View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9333-LTR4-TNT-insertion-7 (Length: 223)

Name: F9333-LTR4-TNT-insertion-7
Description: F9333-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9333-LTR4-TNT-insertion-7
[»] chr1 (5 HSPs)
chr1 (8-213)||(50947131-50947337)
chr1 (10-142)||(50956645-50956777)
chr1 (10-142)||(15854992-15855124)
chr1 (71-142)||(50963653-50963724)
chr1 (10-55)||(50963577-50963622)
[»] chr5 (1 HSPs)
chr5 (9-136)||(33630411-33630538)

Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 5)
Name: chr1

Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 8 - 213
Target Start/End: Original strand, 50947131 - 50947337
8 cgaaactctgttgaaaatcaatgagtacgtgaagaaacatgcatatgccggagataatgaaaaaagtctccgtagttgggaccttgagttcatcgaagtt 107  Q
50947131 cgaaactctgttgaaaatcaatgagtacgtgaagaaacatgcatatgccggagataatgaaaaaagtctccgtagttgggaccttgagttcatcgaagtt 50947230  T
108 gatcgccacacactgtttgcgctagtcttggttag-nnnnnnnnnnnnnnnnnnnctcatgtcatatttatattcttacatgtaacatcatgatgttagt 206  Q
    |||||||||||||||||||||||||||||||||||                    |||||||||||||||||||||||||||||||||||||||||||||    
50947231 gatcgccacacactgtttgcgctagtcttggttagttttttttttttctttttttctcatgtcatatttatattcttacatgtaacatcatgatgttagt 50947330  T
207 ttaatta 213  Q
50947331 ttaatta 50947337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 10 - 142
Target Start/End: Original strand, 50956645 - 50956777
10 aaactctgttgaaaatcaatgagtacgtgaagaaacatgcatatgccggagataatgaaaaaagtctccgtagttgggaccttgagttcatcgaagttga 109  Q
    ||||||||||||| |||||||| || || ||||| |||||| |||| ||||||||||||||||||||||||| |||||||||||| |||||| |||||||    
50956645 aaactctgttgaagatcaatgaatatgtaaagaagcatgcagatgctggagataatgaaaaaagtctccgtaattgggaccttgaattcatcaaagttga 50956744  T
110 tcgccacacactgtttgcgctagtcttggttag 142  Q
    |||||||||  ||||||| ||||||||||||||    
50956745 tcgccacactttgtttgccctagtcttggttag 50956777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 10 - 142
Target Start/End: Original strand, 15854992 - 15855124
10 aaactctgttgaaaatcaatgagtacgtgaagaaacatgcatatgccggagataatgaaaaaagtctccgtagttgggaccttgagttcatcgaagttga 109  Q
    ||||||||||||| ||||| ||||| || ||||| |||| | ||||  |||||||||||||||||||||||| |||||| |  ||||||||| |||||||    
15854992 aaactctgttgaagatcaaagagtatgtaaagaagcatgaagatgctagagataatgaaaaaagtctccgtatttgggatcaagagttcatcaaagttga 15855091  T
110 tcgccacacactgtttgcgctagtcttggttag 142  Q
    || ||  ||| |||||||  |||||||||||||    
15855092 tcaccgtacattgtttgctatagtcttggttag 15855124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 71 - 142
Target Start/End: Original strand, 50963653 - 50963724
71 aagtctccgtagttgggaccttgagttcatcgaagttgatcgccacacactgtttgcgctagtcttggttag 142  Q
    ||||||||||   |||||||||||||||||| ||||||||||||||||| ||||||| ||||||||||||||    
50963653 aagtctccgttcctgggaccttgagttcatcaaagttgatcgccacacattgtttgccctagtcttggttag 50963724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 10 - 55
Target Start/End: Original strand, 50963577 - 50963622
10 aaactctgttgaaaatcaatgagtacgtgaagaaacatgcatatgc 55  Q
    ||||||||||||| |||||||||||||||||||| |||||| ||||    
50963577 aaactctgttgaagatcaatgagtacgtgaagaagcatgcagatgc 50963622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 9 - 136
Target Start/End: Original strand, 33630411 - 33630538
9 gaaactctgttgaaaatcaatgagtacgtgaagaaacatgcatatgccggagataatgaaaaaagtctccgtagttgggaccttgagttcatcgaagttg 108  Q
    |||||||||||||||||||||||||| ||||||||||||||| | || ||||||||||||||||||||||||| |||||||||||||||||| |||||||    
33630411 gaaactctgttgaaaatcaatgagtatgtgaagaaacatgcagaagctggagataatgaaaaaagtctccgtaattgggaccttgagttcatagaagttg 33630510  T
109 atcgccacacactgtttgcgctagtctt 136  Q
    |||||||| || ||||||| ||||||||    
33630511 atcgccacgcattgtttgccctagtctt 33630538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 216832 times since January 2019
Visitors: 2908