View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9343-LTR4-TNT-insertion-2 (Length: 293)

Name: F9343-LTR4-TNT-insertion-2
Description: F9343-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9343-LTR4-TNT-insertion-2
F9343-LTR4-TNT-insertion-2
[»] chr2 (2 HSPs)
chr2 (10-283)||(13886384-13886657)
chr2 (10-283)||(14026509-14026782)
[»] chr5 (2 HSPs)
chr5 (118-281)||(7686595-7686758)
chr5 (13-83)||(7686829-7686899)


Alignment Details
Target: chr2 (Bit Score: 274; Significance: 1e-153; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 10 - 283
Target Start/End: Complemental strand, 13886657 - 13886384
Alignment:
10 tgtttctgttccaagtcaactgcaagcaacagaagatttgataagccctagattcgggtatgtatctgcatcatacataaatgtaatactgtttactgaa 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13886657 tgtttctgttccaagtcaactgcaagcaacagaagatttgataagccctagattcgggtatgtatctgcatcatacataaatgtaatactgtttactgaa 13886558  T
110 ttcgacagtatcttattgttatgatctcttgcagcggtttttcagagtttgagataacgtactcaaatctattggagtatatttctgtcaatctgagtgc 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13886557 ttcgacagtatcttattgttatgatctcttgcagcggtttttcagagtttgagataacgtactcaaatctattggagtatatttctgtcaatctgagtgc 13886458  T
210 acaatttggaagtatatttctgtctccaatgttgatgcaatttggagaaccaatgtggagtgaacttacaatta 283  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13886457 acaatttggaagtatatttctgtctccaatgttgatgcaatttggagaaccaatgtggagtgaacttacaatta 13886384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 10 - 283
Target Start/End: Complemental strand, 14026782 - 14026509
Alignment:
10 tgtttctgttccaagtcaactgcaagcaacagaagatttgataagccctagattcgggtatgtatctgcatcatacataaatgtaatactgtttactgaa 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14026782 tgtttctgttccaagtcaactgcaagcaacagaagatttgataagccctagattcgggtatgtatctgcatcatacataaatgtaatactgtttactgaa 14026683  T
110 ttcgacagtatcttattgttatgatctcttgcagcggtttttcagagtttgagataacgtactcaaatctattggagtatatttctgtcaatctgagtgc 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14026682 ttcgacagtatcttattgttatgatctcttgcagcggtttttcagagtttgagataacgtactcaaatctattggagtatatttctgtcaatctgagtgc 14026583  T
210 acaatttggaagtatatttctgtctccaatgttgatgcaatttggagaaccaatgtggagtgaacttacaatta 283  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14026582 acaatttggaagtatatttctgtctccaatgttgatgcaatttggagaaccaatgtggagtgaacttacaatta 14026509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 118 - 281
Target Start/End: Complemental strand, 7686758 - 7686595
Alignment:
118 tatcttattgttatgatctcttgcagcggtttttcagagtttgagataacgtactcaaatctattggagtatatttctgtcaatctgagtgcacaatttg 217  Q
    ||||||||  |||||||||||||||||||| |||||| |||| |||||||||| ||||||||||  ||| ||||||||||||||||||||||||||| ||    
7686758 tatcttatcattatgatctcttgcagcggtatttcagggtttaagataacgtattcaaatctatcagagaatatttctgtcaatctgagtgcacaatatg 7686659  T
218 gaagtatatttctgtctccaatgttgatgcaatttggagaaccaatgtggagtgaacttacaat 281  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
7686658 gaagtatatttctgtctccaatgttgatgcaatttggagaaccaaagtggagtgaacttacaat 7686595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 13 - 83
Target Start/End: Complemental strand, 7686899 - 7686829
Alignment:
13 ttctgttccaagtcaactgcaagcaacagaagatttgataagccctagattcgggtatgtatctgcatcat 83  Q
    |||||||||||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||||||    
7686899 ttctgttccaagtcaacttcaagcaacggaagatttgataagccctagatttgggtatgtatctgcatcat 7686829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 109784 times since January 2019
Visitors: 1349