View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9333-LTR4-TNT-insertion-2 (Length: 693)

Name: F9333-LTR4-TNT-insertion-2
Description: F9333-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9333-LTR4-TNT-insertion-2
F9333-LTR4-TNT-insertion-2
[»] chr3 (5 HSPs)
chr3 (8-684)||(44992416-44993092)
chr3 (455-547)||(11267642-11267734)
chr3 (445-501)||(44993755-44993811)
chr3 (455-523)||(1127364-1127432)
chr3 (480-536)||(50305645-50305701)
[»] chr2 (9 HSPs)
chr2 (455-523)||(30901384-30901452)
chr2 (638-684)||(30901466-30901512)
chr2 (484-600)||(36718926-36719041)
chr2 (454-546)||(30902129-30902222)
chr2 (453-491)||(1442350-1442388)
chr2 (455-525)||(2992833-2992903)
chr2 (455-504)||(6198902-6198951)
chr2 (455-523)||(2992002-2992070)
chr2 (480-536)||(26021033-26021089)
[»] chr8 (5 HSPs)
chr8 (451-523)||(39656894-39656966)
chr8 (452-491)||(35237962-35238001)
chr8 (454-504)||(45163116-45163166)
chr8 (436-502)||(8491447-8491515)
chr8 (454-491)||(29184189-29184226)
[»] scaffold0041 (2 HSPs)
scaffold0041 (454-550)||(44184-44280)
scaffold0041 (455-504)||(44938-44987)
[»] chr7 (7 HSPs)
chr7 (454-550)||(40905738-40905834)
chr7 (453-503)||(36661683-36661733)
chr7 (454-492)||(38315783-38315821)
chr7 (454-491)||(34827788-34827825)
chr7 (455-504)||(40905031-40905080)
chr7 (455-523)||(3820394-3820462)
chr7 (455-491)||(43551147-43551183)
[»] chr5 (6 HSPs)
chr5 (453-525)||(39949490-39949562)
chr5 (454-521)||(6353683-6353750)
chr5 (455-521)||(30003548-30003614)
chr5 (454-523)||(39950313-39950382)
chr5 (455-504)||(41784622-41784671)
chr5 (456-504)||(18669867-18669915)
[»] chr4 (5 HSPs)
chr4 (455-523)||(37142692-37142760)
chr4 (455-525)||(17979092-17979162)
chr4 (453-521)||(5825332-5825400)
chr4 (455-523)||(17978263-17978331)
chr4 (455-523)||(32894680-32894748)
[»] chr1 (8 HSPs)
chr1 (454-502)||(45597623-45597671)
chr1 (452-503)||(22862600-22862651)
chr1 (453-491)||(13536279-13536317)
chr1 (454-504)||(51129372-51129422)
chr1 (454-503)||(22425521-22425570)
chr1 (480-536)||(3789305-3789361)
chr1 (455-523)||(4530193-4530261)
chr1 (455-523)||(51132289-51132357)
[»] chr6 (2 HSPs)
chr6 (455-504)||(1528561-1528610)
chr6 (454-503)||(6841956-6842005)


Alignment Details
Target: chr3 (Bit Score: 673; Significance: 0; HSPs: 5)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 673; E-Value: 0
Query Start/End: Original strand, 8 - 684
Target Start/End: Original strand, 44992416 - 44993092
Alignment:
8 aaaatgtgggattaaaattaaacctaattacagtttaatcggagatcattagttatatgaaacatcttttctttaagaggatgaaaccatcttttagtga 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44992416 aaaatgtgggattaaaattaaacctaattacagtttaatcggagatcattagttatatgaaacatcttttctttaagaggatgaaaccatcttttagtga 44992515  T
108 aattgaaagttaatcaagaaataatctaatagctcttaacaatgattcatttttctttacaaaaaggaaagaactttgtccattgggtcatttgggtgtg 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44992516 aattgaaagttaatcaagaaataatctaatagctcttaacaatgattcatttttctttacaaaaaggaaagaactttgtccattgggtcatttgggtgtg 44992615  T
208 agcttcataatttctcttaagagtgttaattaagtacgaaagttgagatttttaagaactaagctatgaagcaaaatgaaaaggaagttgggtaaatgca 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44992616 agcttcataatttctcttaagagtgttaattaagtacgaaagttgagatttttaagaactaagctatgaagcaaaatgaaaaggaagttgggtaaatgca 44992715  T
308 agtaaaaccgatagtttgagtgagtctaaaacaaaattgacaagtggtatttatagaatatatgacaaagcacgtgattgtgttgccaacaaagacatgc 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44992716 agtaaaaccgatagtttgagtgagtctaaaacaaaattgacaagtggtatttatagaatatatgacaaagcacgtgattgtgttgccaacaaagacatgc 44992815  T
