View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9341-LTR4-TNT-insertion-1 (Length: 213)

Name: F9341-LTR4-TNT-insertion-1
Description: F9341-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9341-LTR4-TNT-insertion-1
F9341-LTR4-TNT-insertion-1
[»] chr1 (2 HSPs)
chr1 (8-205)||(52092574-52092771)
chr1 (14-205)||(52082387-52082575)
[»] chr3 (1 HSPs)
chr3 (108-179)||(514859-514931)


Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 8 - 205
Target Start/End: Original strand, 52092574 - 52092771
Alignment:
8 gtcactacaaaaatgagagggagccataatcttaatttctcaatgatgaccttgaaaataccatcatcgtccagaaattaacatcaacacacacctcacg 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52092574 gtcactacaaaaatgagagggagccataatcttaatttctcaatgatgaccttgaaaataccatcatcgtccagaaattaacatcaacacacacctcacg 52092673  T
108 acaacctcgtatatttatctctctcaatcgtgtgcagtttttactacgtgcctcactcctttctctgtgatatgatcacaccgttccaagtccaattg 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52092674 acaacctcgtatatttatctctctcaatcgtgtgcagtttttactacgtgcctcactcctttctctgtgatatgatcacaccgttccaagtccaattg 52092771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 14 - 205
Target Start/End: Original strand, 52082387 - 52082575
Alignment:
14 acaaaaatgagagggagccataatcttaatttctcaatgatgaccttgaaaataccatcatcgtccagaaattaacatcaacacacacctcacgacaacc 113  Q
    ||||||||||||||||||||||||     |||||||||||||||||| ||| |||||||| | ||||||||||||||||| ||||||| | | ||||| |    
52082387 acaaaaatgagagggagccataat----ttttctcaatgatgaccttaaaattaccatcaccatccagaaattaacatcagcacacacattatgacaatc 52082482  T
114 tcgtatatttatctctctcaatcgtgtgcagtttt-tactacgtgcctcactcctttctctgtgatatgatcacaccgttccaagtccaattg 205  Q
     |  | |||||||||||||| |||||||||||||| |||||||||||  ||||||||||||||||||||||||||||||||||||||||||||    
52082483 ccacaaatttatctctctcagtcgtgtgcagttttctactacgtgcccgactcctttctctgtgatatgatcacaccgttccaagtccaattg 52082575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 179
Target Start/End: Complemental strand, 514931 - 514859
Alignment:
108 acaacctcgtatatttatctctctcaatcgtgtgcagttttt-actacgtgcctcactcctttctctgtgata 179  Q
    |||||||| || ||| |||||||||| ||||||||||||||| || || ||| |||||||  |||||||||||    
514931 acaacctcttaaattgatctctctcagtcgtgtgcagtttttcaccacatgcttcactcccgtctctgtgata 514859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 18503 times since January 2019
Visitors: 1569