaagctatgaagcaaaatgaaaaggaagttgggtaaatgca 44992715  T
308 agtaaaaccgatagtttgagtgagtctaaaacaaaattgacaagtggtatttatagaatatatgacaaagcacgtgattgtgttgccaacaaagacatgc 407  Q
44992716 agtaaaaccgatagtttgagtgagtctaaaacaaaattgacaagtggtatttatagaatatatgacaaagcacgtgattgtgttgccaacaaagacatgc 44992815  T
408 tcagaatgttgcgagtccgtgagaagaaaaaactaacataataattaggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttctt 507  Q
44992816 tcagaatgttgcgagtccgtgagaagaaaaaactaacataataattaggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttctt 44992915  T
508 ttgaaccattagattagataaagaacatatccttatcatagacattcaatacatgattatttttactctcctccgtatctctttcacccaccaccacttg 607  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44992916 ttgaaccattagattagataaagaacatatccttatcatatacattcaatacatgattatttttactctcctccgtatctctttcacccaccaccacttg 44993015  T
608 gagcaatttcactcaacccatttaagaacattcttccatgcactttagaatttatggtagaggtcgtaaaacaattg 684  Q
44993016 gagcaatttcactcaacccatttaagaacattcttccatgcactttagaatttatggtagaggtcgtaaaacaattg 44993092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 455 - 547
Target Start/End: Complemental strand, 11267734 - 11267642
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagattagataaagaacatatccttatcata 547  Q
    ||||||||||||||||| |||||| |||| ||||||||||| ||||| |   ||| ||||||||||||| ||||||| ||||  |||||||||    
11267734 ggtggcatttagggtgggtgagggaaagaatttcctaccatgggaaaataaattttaaccattagattaaataaagagcatactcttatcata 11267642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 445 - 501
Target Start/End: Complemental strand, 44993811 - 44993755
445 ataataattaggtggcatttagggtggttgagggcaagagtttcctaccataggaaa 501  Q
    ||||| ||||||||||||||||||||| |||||| |||||||||||||||| |||||    
44993811 ataattattaggtggcatttagggtgggtgagggaaagagtttcctaccatgggaaa 44993755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 455 - 523
Target Start/End: Original strand, 1127364 - 1127432
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    ||||||||||||||||| |||||| || ||||||| |||||  ||||||| |||  |||||| ||||||    
1127364 ggtggcatttagggtgggtgagggaaaaagtttcccaccatgagaaagttttttctaaccataagatta 1127432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 480 - 536
Target Start/End: Original strand, 50305645 - 50305701
480 aagagtttcctaccataggaaagttcttttgaaccattagattagataaagaacata 536  Q
    |||||||||||||||||||||||||  ||| | ||||||||||| || ||| |||||    
50305645 aagagtttcctaccataggaaagttgattttagccattagattaaatcaagtacata 50305701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 65; Significance: 3e-28; HSPs: 9)
Name: chr2

Target: chr2; HSP #1
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 455 - 523
Target Start/End: Original strand, 30901384 - 30901452
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
30901384 ggtggcatttagggtgggtgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 30901452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 638 - 684
Target Start/End: Original strand, 30901466 - 30901512
638 ttcttccatgcactttagaatttatggtagaggtcgtaaaacaattg 684  Q
30901466 ttcttccatgcactttagaatttatggtagaggtcgtaaaacaattg 30901512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 484 - 600
Target Start/End: Complemental strand, 36719041 - 36718926
484 gtttcctaccataggaaagttcttttgaaccattagattagataaagaacatatccttatcatagacattcaatacatgattatttttactctcctccgt 583  Q
    ||||||||||||||||||| |  ||| |||||||| |||| ||||  ||||||   |||||||||||||| || ||| |||| |||| |||||||||| |    
36719041 gtttcctaccataggaaagctaattttaaccattaaattaaataagaaacatacttttatcatagacattgaacacaagatt-ttttcactctcctccat 36718943  T
584 atctctttcacccacca 600  Q
     ||||| ||||||||||    
36718942 ctctctctcacccacca 36718926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 454 - 546
Target Start/End: Complemental strand, 30902222 - 30902129
454 aggtggcatttagggtggttgagggcaagagtttcctaccataggaaagtt--cttttgaaccattagattagataaagaacatatccttatcat 546  Q
    |||||||||||||||||| |||||| |||||||||||||||| | ||| ||   ||||| || ||||||||| || |||||||||| ||||||||    
30902222 aggtggcatttagggtgggtgagggaaagagtttcctaccatggaaaaatttgattttg-actattagattaaattaagaacatattcttatcat 30902129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 453 - 491
Target Start/End: Original strand, 1442350 - 1442388
453 taggtggcatttagggtggttgagggcaagagtttccta 491  Q
    ||||||||||||||||||| |||||| ||||||||||||    
1442350 taggtggcatttagggtgggtgagggaaagagtttccta 1442388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 455 - 525
Target Start/End: Complemental strand, 2992903 - 2992833
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagattaga 525  Q
    ||||||||||||||||| |||||| |||||||| | || || | |||||| ||||  ||||||||||||||    
2992903 ggtggcatttagggtgggtgagggaaagagttttccactatggaaaagtttttttataccattagattaga 2992833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 455 - 504
Target Start/End: Complemental strand, 6198951 - 6198902
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagtt 504  Q
    ||||||||||||||||| |||||| |||| ||||| | ||||||||||||    
6198951 ggtggcatttagggtgggtgagggaaagaatttcccatcataggaaagtt 6198902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 455 - 523
Target Start/End: Original strand, 2992002 - 2992070
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    |||||||||||||||||  | ||| |||||||||| | ||| |||||||| |||| | |||||||||||    
2992002 ggtggcatttagggtgggcgggggaaagagtttcccaacatgggaaagttatttttagccattagatta 2992070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 480 - 536
Target Start/End: Original strand, 26021033 - 26021089
480 aagagtttcctaccataggaaagttcttttgaaccattagattagataaagaacata 536  Q
    |||||||||||||||||||||||||  ||| | ||||||||||| || ||| |||||    
26021033 aagagtttcctaccataggaaagttgattttagccattagattaaatcaagtacata 26021089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.00000000002; HSPs: 5)
Name: chr8

