View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9334-LTR4-TNT-insertion-7 (Length: 289)

Name: F9334-LTR4-TNT-insertion-7
Description: F9334-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9334-LTR4-TNT-insertion-7
F9334-LTR4-TNT-insertion-7
[»] chr1 (3 HSPs)
chr1 (10-279)||(34593913-34594182)
chr1 (14-101)||(34578391-34578478)
chr1 (206-279)||(34578123-34578196)
[»] chr6 (6 HSPs)
chr6 (10-103)||(32601041-32601134)
chr6 (10-103)||(32590570-32590663)
chr6 (200-279)||(32590363-32590442)
chr6 (205-279)||(32600811-32600885)
chr6 (47-106)||(24883380-24883439)
chr6 (233-276)||(24883552-24883595)


Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 10 - 279
Target Start/End: Complemental strand, 34594182 - 34593913
Alignment:
10 acataggggatgggaagacccagcaacatgggcaaaaagtgtgggaaatagttggagaacaacaggtgatattgaagataattggaataggtaaggaatc 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34594182 acataggggatgggaagacccagcaacatgggcaaaaagtgtgggaaatagttggagaacaacaggtgatattgaagataattggaataggtaaggaatc 34594083  T
110 aatggaaaaaacagaaactcactatattgatatgtattgttcaattactttgcttcattttccatattgtgatcaaaattattttactttctccctagca 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34594082 aatggaaaaaacagaaactcactatattgatatgtattgttcaattactttgcttcattttccatattgtgatcaaaattattttactttctccctagca 34593983  T
210 tgacttctatagcagattcaaacaataaatgggcatcgtatgctggacctggaggatggaatggtaatta 279  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34593982 tgacttctatagcagattcaaacaataaatgggcatcgtatgctggacctggaggatggaatggtaatta 34593913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 14 - 101
Target Start/End: Complemental strand, 34578478 - 34578391
Alignment:
14 aggggatgggaagacccagcaacatgggcaaaaagtgtgggaaatagttggagaacaacaggtgatattgaagataattggaataggt 101  Q
    |||||||||||||| || ||||| ||||| |||||||||||||||||||||||||| || |||||||| |||||||||||||| ||||    
34578478 aggggatgggaagatcctgcaacgtgggccaaaagtgtgggaaatagttggagaaccacgggtgatatagaagataattggaagaggt 34578391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 206 - 279
Target Start/End: Complemental strand, 34578196 - 34578123
Alignment:
206 agcatgacttctatagcagattcaaacaataaatgggcatcgtatgctggacctggaggatggaatggtaatta 279  Q
    ||||||||||||||   |||| ||||| | ||||||||||| ||||||||||||||||||||||||||||||||    
34578196 agcatgacttctattatagatgcaaacgacaaatgggcatcttatgctggacctggaggatggaatggtaatta 34578123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 10 - 103
Target Start/End: Complemental strand, 32601134 - 32601041
Alignment:
10 acataggggatgggaagacccagcaacatgggcaaaaagtgtgggaaatagttggagaacaacaggtgatattgaagataattggaataggtaa 103  Q
    |||||||||||||||||| || || |||||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||    
32601134 acataggggatgggaagatcctgctacatgggccaaaagtgtgggaaatagttggagaacaacaggagatattgaagataactggaataggtaa 32601041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 10 - 103
Target Start/End: Complemental strand, 32590663 - 32590570
Alignment:
10 acataggggatgggaagacccagcaacatgggcaaaaagtgtgggaaatagttggagaacaacaggtgatattgaagataattggaataggtaa 103  Q
    ||||||||||  |||||| |||||||||||||| |||||||||||||||||||||||||||||||| |||||| ||||||||||| ||||||||    
32590663 acataggggaaaggaagatccagcaacatgggccaaaagtgtgggaaatagttggagaacaacaggagatattaaagataattggcataggtaa 32590570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 200 - 279
Target Start/End: Complemental strand, 32590442 - 32590363
Alignment:
200 ctccctagcatgacttctatagcagattcaaacaataaatgggcatcgtatgctggacctggaggatggaatggtaatta 279  Q
    |||||||| ||||||||||||  ||||  |||| ||||||||||||| ||||||||||||||||||||||||||||||||    
32590442 ctccctaggatgacttctataatagatgtaaacgataaatgggcatcttatgctggacctggaggatggaatggtaatta 32590363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 205 - 279
Target Start/End: Complemental strand, 32600885 - 32600811
Alignment:
205 tagcatgacttctatagcagattcaaacaataaatgggcatcgtatgctggacctggaggatggaatggtaatta 279  Q
    ||||||||||||||||  ||||  |||  | ||||||||||| ||||||||||||||||||||||||||||||||    
32600885 tagcatgacttctataatagatgtaaatgacaaatgggcatcttatgctggacctggaggatggaatggtaatta 32600811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 47 - 106
Target Start/End: Original strand, 24883380 - 24883439
Alignment:
47 agtgtgggaaatagttggagaacaacaggtgatattgaagataattggaataggtaagga 106  Q
    |||||||||||||||||||||||||||   ||||| |||||||| ||| |||||| ||||    
24883380 agtgtgggaaatagttggagaacaacatcagatatcgaagataaatgggataggtgagga 24883439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 233 - 276
Target Start/End: Original strand, 24883552 - 24883595
Alignment:
233 aataaatgggcatcgtatgctggacctggaggatggaatggtaa 276  Q
    ||||||||||| || || ||||||||||||||||||||||||||    
24883552 aataaatgggcttcttacgctggacctggaggatggaatggtaa 24883595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 217209 times since January 2019
Visitors: 2908