View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9333-LTR4-TNT-insertion-7 (Length: 223)

Name: F9333-LTR4-TNT-insertion-7
Description: F9333-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9333-LTR4-TNT-insertion-7
F9333-LTR4-TNT-insertion-7
[»] chr1 (5 HSPs)
chr1 (8-213)||(50947131-50947337)
chr1 (10-142)||(50956645-50956777)
chr1 (10-142)||(15854992-15855124)
chr1 (71-142)||(50963653-50963724)
chr1 (10-55)||(50963577-50963622)
[»] chr5 (1 HSPs)
chr5 (9-136)||(33630411-33630538)


Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 5)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 8 - 213
Target Start/End: Original strand, 50947131 - 50947337
Alignment:
8 cgaaactctgttgaaaatcaatgagtacgtgaagaaacatgcatatgccggagataatgaaaaaagtctccgtagttgggaccttgagttcatcgaagtt 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50947131 cgaaactctgttgaaaatcaatgagtacgtgaagaaacatgcatatgccggagataatgaaaaaagtctccgtagttgggaccttgagttcatcgaagtt 50947230  T
108 gatcgccacacactgtttgcgctagtcttggttag-nnnnnnnnnnnnnnnnnnnctcatgtcatatttatattcttacatgtaacatcatgatgttagt 206  Q
    |||||||||||||||||||||||||||||||||||                    |||||||||||||||||||||||||||||||||||||||||||||    
50947231 gatcgccacacactgtttgcgctagtcttggttagttttttttttttctttttttctcatgtcatatttatattcttacatgtaacatcatgatgttagt 50947330  T
207 ttaatta 213  Q
    |||||||    
50947331 ttaatta 50947337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 10 - 142
Target Start/End: Original strand, 50956645 - 50956777
Alignment:
10 aaactctgttgaaaatcaatgagtacgtgaagaaacatgcatatgccggagataatgaaaaaagtctccgtagttgggaccttgagttcatcgaagttga 109  Q
    ||||||||||||| |||||||| || || ||||| |||||| |||| ||||||||||||||||||||||||| |||||||||||| |||||| |||||||    
50956645 aaactctgttgaagatcaatgaatatgtaaagaagcatgcagatgctggagataatgaaaaaagtctccgtaattgggaccttgaattcatcaaagttga 50956744  T
110 tcgccacacactgtttgcgctagtcttggttag 142  Q
    |||||||||  ||||||| ||||||||||||||    
50956745 tcgccacactttgtttgccctagtcttggttag 50956777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 10 - 142
Target Start/End: Original strand, 15854992 - 15855124
Alignment:
10 aaactctgttgaaaatcaatgagtacgtgaagaaacatgcatatgccggagataatgaaaaaagtctccgtagttgggaccttgagttcatcgaagttga 109  Q
    ||||||||||||| ||||| ||||| || ||||| |||| | ||||  |||||||||||||||||||||||| |||||| |  ||||||||| |||||||    
15854992 aaactctgttgaagatcaaagagtatgtaaagaagcatgaagatgctagagataatgaaaaaagtctccgtatttgggatcaagagttcatcaaagttga 15855091  T
110 tcgccacacactgtttgcgctagtcttggttag 142  Q
    || ||  ||| |||||||  |||||||||||||    
15855092 tcaccgtacattgtttgctatagtcttggttag 15855124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 71 - 142
Target Start/End: Original strand, 50963653 - 50963724
Alignment:
71 aagtctccgtagttgggaccttgagttcatcgaagttgatcgccacacactgtttgcgctagtcttggttag 142  Q
    ||||||||||   |||||||||||||||||| ||||||||||||||||| ||||||| ||||||||||||||    
50963653 aagtctccgttcctgggaccttgagttcatcaaagttgatcgccacacattgtttgccctagtcttggttag 50963724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 10 - 55
Target Start/End: Original strand, 50963577 - 50963622
Alignment:
10 aaactctgttgaaaatcaatgagtacgtgaagaaacatgcatatgc 55  Q
    ||||||||||||| |||||||||||||||||||| |||||| ||||    
50963577 aaactctgttgaagatcaatgagtacgtgaagaagcatgcagatgc 50963622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 9 - 136
Target Start/End: Original strand, 33630411 - 33630538
Alignment:
9 gaaactctgttgaaaatcaatgagtacgtgaagaaacatgcatatgccggagataatgaaaaaagtctccgtagttgggaccttgagttcatcgaagttg 108  Q
    |||||||||||||||||||||||||| ||||||||||||||| | || ||||||||||||||||||||||||| |||||||||||||||||| |||||||    
33630411 gaaactctgttgaaaatcaatgagtatgtgaagaaacatgcagaagctggagataatgaaaaaagtctccgtaattgggaccttgagttcatagaagttg 33630510  T
109 atcgccacacactgtttgcgctagtctt 136  Q
    |||||||| || ||||||| ||||||||    
33630511 atcgccacgcattgtttgccctagtctt 33630538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 109777 times since January 2019
Visitors: 1349