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 451 - 523
Target Start/End: Complemental strand, 39656966 - 39656894
451 attaggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    ||||||||||||||||||||| |  ||| ||||||||||||| ||||||||||| ||||  |||| |||||||    
39656966 attaggtggcatttagggtgggtaggggaaagagtttcctactataggaaagtttttttttaccaatagatta 39656894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 452 - 491
Target Start/End: Original strand, 35237962 - 35238001
452 ttaggtggcatttagggtggttgagggcaagagtttccta 491  Q
    |||||||||||||||||||| |||||| ||||||||||||    
35237962 ttaggtggcatttagggtgggtgagggaaagagtttccta 35238001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 454 - 504
Target Start/End: Complemental strand, 45163166 - 45163116
454 aggtggcatttagggtggttgagggcaagagtttcctaccataggaaagtt 504  Q
    |||||||||||||||||| |||||| |||| ||||| | ||||||||||||    
45163166 aggtggcatttagggtgggtgagggaaagattttcccatcataggaaagtt 45163116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 436 - 502
Target Start/End: Original strand, 8491447 - 8491515
436 aaaactaacataataatta--ggtggcatttagggtggttgagggcaagagtttcctaccataggaaag 502  Q
    |||||||||||||  ||||  ||||||||||||||||| |||||| |||| ||||| || |||||||||    
8491447 aaaactaacataagtattaaaggtggcatttagggtgggtgagggaaagattttcccactataggaaag 8491515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 454 - 491
Target Start/End: Original strand, 29184189 - 29184226
454 aggtggcatttagggtggttgagggcaagagtttccta 491  Q
    |||||||||||||||||| |||||| ||||||||||||    
29184189 aggtggcatttagggtgggtgagggaaagagtttccta 29184226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 33; Significance: 0.000000004; HSPs: 2)
Name: scaffold0041

Target: scaffold0041; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 454 - 550
Target Start/End: Original strand, 44184 - 44280
454 aggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagattagataaagaacatatccttatcatagac 550  Q
    |||||||||||||||||| |||||  |||||||||| |  |||||||||||  |||  ||| |||||| | |||||||||| ||  |||||||||||    
44184 aggtggcatttagggtgggtgaggcaaagagtttcccattataggaaagttaattttgacccttagatcaaataaagaacacatttttatcatagac 44280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 455 - 504
Target Start/End: Complemental strand, 44987 - 44938
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagtt 504  Q
    ||||||||||||||||| |||||  ||||||||||||| || ||||||||    
44987 ggtggcatttagggtgggtgaggcaaagagtttcctactatgggaaagtt 44938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000004; HSPs: 7)
Name: chr7

