View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9333-LTR4-TNT-insertion-4 (Length: 840)

Name: F9333-LTR4-TNT-insertion-4
Description: F9333-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9333-LTR4-TNT-insertion-4
[»] chr7 (10 HSPs)
chr7 (8-840)||(46628921-46629753)
chr7 (45-418)||(46617586-46617959)
chr7 (40-418)||(46636279-46636657)
chr7 (14-431)||(46643667-46644084)
chr7 (143-431)||(46177017-46177305)
chr7 (565-818)||(46637303-46637553)
chr7 (564-825)||(46618596-46618854)
chr7 (635-829)||(46643242-46643439)
chr7 (573-745)||(46176604-46176773)
chr7 (802-840)||(46176564-46176602)
[»] chr1 (2 HSPs)
chr1 (133-420)||(15770075-15770362)
chr1 (607-840)||(15769646-15769882)
[»] chr3 (1 HSPs)
chr3 (356-389)||(18376224-18376257)

Alignment Details
Target: chr7 (Bit Score: 833; Significance: 0; HSPs: 10)
Name: chr7

Target: chr7; HSP #1
Raw Score: 833; E-Value: 0
Query Start/End: Original strand, 8 - 840
Target Start/End: Original strand, 46628921 - 46629753
8 cttccgtgattaagaaatcagagaagctcccacttcaaatgaatcctgctgattcaaaagattttcatgataaatcacgctcctatgcaatttgtttacc 107  Q
46628921 cttccgtgattaagaaatcagagaagctcccacttcaaatgaatcctgctgattcaaaagattttcatgataaatcacgctcctatgcaatttgtttacc 46629020  T
108 catgtcagaaacatggagcgatgctgatacaaaatgttttctacttagtttgtttatttttgggaagaattttactccgataaaaagattcatcgagaac 207  Q
46629021 catgtcagaaacatggagcgatgctgatacaaaatgttttctacttagtttgtttatttttgggaagaattttactccgataaaaagattcatcgagaac 46629120  T
208 aaagggatgggggaaatactttcattttactatggaaagttttacaaaactgatggatattgtagatggtcggagtgcatgaagttaaaggggagaaaat 307  Q
46629121 aaagggatgggggaaatactttcattttactatggaaagttttacaaaactgatggatattgtagatggtcggagtgcatgaagttaaaggggagaaaat 46629220  T
308 gtatgattgggaagaaactttttactggaccaagacaagatgaattattatctcgcttgattcctcatgtatctgaagaatctcaagattctttgttaca 407  Q
46629221 gtatgattgggaagaaactttttactggaccaagacaagatgaattattatctcgcttgattcctcatgtatctgaagaatctcaagattctttgttaca 46629320  T
408 ggtattcaactgtgccatcccatcctctctgttgttaatgaacttcatatgtatattccaatggtaattataatggagtagctgattgaattatcatttg 507  Q
46629321 ggtattcaactgtgccatcccatcctctctgttgttaatgaacttcatatgtatattccaatggtaattataatggagtagctgattgaattatcatttg 46629420  T
508 attgtaacatacaacatttatttgaacatttatgcccgtatcagtgccttttttctttatatatatcatttgtttctgtcctcactttgcttgtatttgt 607  Q
46629421 attgtaacatacaacatttatttgaacatttatgcccgtatcagtgccttttttctttatatatatcatttgtttctgtcctcactttgcttgtatttgt 46629520  T
608 tatacacagatttcaaagtcgtttatggagggcagaatttctctagaaaaatacatatcttctttgaagtctactgttggaataaacgttcttgtggaag 707  Q
46629521 tatacacagatttcaaagtcgtttatggagggcagaatttctctagaaaaatacatatcttctttgaagtctactgttggaataaacgttcttgtggaag 46629620  T
708 cagtagggattggtaacaagaagggagaccttactaggcttggtgtcgaacctgggaagaacagtcggacgttttcagcaccaacttgcaaatctttgtc 807  Q
46629621 cagtagggattggtaacaagaagggagaccttactaggcttggtgtcgaacctgggaagaacagtcggacgttttcagcaccaacttgcaaatctttgtc 46629720  T
808 ttctcttggaccgagtgatatattacaatcttt 840  Q
46629721 ttctcttggaccgagtgatatattacaatcttt 46629753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 198; E-Value: 1e-107