408 tcagaatgttgcgagtccgtgagaagaaaaaactaacataataattaggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttctt 507  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44992816 tcagaatgttgcgagtccgtgagaagaaaaaactaacataataattaggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttctt 44992915  T
508 ttgaaccattagattagataaagaacatatccttatcatagacattcaatacatgattatttttactctcctccgtatctctttcacccaccaccacttg 607  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44992916 ttgaaccattagattagataaagaacatatccttatcatatacattcaatacatgattatttttactctcctccgtatctctttcacccaccaccacttg 44993015  T
608 gagcaatttcactcaacccatttaagaacattcttccatgcactttagaatttatggtagaggtcgtaaaacaattg 684  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44993016 gagcaatttcactcaacccatttaagaacattcttccatgcactttagaatttatggtagaggtcgtaaaacaattg 44993092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 455 - 547
Target Start/End: Complemental strand, 11267734 - 11267642
Alignment:
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagattagataaagaacatatccttatcata 547  Q
    ||||||||||||||||| |||||| |||| ||||||||||| ||||| |   ||| ||||||||||||| ||||||| ||||  |||||||||    
11267734 ggtggcatttagggtgggtgagggaaagaatttcctaccatgggaaaataaattttaaccattagattaaataaagagcatactcttatcata 11267642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 445 - 501
Target Start/End: Complemental strand, 44993811 - 44993755
Alignment:
445 ataataattaggtggcatttagggtggttgagggcaagagtttcctaccataggaaa 501  Q
    ||||| ||||||||||||||||||||| |||||| |||||||||||||||| |||||    
44993811 ataattattaggtggcatttagggtgggtgagggaaagagtttcctaccatgggaaa 44993755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 455 - 523
Target Start/End: Original strand, 1127364 - 1127432
Alignment:
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    ||||||||||||||||| |||||| || ||||||| |||||  ||||||| |||  |||||| ||||||    
1127364 ggtggcatttagggtgggtgagggaaaaagtttcccaccatgagaaagttttttctaaccataagatta 1127432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 480 - 536
Target Start/End: Original strand, 50305645 - 50305701
Alignment:
480 aagagtttcctaccataggaaagttcttttgaaccattagattagataaagaacata 536  Q
    |||||||||||||||||||||||||  ||| | ||||||||||| || ||| |||||    
50305645 aagagtttcctaccataggaaagttgattttagccattagattaaatcaagtacata 50305701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 65; Significance: 3e-28; HSPs: 9)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 455 - 523
Target Start/End: Original strand, 30901384 - 30901452
Alignment:
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
30901384 ggtggcatttagggtgggtgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 30901452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 638 - 684
Target Start/End: Original strand, 30901466 - 30901512
Alignment:
638 ttcttccatgcactttagaatttatggtagaggtcgtaaaacaattg 684  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
30901466 ttcttccatgcactttagaatttatggtagaggtcgtaaaacaattg 30901512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 484 - 600
Target Start/End: Complemental strand, 36719041 - 36718926
Alignment:
484 gtttcctaccataggaaagttcttttgaaccattagattagataaagaacatatccttatcatagacattcaatacatgattatttttactctcctccgt 583  Q
    ||||||||||||||||||| |  ||| |||||||| |||| ||||  ||||||   |||||||||||||| || ||| |||| |||| |||||||||| |    
36719041 gtttcctaccataggaaagctaattttaaccattaaattaaataagaaacatacttttatcatagacattgaacacaagatt-ttttcactctcctccat 36718943  T
584 atctctttcacccacca 600  Q
     ||||| ||||||||||    
36718942 ctctctctcacccacca 36718926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 454 - 546
Target Start/End: Complemental strand, 30902222 - 30902129
Alignment:
454 aggtggcatttagggtggttgagggcaagagtttcctaccataggaaagtt--cttttgaaccattagattagataaagaacatatccttatcat 546  Q
    |||||||||||||||||| |||||| |||||||||||||||| | ||| ||   ||||| || ||||||||| || |||||||||| ||||||||    
30902222 aggtggcatttagggtgggtgagggaaagagtttcctaccatggaaaaatttgattttg-actattagattaaattaagaacatattcttatcat 30902129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 453 - 491
Target Start/End: Original strand, 1442350 - 1442388
Alignment:
453 taggtggcatttagggtggttgagggcaagagtttccta 491  Q
    ||||||||||||||||||| |||||| ||||||||||||    
1442350 taggtggcatttagggtgggtgagggaaagagtttccta 1442388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 455 - 525
Target Start/End: Complemental strand, 2992903 - 2992833
Alignment:
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagattaga 525  Q
    ||||||||||||||||| |||||| |||||||| | || || | |||||| ||||  ||||||||||||||    
2992903 ggtggcatttagggtgggtgagggaaagagttttccactatggaaaagtttttttataccattagattaga 2992833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 455 - 504
Target Start/End: Complemental strand, 6198951 - 6198902
Alignment:
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagtt 504  Q
    ||||||||||||||||| |||||| |||| ||||| | ||||||||||||    
6198951 ggtggcatttagggtgggtgagggaaagaatttcccatcataggaaagtt 6198902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 455 - 523
Target Start/End: Original strand, 2992002 - 2992070
Alignment:
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    |||||||||||||||||  | ||| |||||||||| | ||| |||||||| |||| | |||||||||||    
2992002 ggtggcatttagggtgggcgggggaaagagtttcccaacatgggaaagttatttttagccattagatta 2992070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 480 - 536
Target Start/End: Original strand, 26021033 - 26021089
Alignment:
480 aagagtttcctaccataggaaagttcttttgaaccattagattagataaagaacata 536  Q
    |||||||||||||||||||||||||  ||| | ||||||||||| || ||| |||||    
26021033 aagagtttcctaccataggaaagttgattttagccattagattaaatcaagtacata 26021089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.00000000002; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 451 - 523
Target Start/End: Complemental strand, 39656966 - 39656894
Alignment:
451 attaggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    ||||||||||||||||||||| |  ||| ||||||||||||| ||||||||||| ||||  |||| |||||||    
39656966 attaggtggcatttagggtgggtaggggaaagagtttcctactataggaaagtttttttttaccaatagatta 39656894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 452 - 491
Target Start/End: Original strand, 35237962 - 35238001
Alignment:
452 ttaggtggcatttagggtggttgagggcaagagtttccta 491  Q
    |||||||||||||||||||| |||||| ||||||||||||    
35237962 ttaggtggcatttagggtgggtgagggaaagagtttccta 35238001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 454 - 504
Target Start/End: Complemental strand, 45163166 - 45163116
Alignment:
454 aggtggcatttagggtggttgagggcaagagtttcctaccataggaaagtt 504  Q
    |||||||||||||||||| |||||| |||| ||||| | ||||||||||||    
45163166 aggtggcatttagggtgggtgagggaaagattttcccatcataggaaagtt 45163116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 436 - 502
Target Start/End: Original strand, 8491447 - 8491515
Alignment:
436 aaaactaacataataatta--ggtggcatttagggtggttgagggcaagagtttcctaccataggaaag 502  Q
    |||||||||||||  ||||  ||||||||||||||||| |||||| |||| ||||| || |||||||||    
8491447 aaaactaacataagtattaaaggtggcatttagggtgggtgagggaaagattttcccactataggaaag 8491515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 454 - 491
Target Start/End: Original strand, 29184189 - 29184226
Alignment:
454 aggtggcatttagggtggttgagggcaagagtttccta 491  Q
    |||||||||||||||||| |||||| ||||||||||||    