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 454 - 550
Target Start/End: Complemental strand, 40905834 - 40905738
454 aggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagattagataaagaacatatccttatcatagac 550  Q
    |||||||||||||||||| |||||  |||||||||| |  |||||||||||  |||  ||| |||||| | |||||||||| ||  |||||||||||    
40905834 aggtggcatttagggtgggtgaggcaaagagtttcccattataggaaagttaattttgacccttagatcaaataaagaacacatttttatcatagac 40905738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 453 - 503
Target Start/End: Original strand, 36661683 - 36661733
453 taggtggcatttagggtggttgagggcaagagtttcctaccataggaaagt 503  Q
    ||||||||||||||||||| |||||| |||| ||||| ||||| |||||||    
36661683 taggtggcatttagggtgggtgagggaaagaatttcccaccatgggaaagt 36661733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 454 - 492
Target Start/End: Original strand, 38315783 - 38315821
454 aggtggcatttagggtggttgagggcaagagtttcctac 492  Q
    |||||||||||||||||| |||||| |||||||||||||    
38315783 aggtggcatttagggtgggtgagggaaagagtttcctac 38315821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 454 - 491
Target Start/End: Complemental strand, 34827825 - 34827788
454 aggtggcatttagggtggttgagggcaagagtttccta 491  Q
    |||||||||||||||||| |||||| ||||||||||||    
34827825 aggtggcatttagggtgggtgagggaaagagtttccta 34827788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 455 - 504
Target Start/End: Original strand, 40905031 - 40905080
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagtt 504  Q
    ||||||||||||||||| |||||  ||||||||||||| || ||||||||    
40905031 ggtggcatttagggtgggtgaggcaaagagtttcctactatgggaaagtt 40905080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 455 - 523
Target Start/End: Original strand, 3820394 - 3820462
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    ||||||||||||||||| |  | | ||||||||||||| ||||||||||| ||||  |||| |||||||    
3820394 ggtggcatttagggtgggtaggtgaaagagtttcctactataggaaagtttttttttaccaatagatta 3820462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 455 - 491
Target Start/End: Original strand, 43551147 - 43551183
455 ggtggcatttagggtggttgagggcaagagtttccta 491  Q
    ||||||||||||||||| |||||| ||||||||||||    
43551147 ggtggcatttagggtgggtgagggaaagagtttccta 43551183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000004; HSPs: 6)
Name: chr5

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 453 - 525
Target Start/End: Original strand, 39949490 - 39949562
453 taggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagattaga 525  Q
    ||||||||||||||||||| |||||| |||||||| | || || | |||||| ||||  ||||||||||||||    
39949490 taggtggcatttagggtgggtgagggaaagagttttccactatggaaaagtttttttataccattagattaga 39949562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 454 - 521
Target Start/End: Original strand, 6353683 - 6353750
454 aggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagat 521  Q
    |||||||||||||||||| |||||| |||| ||||| | |||||||||||   ||| |||||||||||    
6353683 aggtggcatttagggtgggtgagggaaagattttcccatcataggaaagtaaattttaaccattagat 6353750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 455 - 521
Target Start/End: Complemental strand, 30003614 - 30003548
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagat 521  Q
    ||||||||||||||||| | |||| |||||||||||||||||  ||||||  |||  ||||||||||    
30003614 ggtggcatttagggtgggtaagggaaagagtttcctaccataaaaaagttgattttgaccattagat 30003548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 454 - 523
Target Start/End: Complemental strand, 39950382 - 39950313
454 aggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    ||||||||||||||||||  | ||| |||||||||| | ||| |||||||| |||| | |||||||||||    
39950382 aggtggcatttagggtgggcgggggaaagagtttcccaacatgggaaagttatttttagccattagatta 39950313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 455 - 504
Target Start/End: Original strand, 41784622 - 41784671
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagtt 504  Q
    ||||||||||||||||| |||||| |||||||| |||| || ||||||||    
41784622 ggtggcatttagggtgggtgagggaaagagttttctactatgggaaagtt 41784671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 456 - 504
Target Start/End: Original strand, 18669867 - 18669915
456 gtggcatttagggtggttgagggcaagagtttcctaccataggaaagtt 504  Q
    |||||||||||||||| |||||| |||||||||| |||||  |||||||    
18669867 gtggcatttagggtgggtgagggaaagagtttcccaccatgagaaagtt 18669915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000004; HSPs: 5)
Name: chr4