Query Start/End: Original strand, 45 - 418
Target Start/End: Original strand, 46617586 - 46617959
45 aatgaatcctgctgattcaaaagattttcatgataaatcacgctcctatgcaatttgtttacccatgtcagaaacatggagcgatgctgatacaaaatgt 144  Q
    ||||||||||||||||||| ||||| |||| |||||||||| ||||| |||||||  ||||||||||||||| |||||||| ||||||||| ||||  ||    
46617586 aatgaatcctgctgattcagaagatgttcacgataaatcactctcctttgcaattgatttacccatgtcagacacatggagtgatgctgatgcaaatagt 46617685  T
145 tttctacttagtttgtttatttttgggaagaattttactccgataaaaagattcatcgagaacaaagggatgggggaaatactttcattttactatggaa 244  Q
    |||  |||  |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
46617686 tttgaactaggtttgtttatttttgggaagaattttactcagataaaacgattcatcgagaacaaagggatgggggaaatactttcattttactatggaa 46617785  T
245 agttttacaaaactgatggatattgtagatggtcggagtgcatgaagttaaaggggagaaaatgtatgattgggaagaaactttttactggaccaagaca 344  Q
     ||||||||||||||||||||||  |||||||||| |||||| ||||  ||| |||||||| |||||||| ||  | || |||||| | ||||| || ||    
46617786 ggttttacaaaactgatggatatcatagatggtcgaagtgcaggaagaaaaaagggagaaagtgtatgataggacataacctttttgccggaccgaggca 46617885  T
345 agatgaattattatctcgcttgattcctcatgtatctgaagaatctcaagattctttgttacaggtattcaact 418  Q
    | ||||| |||| |||||||||||||||||||| ||||||||||||||| || || ||| ||||||||||||||    
46617886 acatgaactattgtctcgcttgattcctcatgtctctgaagaatctcaaaatgctctgtcacaggtattcaact 46617959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 183; E-Value: 1e-98
Query Start/End: Original strand, 40 - 418
Target Start/End: Original strand, 46636279 - 46636657
40 cttcaaatgaatcctgctgattcaaaagattttcatgataaatcacgctcctatgcaatttgtttacccatgtcagaaacatggagcgatgctgatacaa 139  Q
    |||| ||||||||||||||||||| ||||| |||| |||||||||| ||||| | |||||  ||||||||| |||||  ||||||| |||||||||||||    
46636279 cttcgaatgaatcctgctgattcagaagatgttcacgataaatcactctccttttcaattgatttacccatctcagacgcatggagtgatgctgatacaa 46636378  T
140 aatgttttctacttagtttgtttatttttgggaagaattttactccgataaaaagattcatcgagaacaaagggatgggggaaatactttcattttacta 239  Q
    |  ||||| ||||  |||||||||||||| |||||||||||||||  ||||||  ||| |||||||||||||||||||||||||| ||||||||||||||    
46636379 atagttttgtactaggtttgtttatttttcggaagaattttactcatataaaacaatttatcgagaacaaagggatgggggaaatgctttcattttacta 46636478  T
240 tggaaagttttacaaaactgatggatattgtagatggtcggagtgcatgaagttaaaggggagaaaatgtatgattgggaagaaactttttactggacca 339  Q
    ||||||||||||||||||||||||||||  |||||||||| |||||| ||||  ||| ||||||||||||||||| ||  | || |||||| | |||||     
46636479 tggaaagttttacaaaactgatggatatcttagatggtcgaagtgcaggaagaaaaaagggagaaaatgtatgataggacataacctttttgccggaccg 46636578  T
340 agacaagatgaattattatctcgcttgattcctcatgtatctgaagaatctcaagattctttgttacaggtattcaact 418  Q
    || ||| ||||| |||| |||||||||||||||||||| |||||||||||||||||  || ||| ||||||||||||||    
46636579 aggcaacatgaactattgtctcgcttgattcctcatgtctctgaagaatctcaagaggctctgtcacaggtattcaact 46636657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 182; E-Value: 6e-98
Query Start/End: Original strand, 14 - 431
Target Start/End: Complemental strand, 46644084 - 46643667
