View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9333-LTR4-TNT-insertion-4 (Length: 840)

Name: F9333-LTR4-TNT-insertion-4
Description: F9333-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9333-LTR4-TNT-insertion-4
F9333-LTR4-TNT-insertion-4
[»] chr7 (10 HSPs)
chr7 (8-840)||(46628921-46629753)
chr7 (45-418)||(46617586-46617959)
chr7 (40-418)||(46636279-46636657)
chr7 (14-431)||(46643667-46644084)
chr7 (143-431)||(46177017-46177305)
chr7 (565-818)||(46637303-46637553)
chr7 (564-825)||(46618596-46618854)
chr7 (635-829)||(46643242-46643439)
chr7 (573-745)||(46176604-46176773)
chr7 (802-840)||(46176564-46176602)
[»] chr1 (2 HSPs)
chr1 (133-420)||(15770075-15770362)
chr1 (607-840)||(15769646-15769882)
[»] chr3 (1 HSPs)
chr3 (356-389)||(18376224-18376257)


Alignment Details
Target: chr7 (Bit Score: 833; Significance: 0; HSPs: 10)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 833; E-Value: 0
Query Start/End: Original strand, 8 - 840
Target Start/End: Original strand, 46628921 - 46629753
Alignment:
8 cttccgtgattaagaaatcagagaagctcccacttcaaatgaatcctgctgattcaaaagattttcatgataaatcacgctcctatgcaatttgtttacc 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46628921 cttccgtgattaagaaatcagagaagctcccacttcaaatgaatcctgctgattcaaaagattttcatgataaatcacgctcctatgcaatttgtttacc 46629020  T
108 catgtcagaaacatggagcgatgctgatacaaaatgttttctacttagtttgtttatttttgggaagaattttactccgataaaaagattcatcgagaac 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46629021 catgtcagaaacatggagcgatgctgatacaaaatgttttctacttagtttgtttatttttgggaagaattttactccgataaaaagattcatcgagaac 46629120  T
208 aaagggatgggggaaatactttcattttactatggaaagttttacaaaactgatggatattgtagatggtcggagtgcatgaagttaaaggggagaaaat 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46629121 aaagggatgggggaaatactttcattttactatggaaagttttacaaaactgatggatattgtagatggtcggagtgcatgaagttaaaggggagaaaat 46629220  T
308 gtatgattgggaagaaactttttactggaccaagacaagatgaattattatctcgcttgattcctcatgtatctgaagaatctcaagattctttgttaca 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46629221 gtatgattgggaagaaactttttactggaccaagacaagatgaattattatctcgcttgattcctcatgtatctgaagaatctcaagattctttgttaca 46629320  T
408 ggtattcaactgtgccatcccatcctctctgttgttaatgaacttcatatgtatattccaatggtaattataatggagtagctgattgaattatcatttg 507  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46629321 ggtattcaactgtgccatcccatcctctctgttgttaatgaacttcatatgtatattccaatggtaattataatggagtagctgattgaattatcatttg 46629420  T
508 attgtaacatacaacatttatttgaacatttatgcccgtatcagtgccttttttctttatatatatcatttgtttctgtcctcactttgcttgtatttgt 607  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46629421 attgtaacatacaacatttatttgaacatttatgcccgtatcagtgccttttttctttatatatatcatttgtttctgtcctcactttgcttgtatttgt 46629520  T
608 tatacacagatttcaaagtcgtttatggagggcagaatttctctagaaaaatacatatcttctttgaagtctactgttggaataaacgttcttgtggaag 707  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46629521 tatacacagatttcaaagtcgtttatggagggcagaatttctctagaaaaatacatatcttctttgaagtctactgttggaataaacgttcttgtggaag 46629620  T
708 cagtagggattggtaacaagaagggagaccttactaggcttggtgtcgaacctgggaagaacagtcggacgttttcagcaccaacttgcaaatctttgtc 807  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46629621 cagtagggattggtaacaagaagggagaccttactaggcttggtgtcgaacctgggaagaacagtcggacgttttcagcaccaacttgcaaatctttgtc 46629720  T
