View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9334-LTR4-TNT-insertion-1 (Length: 228)

Name: F9334-LTR4-TNT-insertion-1
Description: F9334-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9334-LTR4-TNT-insertion-1
F9334-LTR4-TNT-insertion-1
[»] chr6 (1 HSPs)
chr6 (8-218)||(31215040-31215250)
[»] chr4 (2 HSPs)
chr4 (62-130)||(22905680-22905748)
chr4 (62-130)||(22957348-22957416)


Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 8 - 218
Target Start/End: Original strand, 31215040 - 31215250
Alignment:
8 gtttagaaggttgtgggcttcaaagaaagtttctttggggggtaggtgggaggaaaatttattgggtgaagtggaggagaagttgtcaaccaagaagtaa 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31215040 gtttagaaggttgtgggcttcaaagaaagtttctttggggggtaggtgggaggaaaatttattgggtgaagtggaggagaagttgtcaaccaagaagtaa 31215139  T
108 gggaagtataggtgtgagagatggaaacttcttcatgatgagaatatgtttggaagaaattctagagaaaagatacgggccaagagtgagtaggagggtg 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31215140 gggaagtataggtgtgagagatggaaacttcttcatgatgagaatatgtttggaagaaattctagagaaaagatacgggccaagagtgagtaggagggtg 31215239  T
208 gacttggaatt 218  Q
    |||||||||||    
31215240 gacttggaatt 31215250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 130
Target Start/End: Complemental strand, 22905748 - 22905680
Alignment:
62 aaatttattgggtgaagtggaggagaagttgtcaaccaagaagtaagggaagtataggtgtgagagatg 130  Q
    |||||| |||||||||||||| ||||| ||||||||| |  ||||||||| |  |||| ||||||||||    
22905748 aaatttgttgggtgaagtggaagagaatttgtcaacccaagagtaagggaggcttaggagtgagagatg 22905680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 130
Target Start/End: Complemental strand, 22957416 - 22957348
Alignment:
62 aaatttattgggtgaagtggaggagaagttgtcaaccaagaagtaagggaagtataggtgtgagagatg 130  Q
    |||||| |||||||||||||| ||||| ||||||||| |  ||||||||| |  |||| ||||||||||    
22957416 aaatttgttgggtgaagtggaagagaatttgtcaacccaagagtaagggaggcttaggagtgagagatg 22957348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176068 times since January 2019
Visitors: 2680