14 tgattaagaaatcagagaagctcccacttcaaatgaatcctgctgattcaaaagattttcatgataaatcacgctcctatgcaatttgtttacccatgtc 113  Q
    ||||| ||||||||||  ||||  |||||| || | ||||| |||||||| ||||| |||||||||||||||  |||| ||||||  |||| |||||  |    
46644084 tgattgagaaatcagaccagctttcacttcgaacggatcctactgattcagaagatgttcatgataaatcactttcctctgcaataagtttgcccatccc 46643985  T
114 agaaacatggagcgatgctgatacaaaatgttttctacttagtttgtttatttttgggaagaattttactccgataaaaagattcatcgagaacaaaggg 213  Q
    ||  | ||||||   |||||| |||||  | ||| ||||  |||||||||||||||||||||| ||||||  ||||||||||||||| ||||||||| ||    
46643984 agtcatatggagtattgctgacacaaatagctttgtactaggtttgtttatttttgggaagaactttactaagataaaaagattcatagagaacaaacgg 46643885  T
214 atgggggaaatactttcattttactatggaaagttttacaaaactgatggatattgtagatggtcggagtgcatgaagttaaaggggagaaaatgtatga 313  Q
    ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||| |    
46643884 atgggggaaatacttacattttactatggaaagttttacgaaactgatggatattgtagatggtcggagtgcaggaaattaaaagggagaaaatgtataa 46643785  T
314 ttgggaagaaactttttactggaccaagacaagatgaattattatctcgcttgattcctcatgtatctgaagaatctcaagattctttgttacaggtatt 413  Q
    | ||||||||||||||| | ||| | || ||| | ||| ||||||||||||||||||||||||| ||||| |||||||||||| | || |||||||||||    
46643784 tagggaagaaactttttgccggagcgaggcaacaagaactattatctcgcttgattcctcatgtctctgacgaatctcaagatacatttttacaggtatt 46643685  T
414 caactgtgccatcccatc 431  Q
    |||||||| |||| ||||    
46643684 caactgtgacatctcatc 46643667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 133; E-Value: 1e-68
Query Start/End: Original strand, 143 - 431
Target Start/End: Complemental strand, 46177305 - 46177017
143 gttttctacttagtttgtttatttttgggaagaattttactccgataaaaagattcatcgagaacaaagggatgggggaaatactttcattttactatgg 242  Q
    ||||||||||| |||||||||| |||||||||||||||| ||  |||||||||||| | |||||||||  ||||||||| ||||| ||||||||||||||    
46177305 gttttctacttggtttgtttatgtttgggaagaattttattcaaataaaaagattcttagagaacaaattgatgggggagatactctcattttactatgg 46177206  T
243 aaagttttacaaaactgatggatattgtagatggtcggagtgcatgaagttaaaggggagaaaatgtatgattgggaagaaactttttactggaccaaga 342  Q
    | |||||||||||||||| |||||| ||||||||||| |||||| || |  ||| ||| | ||||||||||  ||  ||||||||||| ||||||| ||     
46177205 agagttttacaaaactgaaggatatcgtagatggtcgaagtgcaggaggaaaaaaggggggaaatgtatgacaggacagaaactttttgctggaccgagg 46177106  T
343 caagatgaattattatctcgcttgattcctcatgtatctgaagaatctcaagattctttgttacaggtattcaactgtgccatcccatc 431  Q
    ||| | ||| | || |||||||||||| ||||||| ||||||||||| |||||| ||||||||||||||||||||||||||||| ||||    
46177105 caacaagaacttttgtctcgcttgattactcatgtctctgaagaatcgcaagatactttgttacaggtattcaactgtgccatctcatc 46177017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 121; E-Value: 1e-61
Query Start/End: Original strand, 565 - 818
Target Start/End: Original strand, 46637303 - 46637553
565 tatatatatcatttgtttctgtcctcactttgcttgtatttgttatacacagatttcaaagtcgtttatggagggcagaatttctctagaaaaatacata 664  Q
    ||||||||| ||||||||| ||||||||||||||| |||||   |||||||||||||||||||||||||||||||| ||| |||||||||| | ||||||    
46637303 tatatatataatttgtttcagtcctcactttgcttatattt---atacacagatttcaaagtcgtttatggagggcggaacttctctagaagattacata 46637399  T