808 ttctcttggaccgagtgatatattacaatcttt 840  Q
    |||||||||||||||||||||||||||||||||    
46629721 ttctcttggaccgagtgatatattacaatcttt 46629753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 198; E-Value: 1e-107
Query Start/End: Original strand, 45 - 418
Target Start/End: Original strand, 46617586 - 46617959
Alignment:
45 aatgaatcctgctgattcaaaagattttcatgataaatcacgctcctatgcaatttgtttacccatgtcagaaacatggagcgatgctgatacaaaatgt 144  Q
    ||||||||||||||||||| ||||| |||| |||||||||| ||||| |||||||  ||||||||||||||| |||||||| ||||||||| ||||  ||    
46617586 aatgaatcctgctgattcagaagatgttcacgataaatcactctcctttgcaattgatttacccatgtcagacacatggagtgatgctgatgcaaatagt 46617685  T
145 tttctacttagtttgtttatttttgggaagaattttactccgataaaaagattcatcgagaacaaagggatgggggaaatactttcattttactatggaa 244  Q
    |||  |||  |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
46617686 tttgaactaggtttgtttatttttgggaagaattttactcagataaaacgattcatcgagaacaaagggatgggggaaatactttcattttactatggaa 46617785  T
245 agttttacaaaactgatggatattgtagatggtcggagtgcatgaagttaaaggggagaaaatgtatgattgggaagaaactttttactggaccaagaca 344  Q
     ||||||||||||||||||||||  |||||||||| |||||| ||||  ||| |||||||| |||||||| ||  | || |||||| | ||||| || ||    
46617786 ggttttacaaaactgatggatatcatagatggtcgaagtgcaggaagaaaaaagggagaaagtgtatgataggacataacctttttgccggaccgaggca 46617885  T
345 agatgaattattatctcgcttgattcctcatgtatctgaagaatctcaagattctttgttacaggtattcaact 418  Q
    | ||||| |||| |||||||||||||||||||| ||||||||||||||| || || ||| ||||||||||||||    
46617886 acatgaactattgtctcgcttgattcctcatgtctctgaagaatctcaaaatgctctgtcacaggtattcaact 46617959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 183; E-Value: 1e-98
Query Start/End: Original strand, 40 - 418
Target Start/End: Original strand, 46636279 - 46636657
Alignment:
40 cttcaaatgaatcctgctgattcaaaagattttcatgataaatcacgctcctatgcaatttgtttacccatgtcagaaacatggagcgatgctgatacaa 139  Q
    |||| ||||||||||||||||||| ||||| |||| |||||||||| ||||| | |||||  ||||||||| |||||  ||||||| |||||||||||||    
46636279 cttcgaatgaatcctgctgattcagaagatgttcacgataaatcactctccttttcaattgatttacccatctcagacgcatggagtgatgctgatacaa 46636378  T
140 aatgttttctacttagtttgtttatttttgggaagaattttactccgataaaaagattcatcgagaacaaagggatgggggaaatactttcattttacta 239  Q
    |  ||||| ||||  |||||||||||||| |||||||||||||||  ||||||  ||| |||||||||||||||||||||||||| ||||||||||||||    
46636379 atagttttgtactaggtttgtttatttttcggaagaattttactcatataaaacaatttatcgagaacaaagggatgggggaaatgctttcattttacta 46636478  T
240 tggaaagttttacaaaactgatggatattgtagatggtcggagtgcatgaagttaaaggggagaaaatgtatgattgggaagaaactttttactggacca 339  Q
    ||||||||||||||||||||||||||||  |||||||||| |||||| ||||  ||| ||||||||||||||||| ||  | || |||||| | |||||     
46636479 tggaaagttttacaaaactgatggatatcttagatggtcgaagtgcaggaagaaaaaagggagaaaatgtatgataggacataacctttttgccggaccg 46636578  T
340 agacaagatgaattattatctcgcttgattcctcatgtatctgaagaatctcaagattctttgttacaggtattcaact 418  Q
    || ||| ||||| |||| |||||||||||||||||||| |||||||||||||||||  || ||| ||||||||||||||    
