View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9343-LTR4-TNT-insertion-6 (Length: 859)

Name: F9343-LTR4-TNT-insertion-6
Description: F9343-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9343-LTR4-TNT-insertion-6
[»] chr1 (1 HSPs)
chr1 (8-859)||(30238385-30239236)

Alignment Details
Target: chr1 (Bit Score: 827; Significance: 0; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 827; E-Value: 0
Query Start/End: Original strand, 8 - 859
Target Start/End: Original strand, 30238385 - 30239236
8 ggaccatcattattgagcagaaggtagcaaaagtaaactatgataaactattcatgataatattgtttttatttttatcaaccataaatcagaaagtggc 107  Q
30238385 ggaccatcattattgagcagaaggtagcaaaagtaaactatgataaactattcatgataatattgtttttatttttatcaaccataaatcagaaagtggc 30238484  T
108 attaagtactaggtgcttcattgtgttggtgacacttgaaaaaactcacctttcatgatgttttttcatttgtttgagtaatacaatgaaactctcaagg 207  Q
30238485 attaagtactaggtgcttcattgtgttggtgacacttgaaaaaactcacctttcatgatgttttttcatttgtttgagtaatacaatgaaactctcaagg 30238584  T
208 atgtatagctttcaaagaaatcaattgatgaagtttcaaaggaaaacaagagttacctcttcagtgacacttggtaataataatgttcaaagaagcgtta 307  Q
30238585 atgtatagctttcaaagaaatcaattgatgaagtttcaaaggaaaacaagagttacctcttcagtgacacttggtaataataatgttcaaagaagcgtta 30238684  T
308 cacttgagtgttgctctttgtcatttattgtnnnnnnnctattttgtaagttgaagaattgttggaaacaatctcttgggtggaaaaggagcagtccaca 407  Q
    |||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30238685 cacttgagtgttgctctttgtcatttattgtaaaaaaactattttgtaagttgaagaattgttggaaacaatctcttgggtggaaaaggagcagtccaca 30238784  T
408 gtatagctatgatcttcaaagctattgtctcaactttgatgatggcacttcaaatgattgtatgattccgtctcgtgtttgttgatgatcttttcgttta 507  Q
30238785 gtatagctatgatcttcaaagctattgtctcaactttgatgatggcacttcaaatgattgtatgattccgtctcgtgtttgttgatgatcttttcgttta 30238884  T
508 atctattcgctatttttctgaattgtgattaagttgatctagtgtttgttgttgttctgtaatcatatgataaaatactacacaaagttgcataattgta 607  Q
30238885 atctattcgctatttttctgaattgtgattaagttgatctagtgtttgttgttgttctgtaatcatatgataaaatactacacaaagttgcataattgta 30238984  T
608 aattgatttcagatctttgttatccaacaagttttgcttagtgaagagtttggttgaaacttagaactaatgtgctatgttacatacgatttcaacctta 707  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
30238985 aattgatttcagatctttgttatccaacaagttttgcttagtgaagagtttggttgaaacttagaactaatgtgttatgttacatacgatttcaacctta 30239084  T
708 aatctggacatgtgtctcaacgagtctaacccttttcttgatccattcctcattggtagctgaaatgttgatttaaattatcacatttatgtataaataa 807  Q
30239085 aatctggacatgtgtctcaacgagtctaacccttttcttgatccattcctcattggtagctgaaatgttgatttaaattatcacatttatgtataaataa 30239184  T
808 ttacttccgttgttgaataagggtgataaaccattaagctcgggactagacg 859  Q
30239185 ttacttccgttgttgaataagggtgataaaccattaagctcgggactagacg 30239236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 109655 times since January 2019
Visitors: 1348