665 tcttctttgaagtctactgttggaataaacgttcttgtggaagcagtagggattggtaacaagaagggagaccttactaggcttggtgtcgaacctggga 764  Q
    |||| ||||||||||||||||||| |   ||| ||||||||||| ||||| ||||||||  ||||||||||||| |||||||||||  | ||||||||||    
46637400 tcttttttgaagtctactgttggacttggcgtacttgtggaagctgtaggtattggtaaggagaagggagacctcactaggcttggcatggaacctggga 46637499  T
765 agaacagtcgga-cgttttcagcaccaacttgcaaatctttgtcttctcttggac 818  Q
    || || || | | ||||| |||||||| |||||||||||||||||||||||||||    
46637500 aggac-gttgaagcgtttccagcaccagcttgcaaatctttgtcttctcttggac 46637553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 104; E-Value: 2e-51
Query Start/End: Original strand, 564 - 825
Target Start/End: Original strand, 46618596 - 46618854
564 ttatatatatcatttgtttctgtcctcactttgcttgtatttgttatacacagatttcaaagtcgtttatggagggcagaatttctctagaaaaatacat 663  Q
    ||||||||||||| |||||| ||||||||||| ||| |||||   ||||||||||||||||||||||||||||||| |||| |||||||||| | ||||     
46618596 ttatatatatcatatgtttcagtcctcactttacttatattt---atacacagatttcaaagtcgtttatggagggaagaacttctctagaagattacac 46618692  T
664 atcttctttgaagtctactgttggaataaacgttcttgtggaagcagtagggattggtaacaagaagggagaccttactaggcttggtgtcgaacctggg 763  Q
    ||||||||||||||||||||||||| |    || ||||||||||| ||||| ||||||||  ||| |||||||||||||||| ||||  | |||||||||    
46618693 atcttctttgaagtctactgttggacttggtgtacttgtggaagctgtaggtattggtaaggagatgggagaccttactaggattggcatggaacctggg 46618792  T
764 aagaacagtcggacgttttcagcaccaacttgcaaatctttgtcttctcttggaccgagtga 825  Q
    ||| ||  ||   ||||  ||| |||| |||||||| ||||||||||||||||||| |||||    
46618793 aaggacgttcaagcgttgccagtaccagcttgcaaagctttgtcttctcttggacctagtga 46618854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 635 - 829
Target Start/End: Complemental strand, 46643439 - 46643242
635 gagggcagaatttctctagaaaaatacatatcttctttgaagtctactgttggaataaacgttcttgtggaagcagtagggattggtaacaagaagggag 734  Q
    ||||| |||| |||||||||| |||||||||||| |||||||||||||| |||| |   ||||||||||||||||||  | ||||||||  |||||||||    
46643439 gagggaagaacttctctagaagaatacatatcttatttgaagtctactgctggacttggcgttcttgtggaagcagttagtattggtaaggagaagggag 46643340  T
735 accttactaggcttggtgtcgaacctgggaagaacagtc---ggacgttttcagcaccaacttgcaaatctttgtcttctcttggaccgagtgatata 829  Q
    |||||||||||||||  || |||||| ||||||||||||   || | |||||||||| |||||||||| || |||||||| ||||||| |||||||||    
46643339 accttactaggcttgacgtggaacctaggaagaacagtcctggggcattttcagcacaaacttgcaaagctctgtcttcttttggacctagtgatata 46643242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 573 - 745
Target Start/End: Complemental strand, 46176773 - 46176604
573 tcatttgtttctgtcctcactttgcttgtatttgttatacacagatttcaaagtcgtttatggagggcagaatttctctagaaaaatacatatcttcttt 672  Q
    ||||||| ||| ||||||||||||  ||||| | |||||| ||| | || ||||| ||| |||||| ||||| |||||| ||| ||||||||||||||||    
46176773 tcatttgcttcagtcctcactttg--tgtatat-ttatactcaggtgtctaagtcatttgtggaggacagaacttctcttgaagaatacatatcttcttt 46176677  T
673 gaagtctactgttggaataaacgttcttgtggaagcagtagggattggtaacaagaagggagaccttactagg 745  Q
