View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9343-LTR4-TNT-insertion-5 (Length: 473)

Name: F9343-LTR4-TNT-insertion-5
Description: F9343-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9343-LTR4-TNT-insertion-5
F9343-LTR4-TNT-insertion-5
[»] chr8 (4 HSPs)
chr8 (8-473)||(11786263-11786727)
chr8 (7-173)||(11772667-11772833)
chr8 (32-234)||(11780438-11780642)
chr8 (32-160)||(11765683-11765811)


Alignment Details
Target: chr8 (Bit Score: 397; Significance: 0; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 8 - 473
Target Start/End: Complemental strand, 11786727 - 11786263
Alignment:
8 ccagcttcagtaggatgagtagagtcaaataacaaatattcagaaggattatcacacaaatcataatcttttacttctcttttacctccacagctgtgat 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11786727 ccagcttcagtaggatgagtagagtcaaataacaaatattcagaaggattatcacacaaatcataatcttttacttctcttttacctccacagctgtgat 11786628  T
108 atccattgtaagggccactaccacagcatgctactcctccttctttcaaaccttttcatcatcaaattaagtcacaaattttagaattagataaatgtaa 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11786627 atccattgtaagggccactaccacagcatgctactcctccttctttcaaaccttttcatcatcaaattaagtcacaaattttagaattagataaatgtaa 11786528  T
208 agaaactatagcagtgtgatatttgaatgctattacaataactttttcgtatatatatacctatattacaaaactcatcatttaattgaaaactaatatc 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11786527 agaaactatagcagtgtgatatttgaatgctattacaataactttttcgtatatatatacctatattacaaaactcatcatttaattgaaaactaatatc 11786428  T
308 atgtaatttgatatgcctttaggatataacctatttcatggtaagtcaatttcataatacaaatatgcaggtcaccaaaggaataacnnnnnnnnnnnnn 407  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                 
11786427 atgtaatttgatatgcctttaggatataacctatttcatggtaagtcaatttcataatacaaatatgcaggtcaccaaaggaataac-aaaaaaaaaaaa 11786329  T
408 nnntttatatgctttgtcaattttactttctcaatcaatcaaaactgtcaaatcattcaaatgttt 473  Q
       ||||||||| ||||||||||||| |||||||||||||| |||||||||||||||| |||||||    
11786328 agatttatatgcgttgtcaattttacattctcaatcaatcataactgtcaaatcattcgaatgttt 11786263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 173
Target Start/End: Complemental strand, 11772833 - 11772667
Alignment:
7 accagcttcagtaggatgagtagagtcaaataacaaatattcagaaggattatcacacaaatcataatcttttacttctcttttacctccacagctgtga 106  Q
    ||||| |||||||||||||||||||||||| |||||||||||||||||||| |||||||| |||||| |||| |||  ||||||| ||||||| |||| |    
11772833 accagtttcagtaggatgagtagagtcaaagaacaaatattcagaaggattctcacacaagtcataacctttcactagtcttttatctccacaactgtaa 11772734  T
107 tatccattgtaagggccactaccacagcatgctactcctccttctttcaaaccttttcatcatcaaa 173  Q
    | |||||||||||||||||||||||||||||| ||  |||||||||||||||||||  |||||||||    
11772733 tttccattgtaagggccactaccacagcatgccaccgctccttctttcaaacctttatatcatcaaa 11772667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 32 - 234
Target Start/End: Complemental strand, 11780642 - 11780438
Alignment:
32 tcaaataacaaatattcagaaggattatcacacaaatcataatcttttacttctcttttacctccacagctgtgatatccattgtaagggccactaccac 131  Q
    ||||| |||||||||||||||||||| |||||||| ||||||||||| |||||||||||||||||||| |||  ||||||  | ||||| ||||| ||||    
11780642 tcaaagaacaaatattcagaaggattgtcacacaagtcataatctttcacttctcttttacctccacaactgaaatatcctctataaggtccactgccac 11780543  T
132 agcatgctactcctccttctttcaaaccttttcatcatcaaattaagtcacaaattttagaattagataa--atgtaaagaaactatagcagtgtgatat 229  Q
    | ||||| |||||| |||||||||||||||||||||||||||||||| || ||| |||||||  | ||||  || ||||||||||||| | |||| ||||    
11780542 aacatgccactcctgcttctttcaaaccttttcatcatcaaattaagccaaaaaatttagaaccaaataaatatataaagaaactataaccgtgtaatat 11780443  T
230 ttgaa 234  Q
    |||||    
11780442 ttgaa 11780438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 32 - 160
Target Start/End: Complemental strand, 11765811 - 11765683
Alignment:
32 tcaaataacaaatattcagaaggattatcacacaaatcataatcttttacttctcttttacctccacagctgtgatatccattgtaagggccactaccac 131  Q
    ||||| |||| ||||||||||||||| | |||||| ||||||||||| |||||||||||||||||||| |||| ||||||||||||||||||||||||||    
11765811 tcaaaaaacacatattcagaaggattcttacacaagtcataatctttcacttctcttttacctccacaactgtaatatccattgtaagggccactaccac 11765712  T
132 agcatgctactcctccttctttcaaacct 160  Q
    ||||||| |||||||||||||||||||||    
11765711 agcatgccactcctccttctttcaaacct 11765683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125318 times since January 2019
Visitors: 1457