29184189 aggtggcatttagggtgggtgagggaaagagtttccta 29184226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 33; Significance: 0.000000004; HSPs: 2)
Name: scaffold0041
Description:

Target: scaffold0041; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 454 - 550
Target Start/End: Original strand, 44184 - 44280
Alignment:
454 aggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagattagataaagaacatatccttatcatagac 550  Q
    |||||||||||||||||| |||||  |||||||||| |  |||||||||||  |||  ||| |||||| | |||||||||| ||  |||||||||||    
44184 aggtggcatttagggtgggtgaggcaaagagtttcccattataggaaagttaattttgacccttagatcaaataaagaacacatttttatcatagac 44280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 455 - 504
Target Start/End: Complemental strand, 44987 - 44938
Alignment:
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagtt 504  Q
    ||||||||||||||||| |||||  ||||||||||||| || ||||||||    
44987 ggtggcatttagggtgggtgaggcaaagagtttcctactatgggaaagtt 44938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000004; HSPs: 7)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 454 - 550
Target Start/End: Complemental strand, 40905834 - 40905738
Alignment:
454 aggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagattagataaagaacatatccttatcatagac 550  Q
    |||||||||||||||||| |||||  |||||||||| |  |||||||||||  |||  ||| |||||| | |||||||||| ||  |||||||||||    
40905834 aggtggcatttagggtgggtgaggcaaagagtttcccattataggaaagttaattttgacccttagatcaaataaagaacacatttttatcatagac 40905738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 453 - 503
Target Start/End: Original strand, 36661683 - 36661733
Alignment:
453 taggtggcatttagggtggttgagggcaagagtttcctaccataggaaagt 503  Q
    ||||||||||||||||||| |||||| |||| ||||| ||||| |||||||    
36661683 taggtggcatttagggtgggtgagggaaagaatttcccaccatgggaaagt 36661733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 454 - 492
Target Start/End: Original strand, 38315783 - 38315821
Alignment:
454 aggtggcatttagggtggttgagggcaagagtttcctac 492  Q
    |||||||||||||||||| |||||| |||||||||||||    
38315783 aggtggcatttagggtgggtgagggaaagagtttcctac 38315821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 454 - 491
Target Start/End: Complemental strand, 34827825 - 34827788
Alignment:
454 aggtggcatttagggtggttgagggcaagagtttccta 491  Q
    |||||||||||||||||| |||||| ||||||||||||    
34827825 aggtggcatttagggtgggtgagggaaagagtttccta 34827788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 455 - 504
Target Start/End: Original strand, 40905031 - 40905080
Alignment:
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagtt 504  Q
    ||||||||||||||||| |||||  ||||||||||||| || ||||||||    
40905031 ggtggcatttagggtgggtgaggcaaagagtttcctactatgggaaagtt 40905080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 455 - 523
Target Start/End: Original strand, 3820394 - 3820462
Alignment:
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    ||||||||||||||||| |  | | ||||||||||||| ||||||||||| ||||  |||| |||||||    
3820394 ggtggcatttagggtgggtaggtgaaagagtttcctactataggaaagtttttttttaccaatagatta 3820462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 455 - 491
Target Start/End: Original strand, 43551147 - 43551183
Alignment:
455 ggtggcatttagggtggttgagggcaagagtttccta 491  Q
    ||||||||||||||||| |||||| ||||||||||||    
43551147 ggtggcatttagggtgggtgagggaaagagtttccta 43551183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000004; HSPs: 6)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 453 - 525
Target Start/End: Original strand, 39949490 - 39949562
Alignment:
453 taggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagattaga 525  Q
