View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9333-LTR4-TNT-insertion-8 (Length: 420)

Name: F9333-LTR4-TNT-insertion-8
Description: F9333-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9333-LTR4-TNT-insertion-8
[»] chr3 (1 HSPs)
chr3 (9-411)||(43058100-43058502)

Alignment Details
Target: chr3 (Bit Score: 403; Significance: 0; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 403; E-Value: 0
Query Start/End: Original strand, 9 - 411
Target Start/End: Complemental strand, 43058502 - 43058100
9 taggtctgaaactttaatatcttccaaaccattgaagaccagactagtaatatatatataagagctatcttgatcatgtaatgtaatcaaggatccctcc 108  Q
43058502 taggtctgaaactttaatatcttccaaaccattgaagaccagactagtaatatatatataagagctatcttgatcatgtaatgtaatcaaggatccctcc 43058403  T
109 acactcatatatgtgatccatcatctaatcgccatcttaggccctctttgactactacctatgaacaatggatactacgtcaaacaaaactcgaattgca 208  Q
43058402 acactcatatatgtgatccatcatctaatcgccatcttaggccctctttgactactacctatgaacaatggatactacgtcaaacaaaactcgaattgca 43058303  T
209 gttcaaagatacatctacaagatccttccttggatagtgtctagttttgaagacccttgacccttgctaatatagtatcttggttggtagttaatcctca 308  Q
43058302 gttcaaagatacatctacaagatccttccttggatagtgtctagttttgaagacccttgacccttgctaatatagtatcttggttggtagttaatcctca 43058203  T
309 accctacttccctagcattgccaaatcaaaaccataaagatatagaaaacccatactatcatgttcctttctcataactaatttctgccatctcaaccaa 408  Q
43058202 accctacttccctagcattgccaaatcaaaaccataaagatatagaaaacccatactatcatgttcctttctcataactaatttctgccatctcaaccaa 43058103  T
409 ttg 411  Q
43058102 ttg 43058100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 295238 times since January 2019
Visitors: 3016