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 455 - 523
Target Start/End: Complemental strand, 37142760 - 37142692
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    ||||||||||||||||| || ||| |||||||||| | ||| |||||||| |||| | |||||||||||    
37142760 ggtggcatttagggtgggtgggggaaagagtttcccaacatgggaaagttatttttagccattagatta 37142692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 455 - 525
Target Start/End: Complemental strand, 17979162 - 17979092
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagattaga 525  Q
    ||||||||||||||||| |||||| |||||||| | || || | |||||| ||||  ||||||||||||||    
17979162 ggtggcatttagggtgggtgagggaaagagttttccactatggaaaagtttttttataccattagattaga 17979092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 453 - 521
Target Start/End: Original strand, 5825332 - 5825400
453 taggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagat 521  Q
    |||||||||||||||||||    ||| |||||||||| ||||||| |||||| |||  |||||||||||    
5825332 taggtggcatttagggtgggaatgggaaagagtttcccaccatagcaaagttttttctaaccattagat 5825400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 455 - 523
Target Start/End: Original strand, 17978263 - 17978331
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    |||||||||||||||||  | ||| |||||||||| | ||| |||||||| |||| | |||||||||||    
17978263 ggtggcatttagggtgggcgggggaaagagtttcccaacatgggaaagttatttttagccattagatta 17978331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 455 - 523
Target Start/End: Complemental strand, 32894748 - 32894680
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    ||||||||||||| ||| |||||| ||||||||||||| || ||| |||| ||||  ||||| ||||||    
32894748 ggtggcatttaggatgggtgagggaaagagtttcctactatgggagagtttttttttaccataagatta 32894680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000004; HSPs: 8)
Name: chr1

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 454 - 502
Target Start/End: Original strand, 45597623 - 45597671
454 aggtggcatttagggtggttgagggcaagagtttcctaccataggaaag 502  Q
    |||||||||||||||||| |||||| |||| ||||| ||||||||||||    
45597623 aggtggcatttagggtgggtgagggaaagaatttcccaccataggaaag 45597671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 452 - 503
Target Start/End: Complemental strand, 22862651 - 22862600
452 ttaggtggcatttagggtggttgagggcaagagtttcctaccataggaaagt 503  Q
    |||||||||||||||| ||| |||||| |||| ||||| |||||||||||||    
22862651 ttaggtggcatttaggatgggtgagggaaagaatttcccaccataggaaagt 22862600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 453 - 491
Target Start/End: Original strand, 13536279 - 13536317
453 taggtggcatttagggtggttgagggcaagagtttccta 491  Q
    ||||||||||||||||||| |||||| ||||||||||||    
13536279 taggtggcatttagggtgggtgagggaaagagtttccta 13536317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 454 - 504
Target Start/End: Original strand, 51129372 - 51129422
454 aggtggcatttagggtggttgagggcaagagtttcctaccataggaaagtt 504  Q
    |||||||||||||||||| |||||| |||||||||| || || ||||||||    
51129372 aggtggcatttagggtgggtgagggaaagagtttcccactatgggaaagtt 51129422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 454 - 503
Target Start/End: Complemental strand, 22425570 - 22425521
454 aggtggcatttagggtggttgagggcaagagtttcctaccataggaaagt 503  Q
    |||||||||||||| ||| |||||| |||| ||||| |||||||||||||    
22425570 aggtggcatttaggatgggtgagggaaagaatttcccaccataggaaagt 22425521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 480 - 536
Target Start/End: Complemental strand, 3789361 - 3789305
480 aagagtttcctaccataggaaagttcttttgaaccattagattagataaagaacata 536  Q
    |||||||||||||||||||||||||  ||| | ||||||||||| || ||| |||||    
3789361 aagagtttcctaccataggaaagttgattttagccattagattaaatcaagtacata 3789305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 455 - 523
Target Start/End: Original strand, 4530193 - 4530261
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    ||||||||||||||||| |||||| |||| ||||| | ||||| |||||   ||| |||||||||||||    
4530193 ggtggcatttagggtgggtgagggaaagaatttcccatcatagaaaagtagcttttaaccattagatta 4530261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 455 - 523
Target Start/End: Complemental strand, 51132357 - 51132289
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    |||| |||||||||||| |||||| |||||||||| |||||  ||||||| |||  |||||| ||||||    
51132357 ggtgacatttagggtggatgagggaaagagtttcccaccatgagaaagttttttctaaccataagatta 51132289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: chr6

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 455 - 504
Target Start/End: Original strand, 1528561 - 1528610
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagtt 504  Q
    ||||||||||||||||| |||||| |||||||||| || || ||||||||    
1528561 ggtggcatttagggtgggtgagggaaagagtttcccactatgggaaagtt 1528610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 454 - 503
Target Start/End: Complemental strand, 6842005 - 6841956
454 aggtggcatttagggtggttgagggcaagagtttcctaccataggaaagt 503  Q
    |||||||||||||| ||| |||||| |||| ||||| |||||||||||||    
6842005 aggtggcatttaggatgggtgagggaaagaatttcccaccataggaaagt 6841956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 198756 times since January 2019
Visitors: 2774