View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9343-LTR4-TNT-insertion-1 (Length: 182)

Name: F9343-LTR4-TNT-insertion-1
Description: F9343-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9343-LTR4-TNT-insertion-1
[»] chr8 (1 HSPs)
chr8 (10-174)||(41359385-41359549)

Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 10 - 174
Target Start/End: Complemental strand, 41359549 - 41359385
10 ccatcacctcctctctctttcaccacccccggtaacactcaataacagcaatagtgatataatacaaaacgtttcaaatgcaacgcatttcacacagata 109  Q
41359549 ccatcacctcctctctctttcaccacccccggtaacactcaataacagcaatagtgatataatacaaaacgtttcaaatgcaacgcatttcacacagata 41359450  T
110 ttattactagggtttcaaatcggcaaaataggacaatctagattttaatttgaaattttatatta 174  Q
41359449 ttattactagggtttcaaatcggcaaaataggacaatctagattttaatttgaaattttatatta 41359385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 41440 times since January 2019
Visitors: 1503