View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9343-LTR4-TNT-insertion-6 (Length: 859)

Name: F9343-LTR4-TNT-insertion-6
Description: F9343-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9343-LTR4-TNT-insertion-6
F9343-LTR4-TNT-insertion-6
[»] chr1 (1 HSPs)
chr1 (8-859)||(30238385-30239236)


Alignment Details
Target: chr1 (Bit Score: 827; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 827; E-Value: 0
Query Start/End: Original strand, 8 - 859
Target Start/End: Original strand, 30238385 - 30239236
Alignment:
8 ggaccatcattattgagcagaaggtagcaaaagtaaactatgataaactattcatgataatattgtttttatttttatcaaccataaatcagaaagtggc 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30238385 ggaccatcattattgagcagaaggtagcaaaagtaaactatgataaactattcatgataatattgtttttatttttatcaaccataaatcagaaagtggc 30238484  T
108 attaagtactaggtgcttcattgtgttggtgacacttgaaaaaactcacctttcatgatgttttttcatttgtttgagtaatacaatgaaactctcaagg 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30238485 attaagtactaggtgcttcattgtgttggtgacacttgaaaaaactcacctttcatgatgttttttcatttgtttgagtaatacaatgaaactctcaagg 30238584  T
208 atgtatagctttcaaagaaatcaattgatgaagtttcaaaggaaaacaagagttacctcttcagtgacacttggtaataataatgttcaaagaagcgtta 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30238585 atgtatagctttcaaagaaatcaattgatgaagtttcaaaggaaaacaagagttacctcttcagtgacacttggtaataataatgttcaaagaagcgtta 30238684  T
308 cacttgagtgttgctctttgtcatttattgtnnnnnnnctattttgtaagttgaagaattgttggaaacaatctcttgggtggaaaaggagcagtccaca 407  Q
    |||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30238685 cacttgagtgttgctctttgtcatttattgtaaaaaaactattttgtaagttgaagaattgttggaaacaatctcttgggtggaaaaggagcagtccaca 30238784  T
408 gtatagctatgatcttcaaagctattgtctcaactttgatgatggcacttcaaatgattgtatgattccgtctcgtgtttgttgatgatcttttcgttta 507  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30238785 gtatagctatgatcttcaaagctattgtctcaactttgatgatggcacttcaaatgattgtatgattccgtctcgtgtttgttgatgatcttttcgttta 30238884  T
508 atctattcgctatttttctgaattgtgattaagttgatctagtgtttgttgttgttctgtaatcatatgataaaatactacacaaagttgcataattgta 607  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30238885 atctattcgctatttttctgaattgtgattaagttgatctagtgtttgttgttgttctgtaatcatatgataaaatactacacaaagttgcataattgta 30238984  T
608 aattgatttcagatctttgttatccaacaagttttgcttagtgaagagtttggttgaaacttagaactaatgtgctatgttacatacgatttcaacctta 707  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
30238985 aattgatttcagatctttgttatccaacaagttttgcttagtgaagagtttggttgaaacttagaactaatgtgttatgttacatacgatttcaacctta 30239084  T
708 aatctggacatgtgtctcaacgagtctaacccttttcttgatccattcctcattggtagctgaaatgttgatttaaattatcacatttatgtataaataa 807  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30239085 aatctggacatgtgtctcaacgagtctaacccttttcttgatccattcctcattggtagctgaaatgttgatttaaattatcacatttatgtataaataa 30239184  T
808 ttacttccgttgttgaataagggtgataaaccattaagctcgggactagacg 859  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
30239185 ttacttccgttgttgaataagggtgataaaccattaagctcgggactagacg 30239236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 295119 times since January 2019
Visitors: 3015