View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9343-LTR4-TNT-insertion-5 (Length: 473)

Name: F9343-LTR4-TNT-insertion-5
Description: F9343-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9343-LTR4-TNT-insertion-5
[»] chr8 (4 HSPs)
chr8 (8-473)||(11786263-11786727)
chr8 (7-173)||(11772667-11772833)
chr8 (32-234)||(11780438-11780642)
chr8 (32-160)||(11765683-11765811)

Alignment Details
Target: chr8 (Bit Score: 397; Significance: 0; HSPs: 4)
Name: chr8

Target: chr8; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 8 - 473
Target Start/End: Complemental strand, 11786727 - 11786263
8 ccagcttcagtaggatgagtagagtcaaataacaaatattcagaaggattatcacacaaatcataatcttttacttctcttttacctccacagctgtgat 107  Q
11786727 ccagcttcagtaggatgagtagagtcaaataacaaatattcagaaggattatcacacaaatcataatcttttacttctcttttacctccacagctgtgat 11786628  T
108 atccattgtaagggccactaccacagcatgctactcctccttctttcaaaccttttcatcatcaaattaagtcacaaattttagaattagataaatgtaa 207  Q
11786627 atccattgtaagggccactaccacagcatgctactcctccttctttcaaaccttttcatcatcaaattaagtcacaaattttagaattagataaatgtaa 11786528  T
208 agaaactatagcagtgtgatatttgaatgctattacaataactttttcgtatatatatacctatattacaaaactcatcatttaattgaaaactaatatc 307  Q
11786527 agaaactatagcagtgtgatatttgaatgctattacaataactttttcgtatatatatacctatattacaaaactcatcatttaattgaaaactaatatc 11786428  T
308 atgtaatttgatatgcctttaggatataacctatttcatggtaagtcaatttcataatacaaatatgcaggtcaccaaaggaataacnnnnnnnnnnnnn 407  Q
11786427 atgtaatttgatatgcctttaggatataacctatttcatggtaagtcaatttcataatacaaatatgcaggtcaccaaaggaataac-aaaaaaaaaaaa 11786329  T
408 nnntttatatgctttgtcaattttactttctcaatcaatcaaaactgtcaaatcattcaaatgttt 473  Q
       ||||||||| ||||||||||||| |||||||||||||| |||||||||||||||| |||||||    
11786328 agatttatatgcgttgtcaattttacattctcaatcaatcataactgtcaaatcattcgaatgttt 11786263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 7 - 173
Target Start/End: Complemental strand, 11772833 - 11772667
7 accagcttcagtaggatgagtagagtcaaataacaaatattcagaaggattatcacacaaatcataatcttttacttctcttttacctccacagctgtga 106  Q
    ||||| |||||||||||||||||||||||| |||||||||||||||||||| |||||||| |||||| |||| |||  ||||||| ||||||| |||| |    
11772833 accagtttcagtaggatgagtagagtcaaagaacaaatattcagaaggattctcacacaagtcataacctttcactagtcttttatctccacaactgtaa 11772734  T
107 tatccattgtaagggccactaccacagcatgctactcctccttctttcaaaccttttcatcatcaaa 173  Q
    | |||||||||||||||||||||||||||||| ||  |||||||||||||||||||  |||||||||    
11772733 tttccattgtaagggccactaccacagcatgccaccgctccttctttcaaacctttatatcatcaaa 11772667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 32 - 234
Target Start/End: Complemental strand, 11780642 - 11780438
32 tcaaataacaaatattcagaaggattatcacacaaatcataatcttttacttctcttttacctccacagctgtgatatccattgtaagggccactaccac 131  Q
    ||||| |||||||||||||||||||| |||||||| ||||||||||| |||||||||||||||||||| |||  ||||||  | ||||| ||||| ||||    
11780642 tcaaagaacaaatattcagaaggattgtcacacaagtcataatctttcacttctcttttacctccacaactgaaatatcctctataaggtccactgccac 11780543  T
132 agcatgctactcctccttctttcaaaccttttcatcatcaaattaagtcacaaattttagaattagataa--atgtaaagaaactatagcagtgtgatat 229  Q
    | ||||| |||||| |||||||||||||||||||||||||||||||| || ||| |||||||  | ||||  || ||||||||||||| | |||| ||||    
11780542 aacatgccactcctgcttctttcaaaccttttcatcatcaaattaagccaaaaaatttagaaccaaataaatatataaagaaactataaccgtgtaatat 11780443  T
230 ttgaa 234  Q
11780442 ttgaa 11780438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 32 - 160
Target Start/End: Complemental strand, 11765811 - 11765683
32 tcaaataacaaatattcagaaggattatcacacaaatcataatcttttacttctcttttacctccacagctgtgatatccattgtaagggccactaccac 131  Q
    ||||| |||| ||||||||||||||| | |||||| ||||||||||| |||||||||||||||||||| |||| ||||||||||||||||||||||||||    
11765811 tcaaaaaacacatattcagaaggattcttacacaagtcataatctttcacttctcttttacctccacaactgtaatatccattgtaagggccactaccac 11765712  T
132 agcatgctactcctccttctttcaaacct 160  Q
    ||||||| |||||||||||||||||||||    
11765711 agcatgccactcctccttctttcaaacct 11765683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 211479 times since January 2019
Visitors: 2901