    |||||||| ||||||| |    || ||||||||||||||||| ||||||||  |||||  |||||||||||||    
46176676 gaagtctattgttggacttggtgtccttgtggaagcagtaggtattggtaaggagaagaaagaccttactagg 46176604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 802 - 840
Target Start/End: Complemental strand, 46176602 - 46176564
802 tttgtcttctcttggaccgagtgatatattacaatcttt 840  Q
    |||||||||||||||||||||||| ||| ||||||||||    
46176602 tttgtcttctcttggaccgagtgaaataatacaatcttt 46176564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 152; Significance: 5e-80; HSPs: 2)
Name: chr1

Target: chr1; HSP #1
Raw Score: 152; E-Value: 5e-80
Query Start/End: Original strand, 133 - 420
Target Start/End: Complemental strand, 15770362 - 15770075
133 gatacaaaatgttttctacttagtttgtttatttttgggaagaattttactccgataaaaagattcatcgagaacaaagggatgggggaaatactttcat 232  Q
    ||||||||| ||||||||||| |||||||||||||||||||||||||||  | ||||||||||||| | || |||||| |||||||||||||||| ||||    
15770362 gatacaaaaagttttctacttggtttgtttatttttgggaagaattttatgcagataaaaagattcttagataacaaacggatgggggaaatactctcat 15770263  T
233 tttactatggaaagttttacaaaactgatggatattgtagatggtcggagtgcatgaagttaaaggggagaaaatgtatgattgggaagaaactttttac 332  Q
    ||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |||   ||||||| | ||| ||||||| ||  ||||||||||||     
15770262 tttactatggaaagttttacaaaactgatggatatcgtagatggtcagagtgcaggaaaaaaaagggggggaaacgtatgataggacagaaactttttag 15770163  T
333 tggaccaagacaagatgaattattatctcgcttgattcctcatgtatctgaagaatctcaagattctttgttacaggtattcaactgt 420  Q
    |||||| || ||| ||||| | || |||||||||||| ||||||||||||||||||| |||||| || ||| ||||||||||||||||    
15770162 tggaccgaggcaacatgaacttttgtctcgcttgattactcatgtatctgaagaatcgcaagatactctgtcacaggtattcaactgt 15770075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 607 - 840
Target Start/End: Complemental strand, 15769882 - 15769646
607 ttatacacagatttcaaagtcgtttatggagggcagaatttctctagaaaaatacatatcttctttgaagtctactgttggaataaacgttcttgtggaa 706  Q
    |||||| ||| |||| ||||| | | ||||||| |||| |||||||||| |||||||||||||||||||||||| ||||||| |    ||||||||||||    
15769882 ttatactcaggtttctaagtcatatgtggagggaagaacttctctagaagaatacatatcttctttgaagtctattgttggagttggtgttcttgtggaa 15769783  T
707 gcagtagggattggtaacaagaagggagaccttactaggcttggtgtcgaacctgggaagaacagtcg---gacgttttcagcaccaacttgcaaatctt 803  Q
    |||||||| ||||||||  ||||||||||||||||||||||||||||||| |||| ||||||||||||   | |||||| |||||||||||||||| |||    
15769782 gcagtaggtattggtaaggagaagggagaccttactaggcttggtgtcgagcctgtgaagaacagtcgtaaggcgtttttagcaccaacttgcaaagctt 15769683  T
804 tgtcttctcttggaccgagtgatatattacaatcttt 840  Q
    |||||||||||||||  ||||||||| ||||||||||    
15769682 tgtcttctcttggacttagtgatataatacaatcttt 15769646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 356 - 389
Target Start/End: Complemental strand, 18376257 - 18376224
356 tatctcgcttgattcctcatgtatctgaagaatc 389  Q
    ||||||||||||||||||||||||| ||||||||    
18376257 tatctcgcttgattcctcatgtatccgaagaatc 18376224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 14431 times since January 2019
Visitors: 570