    ||||||||||||||||||| |||||| |||||||| | || || | |||||| ||||  ||||||||||||||    
39949490 taggtggcatttagggtgggtgagggaaagagttttccactatggaaaagtttttttataccattagattaga 39949562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 454 - 521
Target Start/End: Original strand, 6353683 - 6353750
Alignment:
454 aggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagat 521  Q
    |||||||||||||||||| |||||| |||| ||||| | |||||||||||   ||| |||||||||||    
6353683 aggtggcatttagggtgggtgagggaaagattttcccatcataggaaagtaaattttaaccattagat 6353750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 455 - 521
Target Start/End: Complemental strand, 30003614 - 30003548
Alignment:
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagat 521  Q
    ||||||||||||||||| | |||| |||||||||||||||||  ||||||  |||  ||||||||||    
30003614 ggtggcatttagggtgggtaagggaaagagtttcctaccataaaaaagttgattttgaccattagat 30003548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 454 - 523
Target Start/End: Complemental strand, 39950382 - 39950313
Alignment:
454 aggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    ||||||||||||||||||  | ||| |||||||||| | ||| |||||||| |||| | |||||||||||    
39950382 aggtggcatttagggtgggcgggggaaagagtttcccaacatgggaaagttatttttagccattagatta 39950313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 455 - 504
Target Start/End: Original strand, 41784622 - 41784671
Alignment:
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagtt 504  Q
    ||||||||||||||||| |||||| |||||||| |||| || ||||||||    
41784622 ggtggcatttagggtgggtgagggaaagagttttctactatgggaaagtt 41784671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 456 - 504
Target Start/End: Original strand, 18669867 - 18669915
Alignment:
456 gtggcatttagggtggttgagggcaagagtttcctaccataggaaagtt 504  Q
    |||||||||||||||| |||||| |||||||||| |||||  |||||||    
18669867 gtggcatttagggtgggtgagggaaagagtttcccaccatgagaaagtt 18669915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000004; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 455 - 523
Target Start/End: Complemental strand, 37142760 - 37142692
Alignment:
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    ||||||||||||||||| || ||| |||||||||| | ||| |||||||| |||| | |||||||||||    
37142760 ggtggcatttagggtgggtgggggaaagagtttcccaacatgggaaagttatttttagccattagatta 37142692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 455 - 525
Target Start/End: Complemental strand, 17979162 - 17979092
Alignment:
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagattaga 525  Q
    ||||||||||||||||| |||||| |||||||| | || || | |||||| ||||  ||||||||||||||    
17979162 ggtggcatttagggtgggtgagggaaagagttttccactatggaaaagtttttttataccattagattaga 17979092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 453 - 521
Target Start/End: Original strand, 5825332 - 5825400
Alignment:
453 taggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagat 521  Q
    |||||||||||||||||||    ||| |||||||||| ||||||| |||||| |||  |||||||||||    
5825332 taggtggcatttagggtgggaatgggaaagagtttcccaccatagcaaagttttttctaaccattagat 5825400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 455 - 523
Target Start/End: Original strand, 17978263 - 17978331
Alignment:
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    |||||||||||||||||  | ||| |||||||||| | ||| |||||||| |||| | |||||||||||    
17978263 ggtggcatttagggtgggcgggggaaagagtttcccaacatgggaaagttatttttagccattagatta 17978331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 455 - 523
Target Start/End: Complemental strand, 32894748 - 32894680
Alignment:
