View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9333-LTR4-TNT-insertion-6 (Length: 564)

Name: F9333-LTR4-TNT-insertion-6
Description: F9333-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9333-LTR4-TNT-insertion-6
F9333-LTR4-TNT-insertion-6
[»] chr1 (1 HSPs)
chr1 (10-556)||(27522275-27522821)


Alignment Details
Target: chr1 (Bit Score: 502; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 502; E-Value: 0
Query Start/End: Original strand, 10 - 556
Target Start/End: Original strand, 27522275 - 27522821
Alignment:
10 ccaaactcaaaggccaaaacatcgaccgaaaattcttagtatggacacactcacggccactctcatcgagttcatttccacattcatctttgtttttgcc 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27522275 ccaaactcaaaggccaaaacatcgaccgaaaattcttagtatggacacactcacggccactctcatcgagttcatttccacattcatctttgtttttgcc 27522374  T
110 agcatatcgactctcgcatcatcgtaagaaatctcaccggagatgacgcggcctttagtctcatcgccaccgcgatcgctcacgcttttgccctctctgc 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27522375 agcatatcgactctcgcatcatcgtaagaaatctcaccggagatgacgcggcctttagtctcatcgccaccgcgatcgctcacgcttttgccctctctgc 27522474  T
210 cgccgtgtatataggagctaggatcatcgccgtaaatccttacacgttatgtggccatgctaacccggctgtcacttttggggcttttatgggtggaaat 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27522475 cgccgtgtatataggagctaggatcatcgccgtaaatccttacacgttatgtggccatgctaacccggctgtcacttttggggcttttatgggtggaaat 27522574  T
310 attcacttcattcgttgccttggttactggattgctcagctccttgcctccgttggtgcttgcgcgctcctcatggtcgtcaccggtggacagtttatga 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27522575 attcacttcattcgttgccttggttactggattgctcagctccttgcctccgttggtgcttgcgcgctcctcatggtcgtcaccggtggacagtttatga 27522674  T
410 ctgttagtagtgtttgttttttcaacaactaattaccaacatttgtgatttnnnnnnnnnnnnnnntttgttttagaaatcaaataggactttgagaggg 509  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||               ||||||||||||||||||||||||||||||||||    
27522675 ctgttagtagtgtttgttttttcaacaactaattaccaacatttgtgatttaaaaataaaaaaaaatttgttttagaaatcaaataggactttgagaggg 27522774  T
510 tgagatttcaaaattatggttgaaatggtttaactaactaaagatta 556  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
27522775 tgagatttcaaaattatggttgaaatggtttaactaactaaagatta 27522821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 109801 times since January 2019
Visitors: 1349