View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9333-LTR4-TNT-insertion-8 (Length: 420)

Name: F9333-LTR4-TNT-insertion-8
Description: F9333-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9333-LTR4-TNT-insertion-8
F9333-LTR4-TNT-insertion-8
[»] chr3 (1 HSPs)
chr3 (9-411)||(43058100-43058502)


Alignment Details
Target: chr3 (Bit Score: 403; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 403; E-Value: 0
Query Start/End: Original strand, 9 - 411
Target Start/End: Complemental strand, 43058502 - 43058100
Alignment:
9 taggtctgaaactttaatatcttccaaaccattgaagaccagactagtaatatatatataagagctatcttgatcatgtaatgtaatcaaggatccctcc 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43058502 taggtctgaaactttaatatcttccaaaccattgaagaccagactagtaatatatatataagagctatcttgatcatgtaatgtaatcaaggatccctcc 43058403  T
109 acactcatatatgtgatccatcatctaatcgccatcttaggccctctttgactactacctatgaacaatggatactacgtcaaacaaaactcgaattgca 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43058402 acactcatatatgtgatccatcatctaatcgccatcttaggccctctttgactactacctatgaacaatggatactacgtcaaacaaaactcgaattgca 43058303  T
209 gttcaaagatacatctacaagatccttccttggatagtgtctagttttgaagacccttgacccttgctaatatagtatcttggttggtagttaatcctca 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43058302 gttcaaagatacatctacaagatccttccttggatagtgtctagttttgaagacccttgacccttgctaatatagtatcttggttggtagttaatcctca 43058203  T
309 accctacttccctagcattgccaaatcaaaaccataaagatatagaaaacccatactatcatgttcctttctcataactaatttctgccatctcaaccaa 408  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43058202 accctacttccctagcattgccaaatcaaaaccataaagatatagaaaacccatactatcatgttcctttctcataactaatttctgccatctcaaccaa 43058103  T
409 ttg 411  Q
    |||    
43058102 ttg 43058100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 111504 times since January 2019
Visitors: 1375