46636579 aggcaacatgaactattgtctcgcttgattcctcatgtctctgaagaatctcaagaggctctgtcacaggtattcaact 46636657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 182; E-Value: 6e-98
Query Start/End: Original strand, 14 - 431
Target Start/End: Complemental strand, 46644084 - 46643667
Alignment:
14 tgattaagaaatcagagaagctcccacttcaaatgaatcctgctgattcaaaagattttcatgataaatcacgctcctatgcaatttgtttacccatgtc 113  Q
    ||||| ||||||||||  ||||  |||||| || | ||||| |||||||| ||||| |||||||||||||||  |||| ||||||  |||| |||||  |    
46644084 tgattgagaaatcagaccagctttcacttcgaacggatcctactgattcagaagatgttcatgataaatcactttcctctgcaataagtttgcccatccc 46643985  T
114 agaaacatggagcgatgctgatacaaaatgttttctacttagtttgtttatttttgggaagaattttactccgataaaaagattcatcgagaacaaaggg 213  Q
    ||  | ||||||   |||||| |||||  | ||| ||||  |||||||||||||||||||||| ||||||  ||||||||||||||| ||||||||| ||    
46643984 agtcatatggagtattgctgacacaaatagctttgtactaggtttgtttatttttgggaagaactttactaagataaaaagattcatagagaacaaacgg 46643885  T
214 atgggggaaatactttcattttactatggaaagttttacaaaactgatggatattgtagatggtcggagtgcatgaagttaaaggggagaaaatgtatga 313  Q
    ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||| |    
46643884 atgggggaaatacttacattttactatggaaagttttacgaaactgatggatattgtagatggtcggagtgcaggaaattaaaagggagaaaatgtataa 46643785  T
314 ttgggaagaaactttttactggaccaagacaagatgaattattatctcgcttgattcctcatgtatctgaagaatctcaagattctttgttacaggtatt 413  Q
    | ||||||||||||||| | ||| | || ||| | ||| ||||||||||||||||||||||||| ||||| |||||||||||| | || |||||||||||    
46643784 tagggaagaaactttttgccggagcgaggcaacaagaactattatctcgcttgattcctcatgtctctgacgaatctcaagatacatttttacaggtatt 46643685  T
414 caactgtgccatcccatc 431  Q
    |||||||| |||| ||||    
46643684 caactgtgacatctcatc 46643667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 133; E-Value: 1e-68
Query Start/End: Original strand, 143 - 431
Target Start/End: Complemental strand, 46177305 - 46177017
Alignment:
143 gttttctacttagtttgtttatttttgggaagaattttactccgataaaaagattcatcgagaacaaagggatgggggaaatactttcattttactatgg 242  Q
    ||||||||||| |||||||||| |||||||||||||||| ||  |||||||||||| | |||||||||  ||||||||| ||||| ||||||||||||||    
46177305 gttttctacttggtttgtttatgtttgggaagaattttattcaaataaaaagattcttagagaacaaattgatgggggagatactctcattttactatgg 46177206  T
243 aaagttttacaaaactgatggatattgtagatggtcggagtgcatgaagttaaaggggagaaaatgtatgattgggaagaaactttttactggaccaaga 342  Q
    | |||||||||||||||| |||||| ||||||||||| |||||| || |  ||| ||| | ||||||||||  ||  ||||||||||| ||||||| ||     
46177205 agagttttacaaaactgaaggatatcgtagatggtcgaagtgcaggaggaaaaaaggggggaaatgtatgacaggacagaaactttttgctggaccgagg 46177106  T
343 caagatgaattattatctcgcttgattcctcatgtatctgaagaatctcaagattctttgttacaggtattcaactgtgccatcccatc 431  Q
    ||| | ||| | || |||||||||||| ||||||| ||||||||||| |||||| ||||||||||||||||||||||||||||| ||||    
46177105 caacaagaacttttgtctcgcttgattactcatgtctctgaagaatcgcaagatactttgttacaggtattcaactgtgccatctcatc 46177017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 121; E-Value: 1e-61
Query Start/End: Original strand, 565 - 818
Target Start/End: Original strand, 46637303 - 46637553
Alignment:
565 tatatatatcatttgtttctgtcctcactttgcttgtatttgttatacacagatttcaaagtcgtttatggagggcagaatttctctagaaaaatacata 664  Q