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    ||||||||||||| ||| |||||| ||||||||||||| || ||| |||| ||||  ||||| ||||||    
32894748 ggtggcatttaggatgggtgagggaaagagtttcctactatgggagagtttttttttaccataagatta 32894680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000004; HSPs: 8)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 454 - 502
Target Start/End: Original strand, 45597623 - 45597671
Alignment:
454 aggtggcatttagggtggttgagggcaagagtttcctaccataggaaag 502  Q
    |||||||||||||||||| |||||| |||| ||||| ||||||||||||    
45597623 aggtggcatttagggtgggtgagggaaagaatttcccaccataggaaag 45597671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 452 - 503
Target Start/End: Complemental strand, 22862651 - 22862600
Alignment:
452 ttaggtggcatttagggtggttgagggcaagagtttcctaccataggaaagt 503  Q
    |||||||||||||||| ||| |||||| |||| ||||| |||||||||||||    
22862651 ttaggtggcatttaggatgggtgagggaaagaatttcccaccataggaaagt 22862600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 453 - 491
Target Start/End: Original strand, 13536279 - 13536317
Alignment:
453 taggtggcatttagggtggttgagggcaagagtttccta 491  Q
    ||||||||||||||||||| |||||| ||||||||||||    
13536279 taggtggcatttagggtgggtgagggaaagagtttccta 13536317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 454 - 504
Target Start/End: Original strand, 51129372 - 51129422
Alignment:
454 aggtggcatttagggtggttgagggcaagagtttcctaccataggaaagtt 504  Q
    |||||||||||||||||| |||||| |||||||||| || || ||||||||    
51129372 aggtggcatttagggtgggtgagggaaagagtttcccactatgggaaagtt 51129422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 454 - 503
Target Start/End: Complemental strand, 22425570 - 22425521
Alignment:
454 aggtggcatttagggtggttgagggcaagagtttcctaccataggaaagt 503  Q
    |||||||||||||| ||| |||||| |||| ||||| |||||||||||||    
22425570 aggtggcatttaggatgggtgagggaaagaatttcccaccataggaaagt 22425521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 480 - 536
Target Start/End: Complemental strand, 3789361 - 3789305
Alignment:
480 aagagtttcctaccataggaaagttcttttgaaccattagattagataaagaacata 536  Q
    |||||||||||||||||||||||||  ||| | ||||||||||| || ||| |||||    
3789361 aagagtttcctaccataggaaagttgattttagccattagattaaatcaagtacata 3789305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 455 - 523
Target Start/End: Original strand, 4530193 - 4530261
Alignment:
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    ||||||||||||||||| |||||| |||| ||||| | ||||| |||||   ||| |||||||||||||    
4530193 ggtggcatttagggtgggtgagggaaagaatttcccatcatagaaaagtagcttttaaccattagatta 4530261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 455 - 523
Target Start/End: Complemental strand, 51132357 - 51132289
Alignment:
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagttcttttgaaccattagatta 523  Q
    |||| |||||||||||| |||||| |||||||||| |||||  ||||||| |||  |||||| ||||||    
51132357 ggtgacatttagggtggatgagggaaagagtttcccaccatgagaaagttttttctaaccataagatta 51132289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 455 - 504
Target Start/End: Original strand, 1528561 - 1528610
Alignment:
455 ggtggcatttagggtggttgagggcaagagtttcctaccataggaaagtt 504  Q
    ||||||||||||||||| |||||| |||||||||| || || ||||||||    
1528561 ggtggcatttagggtgggtgagggaaagagtttcccactatgggaaagtt 1528610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 454 - 503
Target Start/End: Complemental strand, 6842005 - 6841956
Alignment:
454 aggtggcatttagggtggttgagggcaagagtttcctaccataggaaagt 503  Q
    |||||||||||||| ||| |||||| |||| ||||| |||||||||||||    
6842005 aggtggcatttaggatgggtgagggaaagaatttcccaccataggaaagt 6841956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 17974 times since January 2019
Visitors: 1567