View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9334-LTR4-TNT-insertion-4 (Length: 226)

Name: F9334-LTR4-TNT-insertion-4
Description: F9334-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9334-LTR4-TNT-insertion-4
F9334-LTR4-TNT-insertion-4
[»] chr5 (1 HSPs)
chr5 (9-218)||(975264-975473)


Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 9 - 218
Target Start/End: Complemental strand, 975473 - 975264
Alignment:
9 ttaattcttgtagaaaacaaaatatgttgatgcattgattcaagacaaaagaaaattacaaaaatgaaaattttgtataatcatttccttctttaaaatc 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
975473 ttaattcttgtagaaaacaaaatatgttgatgcattgattcaagacaaaagaaaattacaaaaatgaaaattttgtataatcatttccttctttaaaatc 975374  T
109 attgtatcnnnnnnngatgagtttaattggaatcagaaataccactcatgttgtaacattgattttggtatacatgtagaaaaatgttcgattgatgttg 208  Q
    ||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
975373 attgtatctttttttgatgagtttaattggaatcagaaataccactcatgttgtaacattgattttggtatacatgtagaaaaatgttcgattgatgttg 975274  T
209 gctcaattgg 218  Q
    ||||||||||    
975273 gctcaattgg 975264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 216670 times since January 2019
Visitors: 2908