    ||||||||| ||||||||| ||||||||||||||| |||||   |||||||||||||||||||||||||||||||| ||| |||||||||| | ||||||    
46637303 tatatatataatttgtttcagtcctcactttgcttatattt---atacacagatttcaaagtcgtttatggagggcggaacttctctagaagattacata 46637399  T
665 tcttctttgaagtctactgttggaataaacgttcttgtggaagcagtagggattggtaacaagaagggagaccttactaggcttggtgtcgaacctggga 764  Q
    |||| ||||||||||||||||||| |   ||| ||||||||||| ||||| ||||||||  ||||||||||||| |||||||||||  | ||||||||||    
46637400 tcttttttgaagtctactgttggacttggcgtacttgtggaagctgtaggtattggtaaggagaagggagacctcactaggcttggcatggaacctggga 46637499  T
765 agaacagtcgga-cgttttcagcaccaacttgcaaatctttgtcttctcttggac 818  Q
    || || || | | ||||| |||||||| |||||||||||||||||||||||||||    
46637500 aggac-gttgaagcgtttccagcaccagcttgcaaatctttgtcttctcttggac 46637553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 104; E-Value: 2e-51
Query Start/End: Original strand, 564 - 825
Target Start/End: Original strand, 46618596 - 46618854
Alignment:
564 ttatatatatcatttgtttctgtcctcactttgcttgtatttgttatacacagatttcaaagtcgtttatggagggcagaatttctctagaaaaatacat 663  Q
    ||||||||||||| |||||| ||||||||||| ||| |||||   ||||||||||||||||||||||||||||||| |||| |||||||||| | ||||     
46618596 ttatatatatcatatgtttcagtcctcactttacttatattt---atacacagatttcaaagtcgtttatggagggaagaacttctctagaagattacac 46618692  T
664 atcttctttgaagtctactgttggaataaacgttcttgtggaagcagtagggattggtaacaagaagggagaccttactaggcttggtgtcgaacctggg 763  Q
    ||||||||||||||||||||||||| |    || ||||||||||| ||||| ||||||||  ||| |||||||||||||||| ||||  | |||||||||    
46618693 atcttctttgaagtctactgttggacttggtgtacttgtggaagctgtaggtattggtaaggagatgggagaccttactaggattggcatggaacctggg 46618792  T
764 aagaacagtcggacgttttcagcaccaacttgcaaatctttgtcttctcttggaccgagtga 825  Q
    ||| ||  ||   ||||  ||| |||| |||||||| ||||||||||||||||||| |||||    
46618793 aaggacgttcaagcgttgccagtaccagcttgcaaagctttgtcttctcttggacctagtga 46618854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 635 - 829
Target Start/End: Complemental strand, 46643439 - 46643242
Alignment:
635 gagggcagaatttctctagaaaaatacatatcttctttgaagtctactgttggaataaacgttcttgtggaagcagtagggattggtaacaagaagggag 734  Q
    ||||| |||| |||||||||| |||||||||||| |||||||||||||| |||| |   ||||||||||||||||||  | ||||||||  |||||||||    
46643439 gagggaagaacttctctagaagaatacatatcttatttgaagtctactgctggacttggcgttcttgtggaagcagttagtattggtaaggagaagggag 46643340  T
735 accttactaggcttggtgtcgaacctgggaagaacagtc---ggacgttttcagcaccaacttgcaaatctttgtcttctcttggaccgagtgatata 829  Q
    |||||||||||||||  || |||||| ||||||||||||   || | |||||||||| |||||||||| || |||||||| ||||||| |||||||||    
46643339 accttactaggcttgacgtggaacctaggaagaacagtcctggggcattttcagcacaaacttgcaaagctctgtcttcttttggacctagtgatata 46643242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 573 - 745
Target Start/End: Complemental strand, 46176773 - 46176604
Alignment:
573 tcatttgtttctgtcctcactttgcttgtatttgttatacacagatttcaaagtcgtttatggagggcagaatttctctagaaaaatacatatcttcttt 672  Q
    ||||||| ||| ||||||||||||  ||||| | |||||| ||| | || ||||| ||| |||||| ||||| |||||| ||| ||||||||||||||||    
46176773 tcatttgcttcagtcctcactttg--tgtatat-ttatactcaggtgtctaagtcatttgtggaggacagaacttctcttgaagaatacatatcttcttt 46176677  T
673 gaagtctactgttggaataaacgttcttgtggaagcagtagggattggtaacaagaagggagaccttactagg 745  Q
    |||||||| ||||||| |    || ||||||||||||||||| ||||||||  |||||  |||||||||||||    
46176676 gaagtctattgttggacttggtgtccttgtggaagcagtaggtattggtaaggagaagaaagaccttactagg 46176604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 802 - 840
Target Start/End: Complemental strand, 46176602 - 46176564
Alignment:
802 tttgtcttctcttggaccgagtgatatattacaatcttt 840  Q
    |||||||||||||||||||||||| ||| ||||||||||    
46176602 tttgtcttctcttggaccgagtgaaataatacaatcttt 46176564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 152; Significance: 5e-80; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 152; E-Value: 5e-80
Query Start/End: Original strand, 133 - 420
Target Start/End: Complemental strand, 15770362 - 15770075
Alignment:
133 gatacaaaatgttttctacttagtttgtttatttttgggaagaattttactccgataaaaagattcatcgagaacaaagggatgggggaaatactttcat 232  Q
    ||||||||| ||||||||||| |||||||||||||||||||||||||||  | ||||||||||||| | || |||||| |||||||||||||||| ||||    
15770362 gatacaaaaagttttctacttggtttgtttatttttgggaagaattttatgcagataaaaagattcttagataacaaacggatgggggaaatactctcat 15770263  T
233 tttactatggaaagttttacaaaactgatggatattgtagatggtcggagtgcatgaagttaaaggggagaaaatgtatgattgggaagaaactttttac 332  Q
    ||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |||   ||||||| | ||| ||||||| ||  ||||||||||||     
15770262 tttactatggaaagttttacaaaactgatggatatcgtagatggtcagagtgcaggaaaaaaaagggggggaaacgtatgataggacagaaactttttag 15770163  T
333 tggaccaagacaagatgaattattatctcgcttgattcctcatgtatctgaagaatctcaagattctttgttacaggtattcaactgt 420  Q
    |||||| || ||| ||||| | || |||||||||||| ||||||||||||||||||| |||||| || ||| ||||||||||||||||    
15770162 tggaccgaggcaacatgaacttttgtctcgcttgattactcatgtatctgaagaatcgcaagatactctgtcacaggtattcaactgt 15770075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 607 - 840
Target Start/End: Complemental strand, 15769882 - 15769646
Alignment:
607 ttatacacagatttcaaagtcgtttatggagggcagaatttctctagaaaaatacatatcttctttgaagtctactgttggaataaacgttcttgtggaa 706  Q
    |||||| ||| |||| ||||| | | ||||||| |||| |||||||||| |||||||||||||||||||||||| ||||||| |    ||||||||||||    
15769882 ttatactcaggtttctaagtcatatgtggagggaagaacttctctagaagaatacatatcttctttgaagtctattgttggagttggtgttcttgtggaa 15769783  T
707 gcagtagggattggtaacaagaagggagaccttactaggcttggtgtcgaacctgggaagaacagtcg---gacgttttcagcaccaacttgcaaatctt 803  Q
    |||||||| ||||||||  ||||||||||||||||||||||||||||||| |||| ||||||||||||   | |||||| |||||||||||||||| |||    
15769782 gcagtaggtattggtaaggagaagggagaccttactaggcttggtgtcgagcctgtgaagaacagtcgtaaggcgtttttagcaccaacttgcaaagctt 15769683  T
804 tgtcttctcttggaccgagtgatatattacaatcttt 840  Q
    |||||||||||||||  ||||||||| ||||||||||    
15769682 tgtcttctcttggacttagtgatataatacaatcttt 15769646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 356 - 389
Target Start/End: Complemental strand, 18376257 - 18376224
Alignment:
356 tatctcgcttgattcctcatgtatctgaagaatc 389  Q
    ||||||||||||||||||||||||| ||||||||    
18376257 tatctcgcttgattcctcatgtatccgaagaatc 18376224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125191 times since January 2019
Visitors: 1454